SEARCH

SEARCH BY CITATION

Keywords:

  • BRAF mutations;
  • hairy cell leukaemia;
  • myeloma;
  • high resolution melt analysis

Summary

  1. Top of page
  2. Summary
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

The BRAF V600E mutation has recently been described in all cases of hairy cell leukaemia (HCL). We have developed and validated a rapid and sensitive high-resolution melting analysis (HRMA) assay that detects BRAF exon 15 mutations when hairy cells are as low as 5–10% in a sample. All 48 HCL patients were positive for the BRAF V600E mutation, while 114 non-HCL cases were all V600E negative. Interestingly, we detected a novel BRAF D594N mutation in one patient with multiple myeloma. The HRMA assay offers a useful tool to aid the laboratory diagnosis of HCL.

Hairy cell leukaemia (HCL) is a clonal B-cell proliferation with a characteristic morphology, immunophenotype and clinical presentation. Although gene expression profiling studies have revealed a distinct molecular signature of HCL (Basso et al, 2004), until recently no cytogenetic or mutational abnormalities specific for HCL had been identified. The hairy appearance of the cells and the co-expression of CD103 and CD11c with the pan B-cell antigens CD19, CD20 and CD22 is strongly suggestive for HCL but may also be found in splenic B-cell marginal zone lymphoma (SMZL) and in subtypes of splenic B-cell lymphoma/leukaemia, unclassifiable, in particular in hairy cell leukaemia-variant (HCL-v) (Swerdlow et al, 2008).

Recently, an amino acid substitution of glutamic acid for valine at position 600 of the BRAF protein (V600E) was identified in all 48 HCL patients tested using Sanger sequencing (Tiacci et al, 2011). The mutation was not detected in a range of other related B cell lymphoproliferative disorders. Mutations of BRAF including non-V600E mutations have also been reported, at low frequency, in other lymphoid malignancies including multiple myeloma (Chapman et al, 2011), chronic lymphocytic leukaemia (Zhang et al, 2011), diffuse large B cell lymphoma (Lee et al, 2003) and acute lymphoblastic leukaemia (Gustafsson et al, 2005). Furthermore, BRAF V600 mutations are frequently observed in many solid tumours, particularly melanoma where approximately 60% of patients harbour the mutation.

Identifying the presence of a BRAF V600E (T1799A) mutation is likely to have significant diagnostic importance and potential therapeutic implications within HCL. Here we report a rapid test, which utilizes touchdown polymerase chain reaction (PCR) and high resolution melting analysis (HRMA) for the detection of BRAF exon 15 mutations, and its application as a diagnostic tool for HCL. HRMA is a powerful in-tube technique that can detect single point mutations by accurately determining the melting profile of a PCR amplicon using fluorescence measurements taken every 0·1°C. We have validated the assay by demonstrating excellent specificity and sensitivity in the appropriate clinical context and in addition, shown that HRMA can provide a rapid screen for other mutations within a PCR amplicon.

Materials and methods

  1. Top of page
  2. Summary
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Patients

We screened our pathology sample database for all cases of CD103+ lymphoproliferative disorders where the term ‘hairy’ was used in the clinical details/diagnostic summary and identified 83 cases. In addition, we identified 43 cases that had a confirmed diagnosis of SMZL (DNA was kindly provided by Professor Ming-Qing Du, Department of Histopathology, University of Cambridge, UK). We further identified 39 cases of multiple myeloma and 10 cases of chronic lymphocytic leukaemia (CLL), chosen at random. All cases were reassessed for independent pathology review by one of the authors without knowledge of the BRAF mutation status, although complete pathology material was not available in all cases. Only cases with at least 10% atypical lymphoid cells were analysed further. DNA was prepared from fresh peripheral blood/bone marrow or from stored unstained slides and quantified using a Qubit fluorometer (Invitrogen, Paisley, UK), with the exception of the previously characterized SMZL cases where DNA was already available.

