SEARCH

SEARCH BY CITATION

Keywords:

  • hepcidin;
  • p53;
  • iron;
  • cancer;
  • inflammation;
  • anaemia

Summary

  1. Top of page
  2. Summary
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Hepcidin is an iron-regulatory protein that is upregulated in response to increased iron or inflammatory stimuli. Hepcidin reduces serum iron and induces iron sequestration in the reticuloendothelial macrophages – the hallmark of anaemia of inflammation. Iron deprivation is used as a defense mechanism against infection, and it also has a beneficial effect on the control of cancer. The tumour-suppressor p53 transcriptionally regulates genes involved in growth arrest, apoptosis and DNA repair, and perturbation of p53 pathways is a hallmark of the majority of human cancers. This study inspected a role of p53 in the transcriptional regulation of hepcidin. Based on preliminary bioinformatics analysis, we identified a putative p53 response-element (p53RE) contained in the hepcidin gene (HAMP) promoter. Chromatin immunoprecipitation (ChIP), reporter assays and a temperature sensitive p53 cell-line system were used to demonstrate p53 binding and activation of the hepcidin promoter. p53 bound to hepcidin p53RE in vivo, andthis p53RE could confer p53-dependent transcriptional activation. Activation of p53 increased hepcidin expression, while silencing of p53 resulted in decreased hepcidin expression in human hepatoma cells. Taken together, these results define HAMP as a novel transcriptional target of p53. We hypothesise that hepcidin upregulation by p53 is part of a defence mechanism against cancer, through iron deprivation. Hepcidin induction by p53 might be involved in the pathogenesis of anaemia accompanying cancer.

Hepcidin regulates iron efflux from enterocytes and other cells, such as hepatocytes and reticuloendothelial macrophages, by internalisation and degradation of ferroportin, the iron exporter of these cells (Nemeth et al, 2004a). Therefore, hepcidin serves as a regulator of iron absorption and distribution. Hepcidin is upregulated in response to increased body iron levels (Gehrke et al, 2003) or to inflammation (Nemeth et al, 2004b), and is downregulated in response to hypoxia, anaemia (Nicolas et al, 2002; Adamsky et al, 2004) and oxidative stress (Choi et al, 2007). An increase in hepcidin expression during infection or inflammation results in a decrease in iron availability (Means, 2000) through retention of iron by reticuloendothelial macrophages and decreased intestinal iron absorption. Recently, hepcidin has been shown to directly bind iron during expression in Escherichia. coli, revealing yet another potential role of hepcidin as an intracellular iron sequestering molecule (Gerardi et al, 2005).

Decreased plasma iron by its sequestration in macrophages and decreased intestinal iron absorption is thought to be the mechanism of anaemia of inflammation. As bacteriae depend on iron for their growth, dietary iron deprivation has been shown to have a beneficial effect in infectious diseases such as malaria, tuberculosis and candidiasis (Weinberg, 1999a). Restriction of dietary iron also showed beneficial effects in non-infectious inflammatory conditions, such as ulcerative colitis (Barollo et al, 2004), joint inflammation (Andrews et al, 1987) and bleomycin-induced pulmonary fibrosis (Chandler et al, 1988). Cancer cells also depend on iron for their proliferation. Several studies have shown that iron deprivation inhibits in-vitro tumour growth (Weinberg, 1999b; Gao & Richardson, 2001). Iron chelators inhibit the growth and induce the apoptosis of human Kaposi sarcoma-derived cells (Simonart et al, 2000) and treatment by iron chelation has been shown to have an anti proliferative effect in leukaemia, neuroblastoma (Richardson, 2002), lymphoma (Kemp et al, 1995) and breast cancer (Yang et al, 2001). Iron chelators have also been shown to inhibit the expression of vascular cell adhesion molecule-1 (VCAM-1), which is known to support angiogenesis and accounts for inflammation-augmented tumour development (Vidal-Vanaclocha et al, 2000; Nakao et al, 2003).

The molecular mechanisms controlling hepicidin gene (HAMP) expression are only starting to unfold. The HAMP promoter contains binding motifs for CCAAT/enhancer-binding protein (C/EBP), hepatocyte nuclear factor 4 (HNF4) (Courselaud et al, 2002), signal transducer and activator of transcription 3 (STAT3) (Pietrangelo et al, 2007) and SMAD4 (Milward et al, 2007), suggesting their role in controlling hepcidin synthesis.

P53 is a key tumour-suppressor gene. It is activated in response to a variety of cellular and genotoxic stress conditions, leading to the induction of growth arrest, apoptosis, DNA repair, senescence and differentiation (Vousden & Lu, 2002). p53 also regulates genes that participate in cell-to-cell communication (Komarova et al, 1998), and in the regulation of angiogenic signals to endothelial cells (Nishizaki et al, 1999). Many studies have shown that p53 exerts its various functions mainly as a transcription factor that regulates the expression of its target genes via a consensus DNA binding site (el-Deiry et al, 1992). P53 is mutated or lost in approximately half of human cancer cases worldwide (Levine et al, 1991). However, many human cancers are characterised by P53 that is only rarely mutated (Preudhomme et al, 1992; Neri et al, 1993; Corradini et al, 1994; Borsellino et al, 1995; Yasuga et al, 1995; Hangaishi et al, 1996), and about half of all human cancers are characterised by increased P53 expression, in many instances of the wild-type P53 allele (Shaulsky et al, 1991a,b; Moll et al, 1995; Ostermeyer et al, 1996; Levine, 1997). Increased levels of wild-type P53 have been found in subsets of human cancers, including neuroblastomas, mesotheliomas, and breast, colon and pancreatic cancer (Niedobitek et al, 1993; Bosari et al, 1995; Theobald et al, 1995; Gudas et al, 1996; Ropke et al, 1996; Chen & Carbone, 1997; Moretta, 1997).

We show here that the human HAMP promoter contains a p53-response element (p53RE). The p53 protein binds to this RE in vivo. Luciferase reporter assays revealed that the human HAMP promoter can confer p53-dependent transcriptional activation through the p53RE. HAMP mRNA levels increased in response to activation of P53 in human hepatoma cells. We suggest another mechanism of tumour suppression for p53 protein: iron deprivation from cancer cells by upregulation of HAMP expression. This affect may also tie p53 to the pathogenesis of anaemia of malignancy.

