SEARCH

SEARCH BY CITATION

Keywords:

  • thrombopoietin;
  • c-Mpl;
  • hereditary thrombocythaemia

Summary

  1. Top of page
  2. Summary
  3. Patients and controls
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

Hereditary thrombocythaemia (HT) is an inherited autosomal dominant disorder. Recent studies reported six different mutations, four within the thrombopoietin (TPO) gene and two within c-Mpl (TPO receptor) gene in six unrelated families with HT. This study investigated the molecular basis of hereditary thrombocythaemia in an Israeli-Jewish family. We screened the genes for TPO and c-Mpl by amplification and sequencing of all the corresponding exons including exon/intron boundaries and promoters. In addition, plasma levels of TPO and erythropoietin (EPO) were measured. No abnormality in the TPO/c-Mpl genes has been identified in affected HT family members. Plasma TPO and EPO levels were found to be normal/low or normal respectively in the individuals affected. In conclusion, lack of a molecular lesion within either TPO or cMpl genes indicate that HT may be caused by factors other than TPO-cMpl axis in this family.

Hereditary thrombocythaemia (HT) is a rare autosomal dominant disorder characterised by elevated platelet counts; in which affected family members are asymptomatic. HT was first described by Fickers and Speck (1974), and since then more than 12 HT families have been described (Slee et al, 1981; Eyster et al, 1986; Fernandez-Robles et al, 1990; Janssen et al, 1990; Schlemper et al, 1994; Kikuchi et al, 1995; Ulibarrena et al, 1997; Jorgensen et al, 1998; Kondo et al, 1998; Kunishima et al, 1998; Wiestner et al, 1998; Ghilardi et al, 1999; Cazzola & Skoda, 2000; Steensma & Tefferi, 2002).

Thrombopoietin (TPO) is the primary regulator of megakaryocyte growth and formation of platelets through binding to its c-Mpl receptor. HT is reported to result from six different mutations, four within the gene for TPO and two within the gene for c-Mpl. The first mutation detected in a Dutch family was a G[RIGHTWARDS ARROW]C transversion in the splice donor site of intron 3 of the TPO gene (Wiestner et al, 1998) Further mutations, detected in Japanese HT patients were, a deletion of a single ΔG nucleotide at position 3856, a A[RIGHTWARDS ARROW]G substitution in the +1 position of the splice donor of intron 3 and a G[RIGHTWARDS ARROW]T substitution at position 3872 in TPO gene (Jorgensen et al, 1998; Kondo et al, 1998; Ghilardi et al, 1999). All four mutations within TPO gene in the 5′-UTR improved translation of mRNA and resulted in persistent TPO elevation (Jorgensen et al, 1998; Kondo et al, 1998; Wiestner et al, 1998; Ghilardi et al, 1999; Cazzola & Skoda, 2000). The first mutation within c-Mpl gene – a single nucleotide substitution (G1238T) was reported in African–American HT family (Moliterno et al, 2004). The second mutation resulted in a G[RIGHTWARDS ARROW]A substitution at position 1514 in exon 10 (Ding et al, 2004). The mutations within c-Mpl gene caused decreased c-Mpl expression.

The aim of our work was to study the molecular basis of HT in an Israeli-Jewish family of three generations by screening the genes for TPO and c-Mpl. The plasma levels of cytokines TPO and EPO were also measured.

Patients and controls

  1. Top of page
  2. Summary
  3. Patients and controls
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

The pedigree and laboratory characteristics of the three generations of the Israeli-Jewish family with HT are shown in Fig. 1 and Table I respectively. The family has been followed up in the Haematology outpatient clinic since 2002. Known causes of secondary thrombocytosis, such as iron deficiency or inflammation were excluded in light of normal serum iron and ferritin levels and normal erythrocyte sedimentation rate (ESR) respectively (Table I). Beside increased platelet and white blood cell (WBC) counts (Table I) all the affected family members were asymptomatic. All the affected HT family members were negative for BCR–ABL transcript and Val617Phe JAK2 mutation.

image

Figure 1.  Pedigree of the family with hereditary thrombocythaemia. The affected members are shown as half-filled symbol. The age at presentation (years) of the corresponding member is given in parenthesis. X – Deceased.

