Interleukin 18 and interleukin 18 binding protein in patients with idiopathic thrombocytopenic purpura

Authors

  • Ning-ning Shan,

    1. Haematology Oncology Centre, Qilu Hospital, Shandong University
    2. Department of Clinical Laboratory, Qilu Hospital, Shandong University
    Search for more papers by this author
  • Xiao-juan Zhu,

    1. Haematology Oncology Centre, Qilu Hospital, Shandong University
    Search for more papers by this author
  • Jun Peng,

    1. Haematology Oncology Centre, Qilu Hospital, Shandong University
    2. The Key Laboratory of Cardiovascular Remodelling and Function Research, Chinese Ministry of Education and Chinese Ministry of Health, Qilu Hospital, Shandong University, Jinan, China
    Search for more papers by this author
  • Ping Qin,

    1. Haematology Oncology Centre, Qilu Hospital, Shandong University
    Search for more papers by this author
  • Xue-wei Zhuang,

    1. Department of Clinical Laboratory, Qilu Hospital, Shandong University
    Search for more papers by this author
  • Hong-chun Wang,

    1. Haematology Oncology Centre, Qilu Hospital, Shandong University
    2. Department of Clinical Laboratory, Qilu Hospital, Shandong University
    Search for more papers by this author
  • Ming Hou

    1. Haematology Oncology Centre, Qilu Hospital, Shandong University
    2. The Key Laboratory of Cardiovascular Remodelling and Function Research, Chinese Ministry of Education and Chinese Ministry of Health, Qilu Hospital, Shandong University, Jinan, China
    Search for more papers by this author

Ming Hou, MD, PhD, Haematology Oncology Centre, Qilu Hospital, Shandong University, 107 West Wenhuaxi Rd, Jinan, Shandong 250012, China.
E-mail: houming@medmail.com.cn

Summary

To evaluate the balance of interleukin IL18 and its endogenous antagonist IL18 binding protein (IL18BP) in patients with idiopathic thrombocytopenic purpura (ITP), plasma IL18, IL18BP, interferon gamma (IFNG) and IL4 levels, as well as platelet counts were measured in patients with active ITP (= 23), ITP in remission (= 21) and in healthy subjects (= 24) by enzyme linked immunosorbent assay (ELISA). Using real-time quantitative polymerase chain reaction, the mRNA expression of IL18, IL18BP, IFNG, IL4, T-box (TBX21) and GATA-binding protein 3(GATA3) were studied in all subjects. The results showed that IL18 and IFNG protein and mRNA levels were significantly increased in patients with active ITP than in control subjects, but that IL18BP were not significantly elevated in ITP patients, which resulted in an elevated ratio of IL18/IL18BP in patients with active disease. During remission stages, the levels of these cytokines were comparable to those of healthy controls. The elevated levels of IL18/IL18BP in plasma during active stages of disease suggest a possible role in the pathogenesis and course of ITP.

Idiopathic thrombocytopenic purpura (ITP) is an acquired chronic autoimmune-mediated bleeding disorder in which platelets are opsonized by platelet autoantibodies that target several platelet glycoproteins (GPs), including GPIIb/IIIa and GPIb/IX, and prematurely destroyed in the reticuloendothelial system of the spleen, liver or bone marrow (Berchtold & Wenger, 1993; Kuwana et al, 1998). Apart from phagocytosis, destruction mechanisms include complement activation and T cell abnormalities (Coopamah et al, 2003; Olsson et al, 2003; Sad et al, 1995; Yoshimura et al, 2000).

It has become evident that T helper type 1 (Th1) and Th2 cells might have pathogenetic importance in ITP (Panitsas et al, 2004; Mosmann et al, 1986). T-box expressed in T cells (TBX21) and GATA- binding protein 3 (GATA3) are major T transcription factors that regulate the expression of Th1 or Th2 cytokine genes, respectively, and play a crucial role in T-cell differentiation (Lucey et al, 1996). The present study evaluated the relevance of Th1 type (i.e., IFNG and TBX21) versus Th2 type (i.e., IL4 and GATA3) in the pathogenesis of ITP focusing on the critical role of IL18 and its natural antagonist: IL18 binding protein (IL18BP) (Dinarello, 2000).