Materials and methods

  1. Top of page
  2. Summary
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Cell cultures

The human hepatoma HepG2 cell line (ATCC HB-8065; American Type Culture Collection, Manassas, VA, USA) was maintained at 37°C in RPMI-1640 medium containing 10% fetal calf serum (FCS). The human hepatoma Hep3B cell line (lacking endogenous P53) expressing the mouse temperature sensitive mutant p53Val135 (ts-p53Val135) was used in this study (Michalovitz et al, 1990). The ts-p53Val135 assumes wild-type p53 conformation on temperature shift to 32°C. This Hep3B cell line was maintained at 37°C in Dulbecco's modified Eagles medium (DMEM) containing 10% FCS. We also used human osteosarcoma U2OS cell-line and human lung adenocarcinoma H1299 cell-line (Kindly provided by D. Givol from the Weizmann Institute of Science, Rehovot, Israel). U2OS was maintained at 37°C in DMEM containing 10% FCS. H1299 was maintained at 37°C in RPMI-1640 medium containing 10% FCS.

Chromatin immunoprecipitation assay

Chromatin immunoprecipitation (ChIP) analysis in the HepG2 cells was performed using the EZ-ChIP kit, according to the manufacturer's protocol (Upstate Biotechnology, Inc., Lake Placid, NY, USA). Immunoprecipitation was done with either anti-p53 antibody (Upstate Biotechnology, BP53-12) or anti-Fli1 antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA). Primers used for the HAMP promoter were as follows (5′ to 3′): Forward, CAACATGCCAGACACTCCTGA; Reverse, GAATCAAGGTTCCGCTCTCCT. Primers used for the p21 (WAF1/CIP1) promoter 100 bp upstream of the 5′ p53RE were as follows: Forward, GCACTCTTGTCCCCCAG; Reverse, TCTA TGCCAGAGCTCAACAT. Primers used for glyceraldehydes-3-phosphate dehydrogenase (GAPDH) exon 4 were as follows: Forward, GTATTCCCCCAGGTTTACAT; Reverse, TTCTGTC TTCCACTCACTCC. ChIP assays were also performed using U2OS cell-line.

Plasmid constructs

To create a luciferase construct for HAMP, a 1036-bp fragment of the 5′-flanking genomic region of HAMP (in position −1013 to +23 in relation to the transcription start site) was isolated from human placenta DNA, subcloned into the pGEM-T Easy vector (Promega, Madison, WI, USA) and then cloned into the KpnI/HindIII site of the pGL3-Basic luciferase reporter vector (Promega). The primers for polymerase chain reaction (PCR) of the fragment were as follows (5′ to 3′): Forward, GTACTCATCG GACTGTAGATG; Reverse, CAGATCTGGGAGCTCAGTGC. KpnI and HindIII sites were added to the 5′ end of the forward and reverse primers respectively.

MDM2 luciferase reporter construct containing the p53REs was kindly given by Moshe Oren, Weizmann Institute of Science, Rehovot, Israel.

The pSuper-p53 siRNA and a mock pSUPER plasmids (Brummelkamp et al, 2002) were kindly donated by Yosef Shiloh, Sackler Faculty of Medicine, Tel Aviv University, Tel Aviv, Israel.

Site-directed mutagenesis

Site-directed mutagenesis was performed using the QuikChange XL site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA), according to the manufacturer's protocol. The abovementioned wild-type HAMP construct served as a template for generating mutant HAMP p53RE reporter constructs. The Primers used for inserting the mutations in the HAMP p53RE were (5′ to 3′; the mutated nucleotides are underlined): G7A – Sense, GGCTGCTGGCCATACC CCGTGTGCATG; antisense, CATGCACACGGGGTATGGCCAGCAGCC; G20A – Sense, GCCCCGTGTGCATATAGGCGATGGGG-3′; anti-sense CCCCATCGCCTATATGCACACGGGGC. Three constructs were generated using these primers: G7A, G20A and G7A + G20A (which contains mutations in both sites). Human wild-type p53-expressing construct (pCMV) was used as template for generating two different human mutated p53-expressing constructs – H179R (Ashur-Fabian et al, 2007) and 342-stop (Zhou et al, 1999). All mutations were confirmed by DNA sequencing, using the ABI PRISM 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA).

Transient transfections

HepG2 and H1299 cells were used for transient transfection assays with the JetPEI transfection reagent (Polyplus-transfection Inc., San Marcos, CA, USA), according to the manufacturer's protocol. The plasmids added were 1 μg of either the wild-type or the mutated hepcidin luciferase reporter constructs or the MDM2 luciferase reporter construct (pGL3-basic; Promega), and either 1 μg of wild-type P53 (pCDNA3, Promega) or 1 μg of mutant P53-H179R (pCDNA3; Promega) or 1 μg of mutant 342-stop P53. The dual luciferase reporter assay system (Promega) was used for measuring the level of Firefly luciferase activity, and for normalising the results to Renilla luciferase activity (CMV vector; Promega). For experiments with interleukin-6 (IL-6), the transfected HepG2 cells were incubated overnight with 2 ng/ml IL-6 (Peprotech, Rocky Hill, NJ, USA).

Small interfering RNA

For small interfering (si)RNA-mediated inhibition of P53 expression, HepG2 cells were plates at 300 000 cells per well in 6-well plates. Transient transfections were performed using the JetPEI transfection reagent (Polyplus-transfection Inc.), according to the manufacturer's protocol. The plasmids added were 0·5 μg of either the pSuper-p53 siRNA construct or the pSuper empty plasmid. The transfected cells were harvested 72 h after transfection, and mRNA levels were determined using quantitative real-time polymerase chain reaction (QPCR).