Download figure to PowerPoint

Table I.   Laboratory characteristics of family members with and without hereditary thrombocythaemia.
Pedigree (Fig. 1)TPO (pg/ml) (n = 20–100)EPO (pg/ml) (n = 3·7–19·6)WBC (× 109/l) (n = 4–10·8)Hct (%) (n = 35–47)Hb (g/dl) (n = 12–18)Platelets (× 109/l) (n = 350–550)Iron (μmol/l) (n = 8·95–26·8)Ferritin (μg/l) (n = 18–300)ESR (mm/h) (n = 2–20)
  1. TPO, thrombopoietin; EPO, erythropoietin; ESR, erythrocyte sedimentation rate; NM, not measured; N, normal range.

  2. *Affected members.

I-1*11·19·31539·713·749015·730·913·4
I-278·29·88·44215312NMNMNM
II-1*44·215·5143913·2050611·62511·6
II-3*336·814·5381349613·325·913·1
II-428·17·86·841·714·3263NMNMNM
III-134·510·91036·913·2035310·530·312·8
III-2*16·36·313·53612·24899·8520·310·5

For a comparison analysis of TPO and EPO levels (see below), 25 patients with essential thrombocythaemia (ET) and 50 healthy volunteers were included. The age of the ET patients ranged between 25 and 85 years, with an average platelet count of 558 × 109/l ± 219 × 109/l. All ET patients were treated with 100 mg aspirin, 17 patients also received hydroxycarbamide (14 patients), Anagrelide (two patients) or Busulfan (one patient). The control population consisted of healthy individuals aged 31–70 years old with an average platelet count of 327 × 109/l ± 69 × 109/l. The study was approved by the Institutional Human Subject Ethics Committee of the Hospital.

Materials and methods

  1. Top of page
  2. Summary
  3. Patients and controls
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

TPO and c-Mpl gene sequence analysis

Genomic DNA was extracted from peripheral blood leucocytes using a standard procedure (Miller et al, 1988). Exons 1–6 of TPO and 1–12 of c-Mpl genes, consisting of coding regions and intron/exon boundaries, were amplified by polymerase chain reaction (PCR) using Taq DNA polymerase (Abgene, Epsom, UK) and specifically designed primers (Table II).The PCR products were purified using High pure PCR product Purification kit (Roche Diagnostics GmbH, Mannheim, Germany) and subjected to direct sequencing (Automatic sequencer ABI Prism 377; Perkin Elmer, Foster City, CA, USA).

Table II.   Primers for amplification and sequencing of thrombopoietin gene and c-Mpl gene
(Fragment length) (bp)Position (nucleotide)Reverse primer (5′−3′)Forward primer (5′−3′)TPO gene Exon no.
5971517–2114CATAACCCCACACCCTGCTGCTCATGTGGGCAATATCCGTG1 + promoter
5703719–4289GTTGGGAGTTCTCACCAGTCTGGAAACTTGGTTAAATGTTCAC2 + 3
1674518–4685GGACTTAGGGAAGCCAAGGTCTATTTCAGCTCCCTTCTCCC4
5706540–7110GCCTGACGCAGAGGGTGGCTTTGAGGCAGTGCGCTTC5 + 6a
5997068–7667CGGCAGTGTCTGAGAACCTTACCGTTTCCTGATGCTTGTAG6b
    c-MPL gene Exon no.
521851–1372GACAGATACATGGGGAGTGGTGTATCTGACAGGAACCTGAG1 + 2
2701611–1881TCTGATTCCGGGAGCTGGCTGTGTAGGAGGGACCTC3
3592341–2700AGAGGAGGGGCAGAAGAAGGCAGAGTTCTGATGTGCCCTG4
6283021–3649CATGCACCAACCTCAATCAGGACAGGCAGACCTAGATTGTG5 + 6
568170–738CTGCGTAGTGAGGTCTGTGGGCAGGCCTGATTCAATGACTC7 + 8
245568–813AGGCGCTGTGCGGCTTTGGCTATCGAAGCCCCGACG9
159996–1155CCGCCAGTCTCCTGCCTGTGGGCCGAAGTCTGACCC10
513315–828ATGGGTGGGCACACAGACCCATGGCTCAGTCTGCTTCT11
561844–1405CTCAAAGAGGCAGGACCAAGCTGCTGTACCACCCACATTG12 and 3′-untranslated region