High resolution melting analysis

Primers flanking a 136 bp amplicon of BRAF exon 15 encompassing the V600 codon were designed (Rozen & Skaletsky, 2000). Primer sequences were CTGTTTTCCTTTACTTACTACACCTCAG and TGGATCCAGACAACTGTTCAAA. DNA (∼1 ng) was amplified in a final volume of 20 μl containing 1 × Platinum Taq polymerase buffer, 1 unit Platinum Taq polymerase (Invitrogen), 2·5 mmol/l MgCl2, 0·2 mmol/l dNTPs, 0·3 μmol/l of each primer and 1 × LC Green Plus (Idaho Technologies, Salt Lake City, Utah, USA). PCR and HRMA were performed on a Rotorgene 6000 realtime analyser (Qiagen, Crawley, UK). PCR conditions were as follows: 95°C for 10 min followed by 45 cycles of 10 s at 95°C, a touchdown of 64·5°C–54·5°C for 10 s (1°C/cycle) and 20 s at 72°C. After PCR amplification, the PCR product was denatured at 95°C for 1 min and cooled to 40°C for 1 min. A high-resolution melt was immediately performed from 70°C to 95°C rising at 0·1°C/s. Normalization bars for the leading range were set from 73°C to 76°C and from 85°C to 86°C for the trailing range. The resulting data were analysed using Rotorgene Series software V1·7. PCR products were sequenced as required.

Dilution series

A dilution series was prepared using DNA derived from the HT29 cell line, which harbours a heterozygous BRAF V600E mutation, and DNA from a control sample that lacked a BRAF exon 15 mutation. The dilution series contained 0%, 2%, 5%, 10%, 25%, 50% and 100% HT29 DNA.

Results

  1. Top of page
  2. Summary
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Primers spanning BRAF exon 15 were designed and the optimal PCR and HRMA conditions established through a series of preliminary experiments using DNA derived from HT29 (BRAF V600E heterozygous) (data not shown). The detection sensitivity of the assay, determined using a dilution series of HT29 DNA, indicated that the HRMA assay carried a sensitivity of between 5 and 10%. (Fig 1A).

image

Figure 1.  (A). HRMA difference plot for the HT29 dilution series. (B). HRMA difference plot of HCL (Patient [Pt] 1811, 1814) and other CD103+ lymphoproliferative disorder (Pt 1791). (C). Sequence analysis of a CD103+ lymphoproliferative disorder (Pt 1791) and HCL patients (Pt 1811, 1814). The line above the sequence indicates codon 600. (D). HRMA in multiple myeloma (Pt 1790 shows a normal pattern). Patient 3042 sequence indicating a GAT to AAT (D594N) mutation and a GTG to GTA (V600V) mutation.

Download figure to PowerPoint

Of the 83 CD103+ cases identified in our search, 70 demonstrated greater than 10% atypical lymphoid cells in the available pathological material and were analysed further. Independent pathology review of cytology, pathology and immunophenotype identified 48 of these as true HCL. The remaining 22 cases were considered non-HCL CD103+ lymphoproliferative disorders, which could not be sub-classified further into either HCL-variant or SMZL, as adequate pathological material was not available. These 70 cases, along with 43 cases of confirmed SMZL, 39 multiple myeloma and 10 CLL cases were assessed using the BRAF exon 15 HRMA assay.

Of the 48 cases of HCL, confirmed by independent pathology review, all 48 carried a GTG to GAG mutation at codon 600 of BRAF (V600E) as identified by HRMA and verified by sequencing of the PCR product. Of these, 47 carried a monoallelic mutation and one carried a biallelic mutation (Fig 1B, C). The patient who possessed a biallelic V600E mutation had relapsed at the time of sampling. Unfortunately, diagnostic material was not available for this patient. One patient demonstrated a variant HRMA difference plot (data not shown) which was subsequently shown by sequencing to be due to the presence of two mutations; the GTG to GAG mutation at codon 600 (V600E) and a GAT to GAC silent mutation at codon 594 (D594D). Of the 22 other CD103+ lymphoproliferative disorders and the 43 SMZL patients, none yielded a difference plot that would indicate a BRAF mutation and the lack of a BRAF V600E mutation was verified by sequencing. Likewise none of the 10 CLL patients carried a BRAF exon 15 mutation.

Of the 39 myeloma patients assessed, HRMA detected a BRAF exon 15 mutation in one patient (Patient 3042). The difference plot suggested the presence of 2 mutations which was confirmed by sequencing (Fig 1D); a GAT to AAT mutation at codon 594 that results in an aspartic acid to asparagine alteration (D594N) and a GTG to GTA mutation at codon 600 that does not affect the amino acid (V600V). Of potential interest, this patient was diagnosed with end-stage plasma cell leukaemia. No prior diagnostic material was available for assessment.