Quantitative real-time PCR analysis

The QPCR was performed using the SYBR Green PCR Master Mix (Applied Biosystems), according to the manufacturer's protocol, with the ABI PRISM 7900HT Sequence Detection System (Applied Biosystems). Samples were normalised to β-actin. The primers used were as follows (5′ to 3′): HAMP– Forward, CCACAACAGACGGG ACAACTT; Reverse, CAGCAGCCGCAGCAGAA; P53– Forward, AGCCTCACCCCGAGCTGC; Reverse, GCTCACGCCCACGGATC-3′; MDM2– Forward, CAAGTTACTGTGTATCAGGCAGGG; Reverse, TCATTGCATGAAGTGCATTTCC; β-actin (ACTB) – Forward, TGTGGCATCCACGAAACTACC; Reverse, CTCAGGAGGAGCAATGATCTTGAT. All reactions were run in duplicates.

Statistics

Mean ± standard deviation was calculated and comparisons between groups were made by Student's paired t-test. A value of P < 0·05 was accepted as statistically significant.

Results

  1. Top of page
  2. Summary
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

The Hepcidin promoter contains a p53RE

The MatInspector and p53HM (Hoh et al, 2002) algorithms were utilised to search for p53REs in the genomic sequence upstream of HAMP. We found a putative p53RE at −435 to −413 (5′ to 3′, all positions are relative to the transcription start site): GGCCATGCCCCGTGTGCATGTAG (the 2 decamers of the p53RE are underlined, mismatches to the consensus p53RE are in bold) (Fig 1). All the deviations from the consensus p53RE are in the less conserved residues, predicted not to severely affect p53-binding to this site. Using rVista 2·0 analyzer (Loots & Ovcharenko, 2004) we also found a putative p53RE contained in the Rattus norvegicus hepcidin promoter (sequence GGACACCACGGCGCATGTTG, position −501 relative to the transcription start site), which was not aligned with the human one.

image

Figure 1.  p53 responsive element (p53RE) on hepcidin promoter. Diagram illustrating p53RE, identified on HAMP promoter in position −435 to −413 relative to the transcription start site. Mismatches to the consensus p53RE are in bold (panel A). A DNA fragment containing the p53RE was cloned into the KpnI/HindIII site of the pGL3-Basic luciferase reporter vector, and site-directed mutagenesis was performed to create mutations in the p53RE. The mutations, in position 7, 20 or both, are shown in bold (panel B).

Download figure to PowerPoint

The p53 protein binds to the human hepcidin p53RE in vivo

Chromatin immunoprecipitation analysis was used to determine whether HAMP p53RE is bound by p53 in vivo. Human hepatoma HepG2 cells were subjected to ChIP analysis with anti-p53 antibody. As p53-DNA binding activity is not significantly increased in response to genotoxic stress (Kaeser & Iggo, 2002), ChIP analysis was performed on untreated cells. Primers were designed to amplify a short segment of the HAMP promoter, containing the p53RE. As shown in Fig 2, this segment was amplified by PCR when using an anti-p53 antibody, but not when using the negative control antibody. These results indicate that the putative human HAMP p53RE is functional.

image

Figure 2.  p53 binds the hepcidin p53RE in vivo. HepG2 cells were subjected to ChIP analysis. Immunoprecipitation of p53 protein-DNA complexes was done with anti-p53 antibody (ap53). Negative controls were chromatin immunoprecipitated with an irrelevant antibody (aFLI1), as well as samples to which no antibody or no immunoprecipitated chromatin was added (no Ab and no DNA respectively). Input, 0·1% of the sonicated chromatin before immunoprecipitation. We validated the ChIP assay findings by primers designed to amplify the genomic region containing the p53 responsive element of p21 (CDKN1A), a known p53 target gene, as a positive control, and by primers designed for exon 4 of the GAPDH gene, as a negative control. Results displayed are representative of three independent experiments.

Download figure to PowerPoint

Similar results were obtained from the ChIP assay performed on U2OS cells (Data not shown).

The p53 protein activates transcription from the human HAMP promoter

To determine whether the putative HAMP p53RE is transcriptionally regulated by p53, a 1036-bp fragment of the 5′-flanking genomic fragment of HAMP was cloned into a luciferase reporter construct. HepG2 cells were co-transfected with this HAMP reporter construct and a wild-type or mutant (H179R or 342-stop) P53-expressing constructs. The wild-type p53 protein, but not the mutant p53, activated transcription from the HAMP promoter (Fig 3A). A similar effect was shown using an MDM2 reporter construct, a known p53-target gene (Barak et al, 1993) (Fig 3B). In addition, similar results were obtained using the P53-null H1299 lung cancer cell line (data not shown).

image

Figure 3.  p53 activates transcription from the human HAMP promoter. HepG2 cells were cotransfected with 1 μg of wild-type HAMP reporter (panel A), MDM2 reporter (panel B) or an empty vector (control), 1 μg of either wild-type P53 (WTP53) or mutated P53 (R179H and 342-stop). Results display mean ± SD of four independent experiments, each in quintuplicates.

Download figure to PowerPoint

Mutations in the putative HAMP p53RE decrease the p53-dependent activation

To further investigate the role of the HAMP p53RE in mediating the activation of HAMP transcription, we generated HAMP promoter reporter constructs bearing mutations in the p53RE in a conserved residue, (guanosine in the position 7 of each decamer) As shown in Fig 4, introducing a mutation in each or both of the decamers of the p53RE reduced activation of HAMP.

image

Figure 4.  Mutations in the hepcidin p53REs reduced activation by p53. HepG2 cells were cotransfected with 1 μg of wild-type p53-expressing construct and 1 μg of either wild-type hepcidin reporter, or mutated hepcidin p53RE reporter in each decamer (G7A or G20A) or both decamers (G7A + G20A) The p53-induced activation of the WT hepcidin p53RE, which was by an average of 4·3-fold, was considered as 100%. Results display mean ± standard deviation of three independent experiments.