TPO and EPO measurements in serum

Serum was obtained by centrifuging blood samples for 15 min at 3000 g. Serum TPO was measured by enzyme-linked immunosorbent assay, as previously published (Tahara et al, 1996). EPO levels were measured by Immulite 2000, a solid-phase chemiluminescent immunometric assay (Pharmatide, Los Angeles, CA, USA).

Statistical analyses

The unpaired Student's t-test was used to compare variables between patients and controls. P < 0·05 was considered statistically significant.

Results

  1. Top of page
  2. Summary
  3. Patients and controls
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

Molecular analysis of TPO and c-Mpl gene

All 6 exons of TPO gene and 12 exons of c-Mpl gene, including promoters and intron/exon boundaries, were amplified by PCR using the specific primers shown in Table II, followed by direct sequencing. No alternations within each of the genes were found.

As shown in Table I, all the affected members had elevated platelet counts and normal hemoglobin levels. In addition, an increased WBC count was observed in all the affected family members, similar to previously published reports on HT (Kikuchi et al, 1995; van Dijken et al, 1996; Kunishima et al, 1998; Wiestner et al, 1998, 2000).

The serum levels of TPO and EPO are presented in Table I. Normal EPO levels were found in the affected family members. Low TPO levels were found in two affected family members (I-1, III-2), but normal in another two (II-I, II-3).

Serum TPO levels of affected family members were significantly lower than those observed in 25 ET patients and 50 healthy volunteers (Fig. 2; P < 0·01).

image

Figure 2.  Thrombopoietin (TPO) levels of hereditary thrombocythaemia (HT) family members, essential thrombocythaemia (ET) patients and controls +HT or −HT indicates presence or absence of HT respectively, in the family members. The values are presented as mean ± SD. *P < 0·01 vs. ET or control.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Summary
  3. Patients and controls
  4. Materials and methods
  5. Results
  6. Discussion
  7. References

In the present study, no mutations were found in the candidate genes for HT, namely, TPO and c-Mpl in the affected HT family members. Although six mutations in previously published reports were identified in either TPO or cMpl (Jorgensen et al, 1998; Kondo et al, 1998; Wiestner et al, 1998; Ghilardi et al, 1999; Ding et al, 2004; Moliterno et al, 2004), no mutations in TPO/cMpl genes were detected in four families with HT in another three reports (Kunishima et al, 1998; Wiestner et al, 2000 and Fujiwara et al, 2004). Thus, our and previously published families indicate that HT is a genetically heterogeneous disorder that may stem from impairment in other factors beside the TPO-c-Mpl axis.

In ET patients, plasma TPO levels are elevated or inappropriately normal in the face of thrombocytosis (Horikawa et al, 1997). The inappropriately elevated levels of plasma free TPO encountered in ET are due, at least in part, to either a clonal defect in platelet/megakaryocyte expression or downregulation of TPO-cMpl causing impaired binding and clearance of TPO (Horikawa et al, 1997; Teofili et al, 2002). Despite the reduced binding of TPO to megakaryocytes in ET, these progenitors are also markedly hypersensitive to the action of the hormone, leading to increased megakaryocytopoiesis and platelet production (Axelrad et al, 2000). Similarly to ET, increased TPO levels were reported in patients with HT and TPO mutations (Kondo et al, 1998; Wiestner et al, 1998; Ghilardi et al, 1999). TPO levels were not reported in patients with c-Mpl mutations (Ding et al, 2004; Moliterno et al, 2004).