Discussion

  1. Top of page
  2. Summary
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

We have developed and validated a HRMA assay for the detection of BRAF exon 15 mutations. The assay is rapid (approximately 90 min) and carries a sensitivity of 5–10%, which is similar to other HRMA assays (Boyd et al, 2010) and potentially superior to direct sequencing, an important point for a diagnostic assay where the tumour content may be <30%. This allowed us to screen samples with 10% neoplastic cells, which was a lower threshold than the 30% used in the report by Tiacci et al (2011). Of 162 lymphoproliferative disorder patients analysed with HRMA, all 48 HCL patients were positive for the V600E mutation, while 114 non-HCL cases were all V600E negative. The detection of the BRAF V600E mutation in all cases of HCL is in agreement with the recently published report of Tiacci et al (2011). Furthermore, the lack of the BRAF V600E mutation in other immunophenotypically similar lymphoproliferative disorders, such as HCL-v, suggests that detection of the BRAF V600E mutation has complete diagnostic specificity and sensitivity in the appropriate context.

Our finding of one multiple myeloma (MM) patient with a BRAF mutation from 39 MM patients screened, is similar to the 4% frequency of BRAF mutations in MM reported in a recent study (Chapman et al, 2011). Interestingly, our patient carried two mutations within BRAF exon 15 (D594N; V600V). The V600V change most likely represents a passenger somatic mutation (Pleasance et al, 2010). Mutations affecting the D594 codon have been identified in many solid tumours, being most frequent in colorectal cancers (Kamata et al, 2010) although D594 mutations have not previously been reported in multiple myeloma. Unlike V600 mutations, D594 mutations have impaired kinase activity (Wan et al 2004), can induce aneuploidy in splenocytes (Kamata et al, 2010) and can drive tumourigenesis through cooperation with mutant RAS (Heidorn et al, 2010).

We believe that the demonstration of a BRAF V600E mutation will rapidly become a key part of the laboratory diagnosis of HCL, as has been the case for other haematological disorders where identifying specific mutations is now central to laboratory diagnosis, e.g. JAK2 V617F in myeloproliferative disorders (James et al, 2005). Simple yet sensitive assays, such as HRMA, will provide a useful tool for specialist haematopathology laboratories.

Acknowledgements

  1. Top of page
  2. Summary
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

We would like to acknowledge the assistance of Professor Ming-Qing Du, Andrea Goday-Fernández, Dr Hongxiang Liu, Krishna Vaghela and Dr Qingguo Yan.