Download figure to PowerPoint

HAMP activation by IL-6 is diminished by p53

Interleukin-6 is a known stimulator of HAMP expression (Nemeth et al, 2003, 2004b; Lee et al, 2005). We examined the interaction between the effects of IL-6 and P53 on HAMP transcriptional activation in HepG2 cells. The addition of IL-6 alone induced a ninefold increase in the expression of HAMP while the addition of P53 to IL-6 treated cells diminished the induction, reducing it to a fourfold increase (Fig 5). Therefore, while P53 by itself induces HAMP expression, when associated with the known potent inducer of HAMP, IL-6, p53 modifies the extent of hepcidin induction. This finding is in agreement with the known ability of p53 to regulate IL-6 signalling via STAT3 and STAT5 in human hepatoma cells (Rayanade et al, 1998).

image

Figure 5. HAMP activation by IL-6 is diminished by P53. HepG2 cells were transfected with 1 μg of wild-type hepcidin reporter and treated overnight with Interleukin-6 alone (IL-6) or with the addition of 1 μg of wild-type P53-expressing construct (WTP53 + IL-6). Control; addition of an empty vector. Results display mean ± standard deviation of four independent experiments, each in quintuplicates.

Download figure to PowerPoint

Restoration of P53 activity increases hepcidin expression

In order to validate that hepcidin is activated by p53, we used the P53-null Hep3B cells stably expressing the ts-p53Val135. Restoration of P53 activity by temperature shift resulted in marked increase in hepcidin expression similar to the increase in MDM2, a known p53 target gene (Fig 6).

image

Figure 6.  Restoration of P53 activity increases Hepcidin expression. The P53-null Hep3B cells stably transfected with ts-p53Val135 were maintained either at 37°C (inactive P53) or placed overnight at 32°C (active P53). HAMP (panel A) and MDM2 (panel B) mRNA levels were determined using QPCR, and normalised to β-actin (ACTB). Fold ratios of mRNA levels were calculated in comparison to that measured when P53 is inactive. Results display mean ± standard deviation of quantification of 4 independent experiments, each in duplicate.

Download figure to PowerPoint

siRNA silencing of P53 decreased HAMP expression

In order to further verify the transcription activation of HAMP by p53 we silenced P53 by si RNA in the P53 positive HepG2 cells. For this purpose, P53-positive HepG2 cells were transfected with a pSuper-p53 siRNA construct and expression of HAMP was determined using QPCR. We found that in P53-silenced cells, the levels of HAMP mRNA were reduced to 59% of the control (Fig 7A). To verify that the observed effect resulted from P53 silencing, we analysed the expression levels of MDM2, a known p53-target gene, which were reduced to 60% of the control (Fig 7B). Therefore, the control of HAMP expression can be attributed, at least in part, to the transcriptional activity of p53.

image

Figure 7. P53 knock-down by siRNA represses HAMP expression. HepG2 cells were transfected with 0·5 μg of either pSuper-p53 siRNA construct (p53si) or with pSuper empty plasmid (control). mRNA levels of HAMP, P53 and MDM2 were measured 72 h after transfection using QPCR and normalised to β-actin (ACTB). The value for the control cells transfected with the pSuper empty plasmid was set at 100% and compared with cells tranfected with the pSuper-p53 siRNA construct. Results display mean ± standard deviation of four independent transfection assays, each in duplicates.

Download figure to PowerPoint

These results support the conclusion that p53 transcriptionally activates HAMP expression.

Discussion

  1. Top of page
  2. Summary
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Hepcidin is an anti-microbial peptide and a central regulator of iron homeostasis. Iron balance is achieved by the control of iron cycling through the reticuloendothelial system and dietary absorption. Disruption of the p53 pathway is crucial to the pathogenesis of malignancies. The present study showed that hepcidin is regulated by p53. However, the limitations of our study should be taken into account; HAMP regulation by p53 was examined only at the level of mRNA expression, which may not be equivalent to protein expression.

In a significant portion of tumours, either the wild type or a mutated form of p53 is upregulated. In addition, cancer patients are treated with chemotherapy and radiotherapy, which induce expression of the wild-type p53 protein present in normal cells and also in a significant portion of malignant cells. This induction causes the known side effects of cancer therapy, such as mucositis, alopecia and bone marrow suppression leading also to anaemia. In view of our findings here, that HAMP is a novel target of the P53 tumour suppressor gene, we hypothesise that HAMP expression will be induced in normal and malignant cells possessing a functional p53. HAMP induction is expected to decrease intestinal iron absorption, enhance iron sequestration in the reticuloendothelial system and, along with the recent finding proposing hepcidin itself as an iron sequestering molecule (Gerardi et al, 2005), diminish the availability of systemic free iron.

Anaemia is the most common haematological abnormality in cancer patients and is observed in about half of the patients at some time during their disease. Several unique causes for anaemia exist in patients with malignancy, such as the side effects of therapy, marrow replacement by tumour, nutritional deficiency, increased destruction of red blood cells and blood loss. Nevertheless, there is a significant overlap with the underlying mechanisms of anaemia of infection and chronic inflammation, where hepcidin was shown to play a central role (Deicher & Horl, 2004; Means, 2004). The elevated expression of P53 in many cancer patients and the p53-hepcidin link revealed here may therefore be relevant to the understanding of anaemia of malignancy.

The decrease in available iron mediated by increased hepcidin may also be a new pathway by which p53 exerts its tumour suppressor activity, by depriving the cancer cells of iron. Iron deprivation leads to cell growth arrest and apoptosis as iron is essential for cellular metabolism, oxygen transport and sensing, DNA synthesis, energy generation and other biological processes (Chaston & Richardson, 2003; Hentze et al, 2004).

Our hypothesis, that upregulation of hepcidin is part of the anti-tumour defence mechanism, is supported by recently published work that demonstrated an increased HAMP expression in a rat model of liver ischaemia/reperfusion, independent of IL-6 and C/EBPa regulatory pathways (Goss et al, 2005). An increase in HAMP mRNA expression was also demonstrated in a mouse model for lung ischaemia (Srisuma et al, 2003). Ischaemia also occurs within solid malignant tumours, due to their impaired neovascularisation that is unable to keep pace with the rapidly growing tumour cell mass and fails to meet its nutritional needs (Siemann et al, 2004). Ischaemia and ischaemia/reperfusion are known to increase P53 expression and p53-mediated apoptotic pathways (Cummings, 1996; Hatoko et al, 2001). Taken together with our findings, we suggest an ischaemia-p53-hepcidin tumour suppressor pathway.