Up to data, the balance between IL18 and IL18BP in patients with ITP is currently unknown. In the present study, we have explored the hypothesis that the imbalance of IL18 and IL18BP may be of importance in ITP. Plasma levels as well as mRNA expression in peripheral blood mononuclear cells (PBMCs) of IL18, IL18BP and other cytokines were measured in 23 patients with active ITP, 21 patients in remission and in 24 healthy volunteers to investigate the possible role of IL18 and IL18BP in ITP.

Materials and methods

Patients

Twenty-three ITP patients with active disease (18 females and five males, age range 16–58 years, median 38 years) were enrolled in this study. Enrollment took place between June 2007 and April 2008 at the Department of Haematology, Qilu Hospital, Jinan, China. The patients’ platelet counts ranged between 1 and 21 × 109/l, with a median count of 8·5 × 109/l, all required treatment because of clinically significant bleeding (Table I). Patients complicated with diabetes, hypertension, cardiovascular diseases, pregnancy, active infection, or connective tissue diseases, such as systemic lupus erythematosus, were excluded. None of them had been treated with glucocorticosteroid prior to sampling (Table I). Twenty-one ITP patients (15 females and six males, age range 19–51 years, median 34 years) were in remission, and the platelet count ranged between 163 and 309 × 109/l with median count of 189 × 109/l (Table II). All of the cases met the diagnosis criteria of chronic ITP as previously described (British Committee for Standards in Haematology General Haematology Task Force, 2003; George et al, 1998). A control group consisted of 24 adult healthy volunteers (18 women and six men; range: 18–65 years; median age 40 years). Platelet counts were ranged from 157 to 298 × 109/l, with the median count of 211 × 109/l. Informed consent was obtained from each participating patient. Ethical approval for the study was obtained from the Medical Ethical Committee of Qilu Hospital, Shandong University.

Table I.   Clinical characteristics of active ITP patients.
Patient no. Sex/age (years)Course of disease (month)Bleeding symptoms*Platelet count (×109/l)Major therapy
  1. *Platelet count is the mean of test results using the same specimens.

  2. PT, petechiae; EC, ecchymoses; EP, epistaxis; GUH, genitourinary hemorrhage; GH, gingival hemorrhage; GC, glucocorticoid; IV Ig, intravenous drip gammaglobulin; SP, splenectomy.

1F/542PT, EP16GC
2M/253·5PT, EC12GC
3F/5120EP13IV Ig
4M/280PT, GH2·5GC
5F/169EC, EP, GH1GC
6F/272·5PT, GUH5GC
7F/331PT21IV Ig
8F/5812EC, GH10GC
9M/508PT, EC1·5GC
10F/432PT, GH9GC
11F/3923EP, GH2GC
12M/2212EC, EP, GH1IV Ig
13F/572PT8·5GC
14F/220PE, GH, GUH2GC, IV Ig
15F/249·5EP9GC
16F/4912·5PT9IV Ig
17F/2513PT, EP, GH10GC
18F/272·5PT, EP2·5GC
19M/2236EC, EP, GH1GC, SP
20F/384·5PT, GUH2GC
21F/4114EP, GH2·5GC
22F/5311·5EP10GC
23F/521PT, EP9GC
Median388 8·5 
(Min–max)(16–58)(0–36) (1–21) 
Table II.   Clinical characteristics of ITP patients in remission.
  1. CR, complete response; defined as platelet count ≥150 × 109/l; GC, glucocorticoid; SP, splenectomy.

