Histone H3 covalent modifications driving response of BCR-ABL1+ cells sensitive and resistant to imatinib to Aurora kinase inhibitor MK-0457

Authors


The emergence of BCR-ABL1 point mutations leading to drug resistance is a major problem of imatinib (IM) treatment for chronic myeloid leukaemia (CML). Such mutations may be located either within or distant from the IM-binding site of the Abl domain, supporting that the destabilization of BCR-ABL1 inactive conformation (the only one inhibited by IM) is a central component of IM resistance. Due to their ability to inhibit mutated BCR-ABL1 kinase both in inactive and active conformation, Aurora kinase (AK) inhibitors have been adopted for the treatment of CML resistant to IM, including those associated with the most deleterious T315I mutation resistant to the second generation kinase inhibitors nilotinib and dasatinib (Young et al, 2006). However, mechanisms driving the response of BCR-ABL1+ haematopoiesis to AK inhibitors remain elusive. The present study showed that the AK inhibitor, MK-0457 (formerly referred to as VX-680), induces chromatin covalent modifications promoting the recruitment of transcriptional co-repressor heterochromatin protein (HP) 1 at a BCR promoter region critical for the fusion gene transcription. BCR-ABL1 downmodulation may concur to reduce the advantage of clonal haematopoiesis over its normal counterpart.

This study used the K562 cell line, murine bone marrow-derived Ba/F3 cells stably transduced with BCR-ABL1 constructs coding for either wild-type or T315I-mutated protein (kindly donated by M W Deininger, Division of Haematology and Haematologic Malignancies, University of Utah School of Medicine) and CD34+ progenitors isolated from bone marrow samples of CML patients. Preliminary experiments confirmed MK-0457 in vitro cytotoxicity against all cell types tested due to a prominent arrest in the G2/M phase of cell cycle and induction of apoptotic death (data not shown). As expected, MK-0457 (100 nmol/l for 24 h) induced the dephosphorylation of p210 BCR-ABL1 protein at a Tyr residue (Y245, located within the SH2-linker domain and proceeding from Tyr412 activating phosphorylation in the activation loop) and AK B at a Thr residue (T232, located within the activation loop) in K562 cells (Fig 1A). Notably, neither drug significantly affected p210 BCR-ABL1 and AK B expression, confirming that protein clearance following their enzymatic activity inhibition required longer intervals (Fig 1A) (Brusa et al, 2006; Corrado et al, 2008). The reduction of BCR-ABL1 transcripts [quantified by a competitive polymerase chain reaction (PCR) strategy(Brusa et al, 2006)] in response to MK-0457 was similar to that elicited by 1 μmol/l IM, suggesting that the drug effects are concurrently driven by BCR-ABL1 kinase inhibition and BCR-ABL1 transcriptional down-modulation (Fig 1B) (Brusa et al, 2006).

Figure 1.

 AK B inhibition in response to MK-0475 induces histone H3 covalent modifications driving the BCR-ABL1 transcriptional downmodulation through HP1 recruitment at the BCR promoter. Western blot or Immunoprecipitation (IP)/immunoblotting analyses, performed on whole cell or nuclear lysates according to published methods, were used to assess the impact of MK-0475 (100 nmol/l for 24 h) on the expression and phosphorylation status of p210 BCR-ABL1 (Upstate Biotechnology) and AK B (Cell Signaling, Danvers, MA, USA) and covalent modifications of histone H3 (Upstate Biotechnology) in the K562 cell line (panel A) and Ba/F3 cells expressing either the wild type (IM-sensitive) or mutated BCR-ABL1 construct coding for IM-resistant T315I mutation (panel D) (Brusa et al, 2006). Signal intensities were quantified by a GS-700 Imagining densitometer (BioRad, Waltham, MA, USA) equipped with dedicated software (Molecular Analyst, St Louis, MO, USA) to assess the statistical significance of differences in signal intensities. ACTB and histone H1 (from Santa Cruz Biotechnology, Santa Cruz, CA, USA) were used as controls for protein loading in Western blots. The results shown here were confirmed in two additional experiments. In K562 cells the levels of BCR-ABL1 transcript (mean values of three separate experiments) following exposure to MK-0457 (100 nmol/l for 24 h) and IM (1 μmol/l for 24 h) were quantified by means of a previously published competitive PCR strategy (Brusa et al, 2006). They were expressed as ratios between gene expression in treated and untreated cells (panel B). Standard deviations did not exceed 10% (data not shown). In K562 cell line PCR amplification of DNA extracted from ChIP products obtained with a ChIP grade anti-HP1 antibody revealed HP1 recruitment at a 280 bp sequence of a BCR promoter region critical for BCR-ABL1 transcription (see main text for details) following 24 h exposure to 100 nmol/l MK-0475. The constitutively acetylated promoter of human histone H4 (region −40 to +285) was used as an internal control (panel D). This result was confirmed in two additional experiments.