On the other hand, we hypothesise that, in malignant cells which acquired mutations in P53 or other aberrations resulting in disruption of the p53 pathway, the consequent downregulation of HAMP expression will, in turn, result in increased iron-availability, which will enable rapid proliferation of the malignant cells.

The p53-hepcidin pathway may also take part in the inflammatory process. Overexpression and mutations of P53 are observed not only in cancer, but also in inflammatory conditions, such as rheumatoid arthritis and ulcerative colitis (Tak et al, 2000), thus p53 is hypothesised to have anti-inflammatory roles in addition to its role as a tumour suppressor and cell cycle regulator. During inflammation, p53 response pathway is activated. The free radical NO, for example, is produced during inflammation and induces p53 post-translational modifications, leading to an increase in the expression of p53 transcriptional targets (Hofseth et al, 2003). Iron has a role in the pathogenesis of inflammation mainly through generation of reactive oxygen species (Morris et al, 1995). Therefore iron deprivation or sequestration might decrease the generation of reactive oxygen species. Thus the p53-hepcidin axis may play a role in the reduction of inflammatory tissue damage as well.

As inflammation was shown to predispose and be involved in the pathogenesis of cancer, the anti-inflammatory hepcidin-mediated iron restrictive role of p53 may be yet another route of p53 tumour suppressive activity.

This study showed that incubating the hepatoma cell line with IL-6 activated the HAMP promoter. IL-6 is known as a stimulator of HAMP production via a STAT3-mediated pathway (Wrighting & Andrews, 2006; Verga Falzacappa et al, 2007). We found that p53 diminished the IL-6 effect on the HAMP promoter by approximately half (Fig 5). These results correspond with the known ability of p53 to repress the IL6 promoter (Santhanam et al, 1991). Moreover, p53 regulates the Janus kinase (JAK)-STAT signal transduction pathway of IL-6 by masking STAT3 and STAT5 accessibility to the genome (Rayanade et al, 1998). Constitutively active IL-6 is observed in many tumour cell lines (Margulies & Sehgal, 1993) and its action is essential to the development of some cancers (Hilbert et al, 1995). On the other hand, IL-6 has been shown to have a direct and indirect anti-tumour activity, and has been suggested as a potential immunotherapy for cancer (Chen et al, 1988; Mule et al, 1990; Givon et al, 1992). IL-6 has been linked to anaemia in cancer (Atkins et al, 1995), and this activity may be mediated through HAMP induction. Therefore both p53 and IL-6 may play a similar role in the defence mechanism against cancer by deprivation of iron from the tumour cells, while each of these factors possesses additional specific activities.

In conclusion, our results add p53 to the factors involved in the transcriptional control of HAMP and thereby link HAMP to cancer. These findings also show that iron deprivation is a new p53-mediated anti-tumoural and anti-inflammatory mechanism.

Acknowledgements

  1. Top of page
  2. Summary
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

This work was supported by the Flight Attendant Medical Research Institute (FAMRI). G. Rechavi holds the Djerassi Chair in Oncology at the Sackler Faculty of Medicine, Tel-Aviv University, Tel-Aviv, Israel. This work was performed in partial fulfillment of the requirements for a Ph.D. degree of Orly Weizer-Stern, Sackler Faculty of Medicine, Tel-Aviv University, Tel-Aviv, Israel. We thank Prof. Moshe Oren from the Weizmann Institute of Science, Rehovot, Israel, for the cell line and plasmids, which contributed greatly to our work.