Patient no. Sex/age (years)Course of disease (month)Duration of CR (month)Platelet count (×109/l)Major therapy received
1M/513612171GC, Danazol
2F/3510 9·5254GC
3F/191313195GC
4M/222232179SP
5M/25912211GC
6F/341912195GC
7F/491610177GC, Danazol
8F/2889183GC
9F/293313163GC
10F/211116174GC
11F/505211241SP
12F/424422299GC
13M/23741309SP
14F/281211188GC
15F/444113184GC
16F/412615284GC
17M/21610249GC, Danazol
18F/371714185GC
19F/27559175GC
20F/481610189GC
21M/392913267GC
Median341712189 
(Min–max)(19–51)(6–55)(9–41)(163–309) 

Isolation of RNA from PBMC

Fifteen milliliters of heparinized venous peripheral blood were collected from each patient and control. The blood was centrifuged and heparinized plasma stored at −80°C until determination of IL18, IL18BP and other cytokines. Mononuclear cells were isolated from heparinized blood by gradient centrifugation on Ficoll-Paque (Pharmacia Diagnostics, Uppsala, Sweden). PBMC were then applied to an RNeasy mini-column (Qiagen GmbH, Hilden, Germany) and was processed according to the manufacturer’s recommendations. Total RNA was eluted with 15 μl of RNase-free water and stored at −80°C. The amount of RNA was determined using the Eppendorf Biophotometer (Brinkmann Instruments, Westbury, NY, USA) and normalized to 1 μg/ml for each subsequent real-time quantitative polymerase chain reaction (RT-PCR) process.

IL18, IL18BP, IFNG and IL4 enzyme-linked immunosorbent assay (ELISA)

IL18 was measured by a commercial ELISA according to manufacturer’s (Uscnlife, Missouri, TX, USA) instructions. The lower detection limit of the assay was 15·6 pg/ml. No significant cross-reactivity with a multitude of recombinant cytokines has been observed. IL18BP as high as 6000 pg/ml has no effect on the IL18 ELISA. The predominant, neutralizing isoform of IL18BP was determined by ELISA according to manufacturer’s (R&D Systems, Minneapolis, MN, USA). The limit of detection was 62 pg/ml. No significant cross-reactivity with human plasma IFNG and IL4 was determined using a commercial ELISA (Jingmei, Beijing, China) according to manufacturer’s instructions. The lower detection limit of this assay was 2 pg/ml.

Quantitative real-time polymerase chain reaction analysis

Multiplex Real-time PCR was performed for IL18, IL18BP, IFNG, IL4, TBX21, GATA3 and the endogenous control (ACTB) on an ABI PRISM®7500 Sequence Detection System (Applied Biosystems, Foster City, CA, USA) by using SYBRw Green (Toyobo, Osaka, Japan) as a double-strand DNA-specific binding dye. Amplification was carried out in a total volume of 20 μl containing 0·5 mm of each primer, 10X SYBRw Green, 0·5 mm of cDNA. The primers for all mRNA assays were intron-spanning. The sequences of the amplification primers for IL18, IL18BP, IFNG, IL4, TBX21 and GATA3 are listed in Table III.

Table III.   Primers and conditions for the RT-PCR experiments performed in this study.
Gene Sequence (5′→3′)T (°C)Product (bp)
IL18GCTTGAATCTAAATTATCAGTC GAAGATTCAAATTGCATCTTAT60341
IL18BPTGGGAGATGTAGCCGACCTT GCCCCCGACCCTCTATTTCA62470
IFNGTTGGCTTAATTCTCTCGGAAACG CGCTACATCTGAATGACCTGC60120
IL4 AGCAGTTCCACAGGCACAAG TACTCTGGTTGGCTTCCTTCAC60110
TBX21CATTGCCGTGACTGCCTACC GATGCTGGTGTCAACAGATGTG60121
GATA3GAGATGGCACGGGACACTAC TGTGGTTGTGGTGGTCTGAC62171
ACTBTTGCCGACAGGATGCAGAA GCCGATCCACACGGAGTACT60101