In the present study, normal TPO levels were found in two affected HT family members but low levels were measured in another two, therefore, the average level of TPO in all the affected HT members was lower than that measured in serum from ET patients. In previously reported HT families without mutations in either TPO or c-Mpl genes the affected family members had normal to high TPO levels (Kunishima et al, 1998; Wiestner et al, 2000; Fujiwara et al, 2004). Thus, TPO levels can vary between HT patients, and therefore, cannot serve as a diagnostic marker for HT.

In summary, in the presented family the genes for TPO and cMpl were not responsible for thrombocythaemia, implying that other causes beside the TPO/c-Mpl pathway may be involved in the pathogenesis of HT.

References

  1. Top of page
  2. Summary
  3. Patients and controls
  4. Materials and methods
  5. Results
  6. Discussion
  7. References
  • Axelrad, A.A., Eskinazi, D., Correa, P.N. & Amato, D. (2000) Hypersensitivity of circulating progenitor cells to megakaryocyte growth and development factor (PEG-rHu MGDF) in essential thrombocythemia. Blood, 96, 33103321.
  • Cazzola, M. & Skoda, R.C. (2000) Translational pathophysiology: a novel molecular mechanism of human disease. Blood, 95, 32803288.
  • Van Dijken, P.J., Woldendorp, K.H. & Van Wouwe, J.P. (1996) Familial thrombocytosis in infancy presenting with a leukaemoid reaction. Acta Paediatrica, 85, 11321134.
  • Ding, J., Komatsu, H., Wakita, A., Kato-Uranishi, M., Ito, M., Satoh, A., Tsuboi, K., Nitta, M., Miyazaki, H., Iida, S. & Ueda, R. (2004) Familial essential thrombocythemia associated with a dominant-positive activating mutation of the c-MPL gene, which encodes for the receptor for thrombopoietin. Blood, 103, 41984200.
  • Eyster, M.E., Saletan, S.L., Rabellino, E.M., Karanas, A., McDonald, T.P., Locke, L.A. & Luderer, J.R. (1986) Familial essential thrombocythemia. American Journal of Medicine, 80, 497502.
  • Fernandez-Robles, E., Vermylen, C., Martiat, P., Ninane, J. & Cornu, G. (1990) Familial essential thrombocythemia. Pediatric Hematology and Oncology, 7, 373376.
  • Fickers, M. & Speck, B. (1974) Thrombocythaemia. Familial occurrence and transition into blastic crisis. Acta Haematologica, 51, 257265.
  • Fujiwara, T., Harigae, H., Kameoka, J., Yokoyama, H., Takahashi, S., Tomiya, Y., Yamada, M., Ishizawa, K., Imaizumi, M. & Sasaki, T. (2004) A case of familial thrombocytosis: possible role of altered thrombopoietin production. American Journal of Hematology, 76, 395397.
  • Ghilardi, N., Wiestner, A., Kikuchi, M., Ohsaka, A. & Skoda, R.C. (1999) Hereditary thrombocythaemia in a Japanese family is caused by a novel point mutation in the thrombopoietin gene. British Journal of Haematology, 107, 310316.
  • Horikawa, Y., Matsumura, I., Hashimoto, K., Shiraga, M., Kosugi, S., Tadokoro, S., Kato, T., Miyazaki, H., Tomiyama, Y., Kurata, Y., Matsuzawa, Y. & Kanakura, Y. (1997) Markedly reduced expression of platelet c-mpl receptor in essential thrombocythemia. Blood, 90, 40314038.
  • Janssen, J.W., Anger, B.R., Drexler, H.G., Bartram, C.R. & Heimpel, H. (1990). Esential thrombocythemia in two sisters originating from different stem cell levels. Blood, 75, 16331636.