References

  1. Top of page
  2. Summary
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  • Adamsky, K., Weizer, O., Amariglio, N., Breda, L., Harmelin, A., Rivella, S., Rachmilewitz, E. & Rechavi, G. (2004) Decreased hepcidin mRNA expression in thalassemic mice. British Journal of Haematology, 124, 123124.
  • Andrews, F.J., Morris, C.J., Lewis, E.J. & Blake, D.R. (1987) Effect of nutritional iron deficiency on acute and chronic inflammation. Annals of the rheumatic diseases, 46, 859865.
  • Ashur-Fabian, O., Adamsky, K., Trakhtenbrot, L., Cohen, Y., Raanani, P., Hardan, I., Nagler, A., Rechavi, G. & Amariglio, N. (2007) Apaf1 in chronic myelogenous leukemia (CML) progression: reduced Apaf1 expression is correlated with a H179R p53 mutation during clinical blast crisis. Cell Cycle, 6, 589594.
  • Atkins, M.B., Kappler, K., Mier, J.W., Isaacs, R.E. & Berkman, E.M. (1995) Interleukin-6-associated anemia: determination of the underlying mechanism. Blood, 86, 12881291.
  • Barak, Y., Juven, T., Haffner, R. & Oren, M. (1993) mdm2 expression is induced by wild type p53 activity. The EMBO journal, 12, 461468.
  • Barollo, M., D'Inca, R., Scarpa, M., Medici, V., Cardin, R., Fries, W., Angriman, I. & Sturniolo, G.C. (2004) Effects of iron deprivation or chelation on DNA damage in experimental colitis. International Journal of Colorectal Disease, 19, 461466.
  • Borsellino, N., Belldegrun, A. & Bonavida, B. (1995) Endogenous interleukin 6 is a resistance factor for cis-diamminedichloroplatinum and etoposide-mediated cytotoxicity of human prostate carcinoma cell lines. Cancer Research, 55, 46334639.
  • Bosari, S., Viale, G., Roncalli, M., Graziani, D., Borsani, G., Lee, A.K. & Coggi, G. (1995) p53 gene mutations, p53 protein accumulation and compartmentalization in colorectal adenocarcinoma. The American Journal of Pathology, 147, 790798.
  • Brummelkamp, T.R., Bernards, R. & Agami, R. (2002) A system for stable expression of short interfering RNAs in mammalian cells. Science, 296, 550553.
  • Chandler, D.B., Barton, J.C., Briggs, III, D.D., Butler, T.W., Kennedy, J.I., Grizzle, W.E. & Fulmer, J.D. (1988) Effect of iron deficiency on bleomycin-induced lung fibrosis in the hamster. The American Review of Respiratory Disease, 137, 8589.
  • Chaston, T.B. & Richardson, D.R. (2003) Iron chelators for the treatment of iron overload disease: relationship between structure, redox activity, and toxicity. American Journal of Hematology, 73, 200210.
  • Chen, H.L. & Carbone, D.P. (1997) p53 as a target for anti-cancer immunotherapy. Molecular Medicine Today, 3, 160167.
  • Chen, L., Mory, Y., Zilberstein, A. & Revel, M. (1988) Growth inhibition of human breast carcinoma and leukemia/lymphoma cell lines by recombinant interferon-beta 2. Proceedings of the National Academy of Sciences of the United States of America, 85, 80378041.
  • Choi, S., Cho, Y., Kim, H. & Park, J. (2007) ROS mediate the hypoxic repression of the hepcidin gene by inhibiting C/EBPalpha and STAT-3. Biochemical and Biophysical Research Communications, 356, 312317.
  • Corradini, P., Inghirami, G., Astolfi, M., Ladetto, M., Voena, C., Ballerini, P., Gu, W., Nilsson, K., Knowles, D.M., Boccadoro, M., Pileri, A. & Dalla-Favera, R. (1994) Inactivation of tumor suppressor genes, p53 and Rb1, in plasma cell dyscrasias. Leukemia, 8, 758767.
  • Courselaud, B., Pigeon, C., Inoue, Y., Inoue, J., Gonzalez, F.J., Leroyer, P., Gilot, D., Boudjema, K., Guguen-Guillouzo, C., Brissot, P., Loreal, O. & Ilyin, G. (2002) C/EBPalpha Regulates Hepatic Transcription of Hepcidin, an Antimicrobial Peptide and Regulator of Iron Metabolism. Cross-talk between C/EBP pathway and iron metabolism. The Journal of Biological Chemistry, 277, 4116341170.
  • Cummings, M.C. (1996) Increased p53 mRNA expression in liver and kidney apoptosis. Biochimica et biophysica acta, 1315, 100104.
  • Deicher, R. & Horl, W.H. (2004) Hepcidin: a molecular link between inflammation and anaemia. Nephrology, Dialysis, Transplantation: Official Publication of the European Dialysis and Transplant Association - European Renal Association, 19, 521524.
  • El-Deiry, W.S., Kern, S.E., Pietenpol, J.A., Kinzler, K.W. & Vogelstein, B. (1992) Definition of a consensus binding site for p53. Nature Genetics, 1, 4549.
  • Gao, J. & Richardson, D.R. (2001) The potential of iron chelators of the pyridoxal isonicotinoyl hydrazone class as effective antiproliferative agents, IV: the mechanisms involved in inhibiting cell-cycle progression. Blood, 98, 842850.
  • Gehrke, S.G., Kulaksiz, H., Herrmann, T., Riedel, H.-D., Bents, K., Veltkamp, C. & Stremmel, W. (2003) Expression of hepcidin in hereditary hemochromatosis: evidence for a regulation in response to the serum transferrin saturation and to non-transferrin-bound iron. Blood, 102, 371376.
  • Gerardi, G., Biasiotto, G., Santambrogio, P., Zanella, I., Ingrassia, R., Corrado, M., Cavadini, P., Derosas, M., Levi, S. & Arosio, P. (2005) Recombinant human hepcidin expressed in Escherichia coli isolates as an iron containing protein. Blood Cells, Molecules & Diseases, 35, 177181.
  • Givon, T., Slavin, S., Haran-Ghera, N., Michalevicz, R. & Revel, M. (1992) Antitumor effects of human recombinant interleukin-6 on acute myeloid leukemia in mice and in cell cultures. Blood, 79, 23922398.
  • Goss, J.A., Seu, P., Gao, F.Q. & Wyllie, S. (2005) Ischemia-reperfusion of rat liver modulates hepcidin in vivo expression. Liver Transplantation: Official Publication of the American Association for the Study of Liver Diseases and the International Liver Transplantation Society, 11, 800806.
  • Gudas, J.M., Nguyen, H., Li, T., Sadzewicz, L., Robey, R., Wosikowski, K. & Cowan, K.H. (1996) Drug-resistant breast cancer cells frequently retain expression of a functional wild-type p53 protein. Carcinogenesis, 17, 14171427.