The PCR reactions were cycled 40 times after initial denaturation (95°C, 5 min) with the following parameters: denaturation 95°C, 15 s; annealing 62°C (IL18BP, GATA3)/60°C (IL18, TBX21, IFNG, and IL4, ACTB) 15 s; extension 72°C, 35 s with temperature transition rates of 20°C/s. Fluorescence was acquired at extension 72°C below the product melting temperature (Tm) and holding for 5 s. Melting curve analysis of amplification products was performed at the end of each PCR reaction. Fluorescence was acquired every 0·1 s. All reactions were carried out in triplicate. Controls included RNA subjected to RT-PCR without reverse transcriptase, RT-PCR with water replacing RNA, and PCR with water replacing cDNA, and all these controls gave a threshold cycle (Ct) value of 40, indicating no detectable PCR product under these cycle conditions. ABI Sequence Detection System software version 1·0 (PE Applied Biosystems, Warrington, UK) was used to determine the cycle number at which fluorescence emission crossed the automatically determined Ct value. All PCR products were visualized by 2% agarose gel electrophoresis stained by ethidium bromide.

We used the comparative Ct method (Using arithmetic formulae) for relative quantification of cytokine mRNA according to relative expression software tool (REST©, Michael, Munich, Germany) (Michael et al, 2002). The amplification efficiency between the target (i.e, IL18 or IL18BP) and the reference control (i.e, ACTB) were compared in order to use the delta delta Ct (ΔΔCt) calculation.

Statistical analysis

Data were expressed as mean ± SD. Statistical significance was determined by one-way analysis of variance (anova) using the Statistical Package for the Social Sciences (spss) version 13.0. The numerical results of RT-PCR results were analysed using REST software. A probability value, P < 0·05 was considered statistically significant.

Results

Cytokine changes in ITP patients

The plasma levels of both IFNG and IL18 in ITP patients with active disease were increased significantly compared with the normal controls (P < 0·01). On the contrary, IL4 levels were considerably decreased (P < 0·01). There were no significant differences in plasma levels of IL18BP between ITP patients and controls. No significant difference between the patients in remission and the normal controls were found. Statistically significant IL18 (P < 0·01) and IFNG (P < 0·01) levels were found in active patients compared to patients in remission, and there were no significant differences of IL18BP (P = 0·513) between the two groups (Table IV). In addition, we found that plasma concentrations of IL18 correlated with IFNG (Fig 1). There was no correlation between the IL18, IFNG or IL4 level and the platelet count in individuals in our present research.

Table IV.   Cytokine levels in ITP patients and controls (mean ± SD).
GroupsNumber of casesIL18 (pg/ml)IL18BP (pg/ml)IFNG (pg/ml)IL4 (pg/ml)
  1. *P < 0·05, ITP (active) compared with normal controls.

  2. P < 0·05, ITP (active) compared with ITP (remission).

Controls24153·8 ± 103·1918·1 ± 196·938·6 ± 29·117·8 ± 12·0
ITP (active)23429·1 ± 150·9*†983·7 ± 253·867·2 ± 23·7*†8·9 ± 3·5*†
ITP (remission)21131·9 ± 101·3928·2 ± 298·539·6 ± 17·418·1 ± 12·7
Figure 1.

 Correlation of IL18 and IFNG in active ITP patients. Scatter plots above: plasma concentrations of IL18 were positively correlated with those of IFNG (ELISA).

Comparison of mRNA expressions in patients and controls

Using the REST software, the data are presented as the fold change in gene expression normalized to an endogenous reference gene and relative to healthy controls. The relative amount of IL18 mRNA was increased 4·7-fold in active patients compared to healthy controls (P < 0·01) and threefold compared to patients in remission (P < 0·01), respectively. Interestingly, the expression of IL18BP was unchanged in patients compared to the controls (Fig 2). IFNG was up-regulated in active ITP patients by 10·5-fold compared to controls and 5·1-fold when compared to remission patients (P < 0·01). TBX21 mRNA expression was significantly higher in active ITP patients compared to that of the control group (P < 0·01). The decrease observed in IL4 and GATA3 was 2·8-fold (P < 0·01) and 2·9-fold, respectively (P < 0·01), in active patients compared to controls. Statistically significant differences in IL4, TBX21 and GATA3 were also found in active patients compared with patients in remission. Of all the subjects, there was no significant difference between patients in remission and the control group.