References

  1. Top of page
  2. Summary
  3. Materials and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  • Basso, K., Liso, A., Tiacci, E., Benedetti, R., Pulsoni, A., Foa, R., Di Raimondo, F., Ambrosetti, A., Califano, A., Klein, U., Dalla-Favera, R. & Falini, B. (2004) Gene expression profiling of hairy cell leukemia reveals a phenotype related to memory B cells with altered expression of chemokine and adhesion receptors. The Journal of Experimental Medicine, 199, 5968.
  • Boyd, E.M., Bench, A.J., Goday-Fernández, A., Anand, S., Vaghela, K.J., Scott, M.A., Bareford, D., Green, A.R., Huntly, B. & Erber, W.N. (2010) Clinical utility of routine MPL exon 10 analysis in the diagnosis of essential thrombocythemia and primary myelofibrosis. British Journal of Haematology, 149, 250257.
  • Chapman, M.A., Lawrence, M.S., Keats, J.J., Cibulskis, K., Sougnez, C., Schinzel, A.C., Harview, C.L., Brunet, J.P., Ahmann, G.J., Adli, M., Anderson, K.C., Ardlie, K.G., Auclair, D., Baker, A., Bergsagel, P.L., Bernstein, B.E., Drier, Y., Fonseca, R., Gabriel, S.B., Hofmeister, C.C., Jagannath, S., Jakubowiak, A.J., Krishnan, A., Levy, J., Liefeld, T., Lonial, S., Mahan, S., Mfuko, B., Monti, S., Perkins, L.M., Onofrio, R., Pugh, T.J., Rajkumar, S.V., Ramos, A.H., Siegel, D.S., Sivachenko, A., Stewart, A.K., Trudel, S., Vij, R., Voet, D., Winckler, W., Zimmerman, T., Carpten, J., Trent, J., Hahn, W.C., Garraway, L.A., Meyerson, M., Lander, E.S., Getz, G. & Golub, T.R. (2011) Initial genome sequencing and analysis of multiple myeloma. Nature, 24, 467472.
  • Gustafsson, B., Angelini, S., Sander, B., Christensson, B., Hemminki, K. & Kumar, R. (2005) Mutations in the BRAF and N-ras genes in childhood acute lymphoblastic leukaemia. Leukemia, 19, 310312.
  • Heidorn, S.J., Milagre, C., Whittaker, S., Nourry, A., Niculescu-Davus, I., Dhomen, N., Hussain, J., Reis-Filho, J.S., Springer, C.J., Pritchard, C. & Marais, R. (2010) Kinase-dead BRAF and oncogenic RAS cooperate to drive tumor progression through CRAF. Cell, 140, 209221.
  • James, C., Ugo, V., Le Couédic, J.P., Staerk, J., Delhommeau, F., Lacout, C., Garçon, L., Raslova, H., Berger, R., Bennaceur-Griscelli, A., Villeval, J.L., Constantinescu, S.N., Casadevall, N. & Vainchenker, W. (2005) A unique clonal JAK2 mutation leading to constitutive signalling causes polycythaemia vera. Nature, 434, 11441148.
  • Kamata, T., Hussain, J., Giblett, S., Hayward, R., Marais, R. & Pritchard, C. (2010) BRAF inactivation drives aneuploidy by deregulating CRAF. Cancer Research, 70, 84758486.
  • Lee, J.W., Yoo, N.J., Soung, Y.H., Kim, H.S., Park, W.S., Kim, S.Y., Lee, J.H., Park, J.Y., Cho, Y.G., Kim, C.J., Ko, Y.H., Kim, S.H., Nam, S.W., Lee, J.Y. & Lee, S.H. (2003) BRAF mutations in non-Hodgkin’s lymphoma. British Journal of Cancer, 89, 19581960.
  • Pleasance, E.D., Stephens, P.J., O’Meara, S., McBride, D.J., Meynert, A., Jones, D., Lin, M.L., Beare, D., Lau, K.W., Greenman, C., Varela, I., Nik-Zainal, S., Davies, H.R., Ordoñez, G.R., Mudie, L.J., Latimer, C., Edkins, S., Stebbings, L., Chen, L., Jia, M., Leroy, C., Marshall, J., Menzies, A., Butler, A., Teague, J.W., Mangion, J., Sun, Y.A., McLaughlin, S.F., Peckham, H.E., Tsung, E.F., Costa, G.L., Lee, C.C., Minna, J.D., Gazdar, A., Birney, E., Rhodes, M.D., McKernan, K.J., Stratton, M.R., Futreal, P.A. & Campbell, P.J. (2010) A small-cell lung cancer genome with complex signatures of tobacco exposure. Nature, 463, 184190.
  • Rozen, S. & Skaletsky, H.J. (2000) Primer3 on the WWW for general users and for biologist programmers. In: Bioinformatics Methods and Protocols: Methods in Molecular Biology (eds by S. Krawetz & S. Misener), pp. 365386. Humana Press, Totowa, NJ.
  • Swerdlow, S.H., Campo, E., Harris, N.L., Jaffe, E.S., Pileri, S.A., Stein, H., Thiele, J. & Vardiman, J.W. (eds) (2008) WHO Classification of Tumours of Hematopoietic and Lymphoid Tissues, 4th edn. International Agency for Research on Cancer, Lyon.
  • Tiacci, E., Trifonov, V., Schiavon, i.G., Holmes, A., Kern, W., Martelli, M.P., Pucciarini, A., Bigerna, B., Pacini, R., Wells, V.A., Sportoletti, P., Pettirossi, V., Mannucci, R., Elliott, O., Liso, A., Ambrosetti, A., Pulsoni, A., Forconi, F., Trentin, L., Semenzato, G., Inghirami, G., Capponi, M., Di Raimondo, F., Patti, C., Arcaini, L., Musto, P., Pileri, S., Haferlach, C., Schnittger, S., Pizzolo, G., Foà, R., Farinelli, L., Haferlach, T., Pasqualucci, L., Rabadan, R. & Falini, B. (2011) BRAF mutations in hairy-cell leukemia. New England Journal of Medicine, 364, 23052315.
  • Wan, P.T., Garnett, M.J., Roe, S.M., Lee, S., Niculescu-Duvaz, D., Good, V.M., Jones, C.M., Marshall, C.J., Springer, C.J., Barford, D., Marais, R. & Cancer Genome Project. (2004) Mechanism of activation of the RAF-ERK signaling pathway by oncogenic mutations of B-RAF. Cell, 116, 855867.
  • Zhang, X., Reis, M., Khoriaty, R., Li, Y., Ouillette, P., Samayoa, J., Carter, H., Karchin, R., Li, M., Diaz, Jr, L.A., Velculescu, V.E., Papadopoulos, N., Kinzler, K.W., Vogelstein, B. & Malek, S.N. (2011) Sequence analysis of 515 kinase genes in chronic lymphocytic leukemia. Leukemia, epub ahead of print doi: 10.1038/leu.2011.163.