  • Hangaishi, A., Ogawa, S., Imamura, N., Miyawaki, S., Miura, Y., Uike, N., Shimazaki, C., Emi, N., Takeyama, K., Hirosawa, S., Kamada, N., Kobayashi, Y., Takemoto, Y., Kitani, T., Toyama, K., Ohtake, S., Yazaki, Y., Ueda, R. & Hirai, H. (1996) Inactivation of multiple tumor-suppressor genes involved in negative regulation of the cell cycle, MTS1/p16INK4A/CDKN2, MTS2/p15INK4B, p53, and Rb genes in primary lymphoid malignancies. Blood, 87, 49494958.
  • Hatoko, M., Tanaka, A., Kuwahara, M. & Yurugi, S. (2001) Molecular response to ischemia-reperfusion of rat skin: study of expression of p53, p21WAF-1, and Bax proteins, and apoptosis. Annals of Plastic Surgery, 47, 425430.
  • Hentze, M.W., Muckenthaler, M.U. & Andrews, N.C. (2004) Balancing acts: molecular control of mammalian iron metabolism. Cell, 117, 285297.
  • Hilbert, D.M., Kopf, M., Mock, B.A., Kohler, G. & Rudikoff, S. (1995) Interleukin 6 is essential for in vivo development of B lineage neoplasms. The Journal of Experimental Medicine, 182, 243248.
  • Hofseth, L., Saito, S., Hussain, S., Espey, M., Miranda, K., Araki, Y., Jhappan, C., Higashimoto, Y., He, P., Linke, S., Quezado, M., Zurer, I., Rotter, V., Wink, D., Appella, E. & Harris, C. (2003) Nitric oxide-induced cellular stress and p53 activation in chronic inflammation. Proceedings of the National Academy of Sciences of the United States of America, 100, 143148.
  • Hoh, J., Jin, S., Parrado, T., Edington, J., Levine, A.J. & Ott, J. (2002) The p53MH algorithm and its application in detecting p53-responsive genes. Proceedings of the National Academy of Sciences of the United States of America, 99, 84678472.
  • Kaeser, M.D. & Iggo, R.D. (2002) Chromatin immunoprecipitation analysis fails to support the latency model for regulation of p53 DNA binding activity in vivo. Proceedings of the National Academy of Sciences of the United States of America, 99, 95100.
  • Kemp, J.D., Cardillo, T., Stewart, B.C., Kehrberg, E., Weiner, G., Hedlund, B. & Naumann, P.W. (1995) Inhibition of lymphoma growth in vivo by combined treatment with hydroxyethyl starch deferoxamine conjugate and IgG monoclonal antibodies against the transferrin receptor. Cancer Research, 55, 38173824.
  • Komarova, E.A., Diatchenko, L., Rokhlin, O.W., Hill, J.E., Wang, Z.J., Krivokrysenko, V.I., Feinstein, E. & Gudkov, A.V. (1998) Stress-induced secretion of growth inhibitors: a novel tumor suppressor function of p53. Oncogene, 17, 10891096.
  • Lee, P., Peng, H., Gelbart, T., Wang, L. & Beutler, E. (2005) Regulation of hepcidin transcription by interleukin-1 and interleukin-6. Proceedings of the National Academy of Sciences of the United States of America, 102, 19061910.
  • Levine, A.J. (1997) p53, the cellular gatekeeper for growth and division. Cell, 88, 323331.
  • Levine, A.J., Momand, J. & Finlay, C.A. (1991) The p53 tumour suppressor gene. Nature, 351, 453456.
  • Loots, G.G. & Ovcharenko, I. (2004) rVISTA 2·0: evolutionary analysis of transcription factor binding sites. Nucleic Acids Research, 32, W217221.
  • Margulies, L. & Sehgal, P.B. (1993) Modulation of the human interleukin-6 promoter (IL-6) and transcription factor C/EBP beta (NF-IL6) activity by p53 species. The Journal of biological chemistry, 268, 1509615100.
  • Means, Jr, R.T. (2000) The anaemia of infection. Best Practice & Research Clinical Haematology, 13, 151162.
  • Means, Jr, R.T., (2004) Hepcidin and anaemia. Blood Reviews, 18, 219225.
  • Michalovitz, D., Halevy, O. & Oren, M. (1990) Conditional inhibition of transformation and of cell proliferation by a temperature-sensitive mutant of p53. Cell, 62, 671680.
  • Milward, E., Johnstone, D., Trinder, D., Ramm, G. & Olynyk, J. (2007) The nexus of iron and inflammation in hepcidin regulation: SMADs, STATs, and ECSIT. Hepatology, 45, 253256.
  • Moll, U.M., LaQuaglia, M., Benard, J. & Riou, G. (1995) Wild-type p53 protein undergoes cytoplasmic sequestration in undifferentiated neuroblastomas but not differentiated tumors. Proceedings of the National Academy of Sciences of the United States of America, 92, 44074411.
  • Moretta, A. (1997) Molecular mechanisms in cell-mediated cytotoxicity. Cell, 90, 1318.
  • Morris, C.J., Earl, J.R., Trenam, C.W. & Blake, D.R. (1995) Reactive oxygen species and iron – a dangerous partnership in inflammation. The International Journal of Biochemistry & Cell Biology, 27, 109122.
  • Mule, J.J., McIntosh, J.K., Jablons, D.M. & Rosenberg, S.A. (1990) Antitumor activity of recombinant interleukin 6 in mice. Journal of Experimental Medicine, 171, 629636.
  • Nakao, S., Kuwano, T., Ishibashi, T., Kuwano, M. & Ono, M. (2003) Synergistic effect of TNF-alpha in soluble VCAM-1-induced angiogenesis through alpha 4 integrins. Journal of Immunology, 170, 57045711.
  • Nemeth, E., Valore, E.V., Territo, M., Schiller, G., Lichtenstein, A. & Ganz, T. (2003) Hepcidin, a putative mediator of anemia of inflammation, is a type II acute-phase protein. Blood, 101, 24612463.
  • Nemeth, E., Tuttle, M.S., Powelson, J., Vaughn, M.B., Donovan, A., Ward, D.M., Ganz, T. & Kaplan, J. (2004a) Hepcidin regulates cellular iron efflux by binding to ferroportin and inducing its internalization. Science, 306, 20902093.
  • Nemeth, E., Rivera, S., Gabayan, V., Keller, C., Taudorf, S., Pedersen, B.K. & Ganz, T. (2004b) IL-6 mediates hypoferremia of inflammation by inducing the synthesis of the iron regulatory hormone hepcidin. Journal of Clinical Investigation, 113, 12711276.
  • Neri, A., Baldini, L., Trecca, D., Cro, L., Polli, E. & Maiolo, A.T. (1993) p53 gene mutations in multiple myeloma are associated with advanced forms of malignancy. Blood, 81, 128135.
  • Nicolas, G., Chauvet, C., Viatte, L., Danan, J.L., Bigard, X., Devaux, I., Beaumont, C., Kahn, A. & Vaulont, S. (2002) The gene encoding the iron regulatory peptide hepcidin is regulated by anemia, hypoxia, and inflammation. Journal of clinical investigation, 110, 10371044.