Figure 2.

 Relative mRNA expressions of IL18 and IL18BP and other cytokines in active ITP and patients in remission with healthy controls. Freshly isolated human peripheral blood mononuclear cells (PBMC) from ITP patients and healthy controls were quantified by RT-PCR. *P < 0·01, ITP (active) vs. normal controls, #P < 0·01, ITP (active) vs. ITP (remission).

Th1/Th2 ratio by ELISA and RT-PCR

We observed elevated IFNG/IL4 and IL18/IL4 ratios in patients with active ITP compared with the control group, whereas there was no significant difference between that in remission patients and the control group. Significant differences were also found between the active and remission groups (P < 0·05). Further assessment of the relative expression of the two transcription factors and cytokine genes showed the expression ratios of TBX21/GATA3, IFNG/IL4 and IL18/IL4 were significantly elevated in all active ITP patients compared with that of normal and remission groups (P < 0·05).

The ratio of IL18/IL18BP in normal control, patients with active disease and patients in remission

The plasma levels of IL18 of ITP patients with active disease were increased significantly compared to the normal controls with no significant differences in plasma levels of IL18BP. The ratio of IL18/IL18BP in patients with active disease was increased significantly when compared with that of normal and remission groups (P < 0·01), but there was no significant difference between patients in remission and normal group. The ratio of IL18 mRNA/IL18BP mRNA in the ITP remission group was elevated, but this did not reach statistical significance when compared with that of control group. The ratio of IL18 mRNA/IL18BP mRNA was significantly different between the active and control groups (P < 0·01) and statistically significant differences were found in active patients compared to patients in remission (P < 0·01).

Discussion

Derangement of T cell function has been widely demonstrated in ITP, with abnormal cytokine profiles correlated to loss of immune tolerance and defective B cell suppression (Andersson, 1998; Semple et al, 1996). An increased Th1/Th2 ratio in the peripheral blood has been proposed to correlate with disease activity in ITP (Mosmann et al, 1986; Panitsas et al, 2004). IL18 is an inflammatory cytokine that belongs to the IL1 cytokine superfamily, which is predominantly produced by Kupffer cells in the liver, but also expressed in pancreas, kidney, skeletal muscle, lung, osteoblasts, and keratinocytes. Originally termed as an IFNG inducing factor, IL18 stimulates IFNG production via T lymphocytes and natural killer (NK) cells (Munder et al, 1998; Nakanishi et al, 2001; Reddy, 2004). IL18 appears to modulate inflammation at multiple checkpoints, acting not only on initiation and expansion of putative autoreactive Th1 responses but also via direct effects on multiple cellular targets, including macrophages, lymphocytes, and NK cells (Chaix et al, 2008; Gracie et al, 2003). Up-regulation of IL18 has previously been detected in multiple sclerosis (MS) (Huang et al, 2004), lupus nephritis (LN) (Tucci et al, 2008; Calvani et al, 2005), atopic dermatitis (Park do & Youn, 2007), type 1 diabetes (Altinova et al, 2008) and other autoimmune diseases (Ludwiczek et al, 2005). Patients with active ITP displayed high plasma levels and IL18 mRNA expression.

IL18BP is a constitutively secreted protein that binds IL18 with high-affinity, providing a potential mechanism for regulating IL18 activity. IL18BP is induced by IFNG, thus establishing a negative feedback loop that can be observed in vitro and in vivo (Hurgin et al, 2002; Paulukat et al, 2001). Human IL18BPa and IL18BPc isoforms are capable of binding to and neutralizing IL18 (Kim et al, 2000). The affinity of IL18BPc is 10-fold less than IL18BPa. IL18BPa, measured in this study, is the main IL18BP in humans. Data showed that IL18BP inhibits IL18-induced IFNG and IL8 production and NFκB1 activation in vitro and LPS-induced IFNG production in vivo (Aizawa et al, 1999; Novick et al, 1999). Elevated IL18BP levels were previously shown in sera of patients with Wegeners Granulomatosis (Novick et al, 2008), Crohn’s disease (Ludwiczek et al, 2005) and inflammatory bowel disease in children (Leach et al, 2008). This is the first report on IL18BP plasma levels in ITP patients, which, together with the levels of IL18, enabled us to evaluate the balance of IL18 and IL18BP in the immune response of these patients.