Combinatorial patterns of histone covalent modifications regulate DNA accessibility to the transcriptional apparatus. In particular, serine 10 at the N-terminal tail of histone H3 (H3S10) is a critical component of a ‘condensation code’ occurring during mitosis and has a key role in gene activation upon mitogen stimulation. Its phosphorylation (ph) is catalysed by AK B and disrupts the interactions of transcriptional repressor heterochromatin protein 1 (HP1) chromodomain with tri-methylated lysine 9 (H3K9me3) and acetylated lysine 14 (H3K14ac), the covalent modifications driving HP-1 delocalization from pericentromeric foci at the mitosis onset and from promoters of transiently silenced genes at the G0 to G1 transition (Crosio et al, 2002; Fischle et al, 2005). Densitometric analysis of signal intensities showed a significant reduction of H3S10ph associated with a significant increment of H3K9me3 (P < 0·001 in both cases) in K562 cells following AK B inhibition by MK-0457 (Fig 1A). The histone methyl-transferase SUV39H1, whose function is restored by MK-0457-induced inhibition of BCR-ABL1 kinase, probably contributes to the latter event (Brusa et al, 2006; Corrado et al, 2008). Indeed, SUV19H1 is a critical component of HP1 targeting to chromatin as it directly interacts with HP1 and stabilizes HP1 ligand to H3K9me3 (Stewart et al, 2005). PCR amplification (40 cycles of 0 s at 95°C, 0 s at 59°C and 25 s at 72°C) of DNA from chromatin immunoprecipitation (ChIP) products obtained with a ChIP grade anti-HP1 antibody (Upstate Biotechnology, Waltham, MA, USA) enabled assessment of the HP1 content at a minimal promoter region of BCR critical for BCR-ABL1 transcription [composed of 270 bp of 5′ flanking sequence and 380 bp of exon 1 transcribed sequence and amplified by 5′ CTGCGAGTTCTGCCAGAGAG 3′ (upper primer) and 5′ CACCCTCCCCCCGTCCCTGT 3′ (lower primer)]. Densitometric analysis of BCR promoter amplification signals relative to the constitutively acetylated promoter of human histone H4a (region −40 to +285) showed significantly greater HP1 recruitment at the BCR promoter by MK-0457 compared to IM (< 0·0001 vs. P < 0·001) (Fig 1C). These findings suggest that BCR-ABL1 transcript reduction is driven by BCR-ABL1 kinase inhibition through additional post-translational events (including the de-acetylation of histone H4) which may interfere with RNA polymerase processivity and block transcriptional elongation (Brusa et al, 2006; Zippo et al, 2009).

The participation of histone H3 covalent modifications in BCR-ABL1+ cell response to MK-0457 was further investigated in murine Ba/F3 cell line. The inactivating de-phosphorylation of AK B induced by MK-0457 (100 nmol/l for 24 h) reduced H3S10ph and raised H3K9me3 in Ba/F3 cells expressing the wild type (IM-sensitive) BCR-ABL1 protein and the IM-resistant T315I point mutation (Fig 1D). The dependence of cloned BCR-ABL1 expression by a heterologous promoter (the chicken β-actin promoter) precluded the evaluation of BCR-ABL1 transcript levels in those cell contexts (data not shown) (Daley & Baltimore, 1988).

MK-0457 effects were next investigated in CD34+ cells from four CML patients harbouring the T315I mutation. In vitro exposure to MK-0457 (1 μmol/l for 24 h) induced p210 BCR-ABL1 de-phosphorylation at Y245, supporting that the inhibition of mutated BCR-ABL1 protein enzymatic activity in primary leukaemic progenitors requires higher drug doses (Fig 2) (Donato et al, 2010). In all cases MK-0457 induced AK B de-phosphorylation at T232 resulting in H3S10 de-phosphorylation associated with H3K9 tri-methylation (Fig 2).

Figure 2.

 Histone H3 covalent modifications induced by in vitro exposure to MK-0457 in CD34+ haematopoietic progenitors expressing the IM-resistant T315I-mutated BCR-ABL1 protein. Indirect immuno-magnetic labelling (miniMACS, Mylteny Biotech, Bergish Gladback, Germany) was used to isolate CD34+ cells from bone marrow of four CML patients (PT 1, 2, 3 and 4) who developed IM resistance in consequence of T315I mutation after informed consent. Cells were treated with MK-0457 (1 μmol/l for 24 h). Their content following selection was >90% in all cases (data not shown). CD34+ haematopoietic progenitors from peripheral blood of haematologically normal persons were used as normal controls (nc). Results presented here have been confirmed in four additional cases (not shown). See legend of Fig 1 for technical details.

In conclusion, our results are consistent with a role of histone H3 covalent modifications in the response to MK-0457 of IM-sensitive and, more importantly, IM-resistant BCR-ABL1-expressing cells (Gontarewicz et al, 2008; Donato et al, 2010). H3S10 de-phosphorylation and H3K9 tri-methylation enable the recruitment of transcriptional co-repressor HP1 to chromatin, resulting in a significant reduction of BCR-ABL1 expression. Furthermore, such histone covalent modifications may represent a common mechanism for specific transcriptional co-repressor recruitment at the promoters of genes involved in leukaemic cell proliferation and survival advantage, including the TP53 antagonist MDM2 and cyclin D1 (Donato et al, 2010).

Acknowledgements

Manuela Mancini, Chiara Marcozzi, Enza Barbieri and Maria Alessandra Santucci contributed to the study design, performed the experiments and wrote the manuscript. Michela Aluigi and Elisa Leo performed some of the experimental procedures. Fausto Castagnetti provided clinical details of patients.

The study was supported by the University of Bologna (ex60% funds), MIUR (Prin funds), BolognaAIL and Carisbo Foudation.

Ancillary