  • Niedobitek, G., Agathanggelou, A., Barber, P., Smallman, L.A., Jones, E.L. & Young, L.S. (1993) P53 overexpression and Epstein-Barr virus infection in undifferentiated and squamous cell nasopharyngeal carcinomas. The Journal of Pathology, 170, 457461.
  • Nishizaki, M., Fujiwara, T., Tanida, T., Hizuta, A., Nishimori, H., Tokino, T., Nakamura, Y., Bouvet, M., Roth, J.A. & Tanaka, N. (1999) Recombinant adenovirus expressing wild-type p53 is antiangiogenic: a proposed mechanism for Bystander effect. Clinical Cancer Research, 5, 10151023.
  • Ostermeyer, Anne, G., Runko, E., Winkfield, B., Ahn, B. & Moll Ute, M. (1996) Cytoplasmically sequestered wild-type p53 protein in neuroblastoma is relocated to the nucleus by a C-terminal peptide. Proceedings of the National Academy of Sciences of the United States of America, 93, 1519015194.
  • Pietrangelo, A., Dierssen, U., Valli, L., Garuti, C., Rump, A., Corradini, E., Ernst, M., Klein, C. & Trautwein, C. (2007) STAT3 is required for IL-6-gp130-dependent activation of Hepcidin in vivo. Gastroenterology, 132, 294300.
  • Preudhomme, C., Facon, T., Zandecki, M., Vanrumbeke, M., Lai, J., Nataf, E., Loucheux-Lefebvre, M.H., Kerckaert, J.P. & Fenaux, P. (1992) Rare occurrence of P53 gene mutations in multiple myeloma. British journal of haematology, 81, 440443.
  • Rayanade, R.J., Ndubuisi, M.I., Etlinger, J.D. & Sehgal, P.B. (1998) Regulation of IL-6 signaling by p53: STAT3- and STAT5-masking in p53-Val135-containing human hepatoma Hep3B cell lines. Journal of Immunology, 161, 325334.
  • Richardson, D.R. (2002) Iron chelators as therapeutic agents for the treatment of cancer. Critical Reviews in Oncology/Hematology, 42, 267281.
  • Ropke, M., Hald, J., Guldberg, P., Zeuthen, J., Norgaard, L., Fugger, L., Svejgaard, A., Burg, Sjoerd Van, D., Nijman Hans, W., Melief Cornelis, J.M. & Claesson Mogens, H. (1996) Spontaneous human squamous cell carcinomas are killed by a human cytotoxic T lymphocyte clone recognizing a wild-type p53-derived peptide. Proceedings of the National Academy of Sciences of the United States of America, 93, 1470414707.
  • Santhanam, U., Ray, A. & Sehgal, P.B. (1991) Repression of the interleukin 6 gene promoter by p53 and the retinoblastoma susceptibility gene product. Proceedings of the National Academy of Sciences of the United States of America, 88, 76057609.
  • Shaulsky, G., Goldfinger, N., Peled, A. & Rotter, V. (1991a) Involvement of wild-type p53 protein in the cell cycle requires nuclear localization. Cell Growth & Differentiation: The Molecular Biology Journal of the American Association for Cancer Research, 2, 661667.
  • Shaulsky, G., Goldfinger, N., Tosky, M., Levine, A.J. & Rotter, V. (1991b) Nuclear localization is essential for the activity of p53 protein. Oncogene, 6, 20552065.
  • Siemann, D.W., Chaplin, D.J. & Horsman, M.R. (2004) Vascular-targeting therapies for treatment of malignant disease. Cancer, 100, 24912499.
  • Simonart, T., Degraef, C., Andrei, G., Mosselmans, R., Hermans, P., Van Vooren, J.P., Noel, J.C., Boelaert, J.R., Snoeck, R. & Heenen, M. (2000) Iron chelators inhibit the growth and induce the apoptosis of Kaposi's sarcoma cells and of their putative endothelial precursors. The Journal of Investigative Dermatology, 115, 893900.
  • Srisuma, S., Biswal, S.S., Mitzner, W.A., Gallagher, S.J., Mai, K.H. & Wagner, E.M. (2003) Identification of genes promoting angiogenesis in mouse lung by transcriptional profiling. American Journal of Respiratory Cell and Molecular Biology, 29, 172179.
  • Tak, P.P., Zvaifler, N.J., Green, D.R. & Firestein, G.S. (2000) Rheumatoid arthritis and p53: how oxidative stress might alter the course of inflammatory diseases. Immunology Today, 21, 7882.
  • Theobald, M., Biggs, J., Dittmer, D., Levine, A.J. & Sherman, L.A. (1995) Targeting p53 as a General Tumor Antigen. Proceedings of the National Academy of Sciences of the United States of America, 92, 1199311997.
  • Verga Falzacappa, M.V., Vujic Spasic, M., Kessler, R., Stolte, J., Hentze, M.W. & Muckenthaler, M.U. (2007) STAT3 mediates hepatic hepcidin expression and its inflammatory stimulation. Blood, 109, 353358.
  • Vidal-Vanaclocha, F., Fantuzzi, G., Mendoza, L., Fuentes, A.M., Anasagasti, M.J., Martin, J., Carrascal, T., Walsh, P., Reznikov, L.L., Kim, S.H., Novick, D., Rubinstein, M. & Dinarello, C.A. (2000) IL-18 regulates IL-1beta-dependent hepatic melanoma metastasis via vascular cell adhesion molecule-1. Proceedings of the National Academy of Sciences of the United States of America, 97, 734739.
  • Vousden, K.H. & Lu, X. (2002) Live or let die: the cell's response to p53. Nature Reviews Cancer, 2, 594604.
  • Weinberg, E.D. (1999a) Iron loading and disease surveillance. Emerging Infectious Diseases, 5, 346352.
  • Weinberg, E.D. (1999b) Development of clinical methods of iron deprivation for suppression of neoplastic and infectious diseases. Cancer Investigation, 17, 507513.
  • Wrighting, D.M. & Andrews, N.C. (2006) Interleukin-6 induces hepcidin expression through STAT3. Blood, 108, 32043209.
  • Yang, D.C., Jiang, X.P., Elliott, R.L. & Head, J.F. (2001) Inhibition of growth of human breast carcinoma cells by an antisense oligonucleotide targeted to the transferrin receptor gene. Anticancer Research, 21, 17771787.
  • Yasuga, Y., Hirosawa, S., Yamamoto, K., Tomiyama, J., Nagata, J. & Aokia, N. (1995) N-ras and p53 gene mutations are very rare events in multiple myeloma. International Journal of Hematology, 62, 9197.
  • Zhou, X., Wang, X.W., Xu, L., Hagiwara, K., Nagashima, M., Wolkowicz, R., Zurer, I., Rotter, V. & Harris, C.C. (1999) COOH-terminal domain of p53 modulates p53-mediated transcriptional transactivation, cell growth, and apoptosis. Cancer Research, 59, 843848.