The patients had not received glucocorticosteroid before they were recruited into this study, which guarantees that the immune disorder had not been disturbed by outer factors. Elevated levels of IL18 might enhance Th1 immune responses, including excessive IFNG and tumour necrosis factor-α production, leading to exacerbation of ITP. In a feedback mechanism, endogenous IL18BP is then produced in order to neutralize and normalize the increased levels of IL18 (Hurgin et al, 2002; Paulukat et al, 2001). Our study demonstrated that, despite the compensatory slightly higher levels of IL18BP in plasma of patients with active ITP, the IL18/IL18BP ratio in those patients were still above those in patients in remission or healthy controls. These findings indicate that IL18BP may not be sufficient for blocking the pro-inflammatory activities of IL18 in active ITP.

Increased levels of IL18, often in correlation with disease activity, were reported in various experimental and human autoimmune disorders (Boraschi & Dinarello, 2006). In the collagen-induced model of arthritis, administration of IL18 exacerbated the disease, whereas treatment with IL18BP ameliorated it (Plater-Zyberk et al, 2001; Tissi et al, 2004). It has been demonstrated that increasing the level of IL18BP can alleviate the injury of liver and other autoimmune diseases (Banda et al, 2003; Kaser et al, 2002; Liang et al, 2006). Therefore, regulating the balance of IL18 and IL18BP in ITP may be also a therapeutic approach against ITP, though further studies are warranted.

We also focused on expression levels of other Th1 and Th2 cytokines and transcription factors that regulate the differentiations of Th1 and Th2 cells. We observed Th1 polarization of the immune response in ITP in vitro, in accordance with previous reports (Andersson, 1998; Ogawara et al, 2003; Panitsas et al, 2004; Semple et al, 1996; Wang et al, 2005; Yoshimura et al, 2000), whereas contradictory findings were described elsewhere (Jacobsson & Wadenvik, 2000; Webber et al, 2001). The plasma level of Th1 cytokines, such as IFNG and IL18 were overexpressed, and the mRNA levels of IFNG, IL18 and TBX21 were significantly higher in ITP patients than in controls, in contrast to the lower expressions of GATA3 and IL4. Previous studies have suggested that TBX21 is the master regulator of Th1 lineage commitment that strongly promotes IFNG expression (Del Prete et al, 1991; Szabo et al, 2000) and GATA3 significantly down-regulates IFNG production from developing Th1 cells in addition to inducing IL4 and IL5 levels (Ferber et al, 1999). Although alteration of TBX21 or GATA3 mRNA expression is evident in patients with various inflammatory diseases of Crohn’s disease (Matsuoka et al, 2004; Neurath et al, 2002), rheumatoid arthritis (Kawashima & Miossec, 2005) and systemic lupus erythematosus (Lit et al, 2007), little information is available about the interactions of these transcription factors in ITP. In this study, our results confirmed a reciprocal pattern in mRNA expression of Th1/Th2-associated transcription factors and cytokines in ITP.

Taken together, the present data demonstrate for the first time that IL18 and IL18BP are constitutively expressed in humans and IL18 is up-regulated in active ITP patients. Regulating the balance of IL18 and IL18BP in ITP might provide a reasonable therapeutic strategy for ITP.

Funding

This work was supported by grants from National Natural Science Foundation of China (No. 30570779, No. 30470742, No. 30600259, No. 30770922, and No. 30300312), 973 Program (No. 2006 CB 503803). Foundation for the Author of National Excellent Doctoral Dissertation of PR China (No. 200561), Key Clinical Research Project of Public Health Ministry of China 2007–2009, the 1020 Program from Health Department of Shandong Province, and Commonweal Trade for Scientific Research (No. 200802031).

Ancillary