  • Jorgensen, M.J., Raskind, W.H., Wolff, J.F., Bachrach, H.R. & Kaushansky, K. (1998) Familial thrombocytosis associated with overproduction of thrombopoietin due to a novel splice donor site mutation. (Abstract). Blood, 92(Suppl. 1), 205a.
  • Kikuchi, M., Tayama, T., Hayakawa, H., Takahashi, I., Hoshino, H. & Ohsaka, A. (1995) Familial thrombocytosis. British Journal of Haematology, 89, 900902.
  • Kondo, T., Okabe, M., Sanada, M., Kurosawa, M., Suzuki, S., Kobayashi, M., Hosokawa, M. & Asaka, M. (1998) Familial essential thrombocythemia associated with one-base deletion in the 5′-untranslated region of the thrombopoietin gene. Blood, 92, 10911096.
  • Kunishima, S., Mizuno, S., Naoe, T., Saito, H. & Kamiya, T. (1998) Genes for thrombopoietin and c-mpl are not responsible for familial thrombocythaemia: a case study. British Journal of Haematology, 100, 383386.
  • Miller, S.A., Dykes, D.D. & Polesky, H.F. (1988) A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Research, 16, 1215.
  • Moliterno, A.R., Williams, D.M., Gutierrez-Alamillo, L.I., Salvatori, R., Ingersoll, R.G. & Spivak, J.L. (2004) Mpl Baltimore: a thrombopoietin receptor polymorphism associated with thrombocytosis. Proceedings National Academy of Science of the United States of America, 101, 1144411447.
  • Schlemper, R.J., Van Der Maas, A.P. & Eikenboom, J.C. (1994) Familial essential thrombocythemia: clinical characteristics of 11 cases in one family. Annals of Hematology, 68, 153158.
  • Slee, P.H., Van Everdingen, J.J., Geraedts, J.P., Te Velde, J. & Den Ottolander, G.J. (1981) Familial myeloproliferative disease. Hematological and cytogenetic studies. Acta Medica Scandinavica, 210, 321327.
  • Steensma, D.P. & Tefferi, A. (2002) Cytogenetic and molecular genetic aspects of essential thrombocythemia. Acta Haematologica, 108, 5565.
  • Tahara, T., Usuki, K., Sato, H., Ohashi, H., Morita, H., Tsumura, H., Matsumoto, A., Miyazaki, H., Urabe, A. & Kato, T. (1996). A sensitive sandwich ELISA for measuring thrombopoietin in human serum: serum thrombopoietin levels in healthy volunteers and in patients with haemopoietic disorders. British Journal of Haematology, 93, 783788.
  • Teofili, L., Pierconti, F., Di Febo, A., Maggiano, N., Vianelli, N., Ascani, S., Rossi, E., Pileri, S., Leone, G., Larocca, L.M. & De Stefano, V. (2002) The expression pattern of c-mpl in megakaryocytes correlates with thrombotic risk in essential thrombocythemia. Blood, 100, 714717.
  • Ulibarrena, C., Vecino, A.M., Odriozola, J. & Cesar, J.M. (1997) [Familial essential thrombocythemia associated with von Willebrand disease]. Medicina Clinica (Barcelona), 109, 237.
  • Wiestner, A., Schlemper, R.J., Van Der Maas, A.P. & Skoda, R.C. (1998) An activating splice donor mutation in the thrombopoietin gene causes hereditary thrombocythaemia. Nature Genetics, 18, 4952.
  • Wiestner, A., Padosch, S.A., Ghilardi, N., Cesar, J.M., Odriozola, J., Shapiro, A. & Skoda, R.C. (2000) Hereditary thrombocythaemia is a genetically heterogeneous disorder: exclusion of TPO and MPL in two families with hereditary thrombocythaemia. British Journal of Haematology, 110, 104109.