SEARCH

SEARCH BY CITATION

Keywords:

  • HHV-6;
  • Hodgkin;
  • lymphoma;
  • herpesvirus

Summary

  1. Top of page
  2. Summary
  3. Patients and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. Authorship
  8. Conflicts of interest
  9. References

Classical Hodgkin lymphoma (HL) exhibits a bi-modal age distribution that suggests an infectious aetiology. However, most cases of nodular sclerosis HL (NSHL) are Epstein–Barr virus (EBV) negative (60–90%). Previous studies regarding human herpesvirus 6 (HHV-6) positivity of HL have led to conflicting results. In order to clarify this situation, we examined NSHL biopsies for the presence and distribution of HHV-6 by immunohistochemistry (IHC), polymerase chain reaction (PCR), and fluorescence in situ hybridization (FISH). PCR identified HHV-6 DNA in 86% of NSHL cases. As HHV-6 DNA was also identified in most cases of reactive lymphoid hyperplasia, we sought to localize the virus to specific cells by IHC, which detected HHV-6 in Reed–Sternberg (RS) cells of nearly half (48%) of NSHL cases. Dual CD30/HHV-6 immunostaining confirmed HHV-6 immunoreactivity in CD30+ RS cells, and HHV-6 PCR positivity was confirmed in laser capture microdissection-isolated CD30+ RS cells. FISH demonstrated multiple copies of HHV-6 genome in scattered cells. In contrast, EBV+ RS cells were identified in only 24% of the cases. HHV-6+ cases trended toward a younger age than EBV+ cases. These results conclusively demonstrate that RS cells in many cases of NSHL are HHV-6 positive, and suggest that HHV-6 may play a role in NSHL pathogenesis, particularly in younger patients with EBV-negative disease.

Classical Hodgkin lymphoma (cHL) is a malignant neoplasm composed of scattered malignant Reed–Sternberg (RS) cells admixed within a reactive inflammatory infiltrate. The RS cells of cHL are hyperdiploid germinal centre-derived B cells that carry numerous immunoglobulin gene mutations and cytogenetic defects (Bräuninger et al, 2006). While the aetiology of cHL remains unknown, the peculiar bi-modal age distribution of the disease, with a young adult peak (15–34 years) and a second peak in the elderly (>55 years), suggests that some cases, particularly those in young adults, may be due to an infectious agent (Grufferman & Delzell, 1984). The discovery that a variable proportion of cases of cHL contain clonal Epstein–Barr virus (EBV) infected RS cells partially confirmed this suggestion (Weiss et al, 1989). However, it is the nodular sclerosis subtype of HL (NSHL), the most common subtype of cHL, which is least often EBV-associated, with EBV positivity limited to 10–40% of cases (Hummel et al, 1992).

While attempts to identify alternate infectious agents in EBV-negative cHL have largely been unsuccessful, there are reports of an association between human herpesvirus 6 (HHV-6) and cHL (Marasca et al, 1990; Torelli et al, 1991; Maeda et al, 1993; Krueger et al, 1994, 2001; Rojo et al, 1994; Trovato et al, 1994; Valente et al, 1996; Luppi et al, 1998; Schmidt et al, 2000; Lacroix et al, 2007). To further clarify the relationship of HHV-6 infection with NSHL, we examined lymphoid tissue from a randomly selected cohort of 21 NSHL cases for the presence of HHV-6 by immunohistochemistry (IHC), polymerase chain reaction (PCR, followed by sequencing and Southern blotting), and fluorescence in situ hybridization (FISH) in order to (i) identify virus by three modalities, (ii) localize virus to specific cell types, and (iii) compare the cellular distribution of HHV-6 with EBV in HL tissue.

HHV-6 infection is very common in the first 2 years of life, often presenting as roseola infantum, an acute febrile illness accompanied by diffuse rash (Yamanishi et al, 1988). In adults, primary infection often presents as heterophile-negative mononucleosis. By adulthood, more than 90% of adults are seropositive (Saxinger et al, 1988; Levy et al, 1990). Like all herpesvirus infections, primary HHV-6 infection is usually followed by lifelong asymptomatic latent persistence. Under conditions of stress or immune compromise, symptomatic recurrence due to lytic viral reactivation can occur. In immunocompromised adults, HHV-6 reactivation may be associated with fever, pneumonitis, hepatitis, neurological dysfunction, and marrow failure (De Bolle et al, 2005). Under normal circumstances, HHV-6 DNA can be detected in situ in a number of organs and tissues, including lymphoid tissue (Chen & Hudnall, 2006). In these sites the virus is capable of infecting a broad range of cell types via the ubiquitous CD46 receptor (Isegawa et al, 1999). HHV-6 is a beta-herpesvirus with close sequence similarity to HHV-7 and cytomegalovirus (Berneman et al, 1992). Two HHV-6 variants, HHV-6A and HHV-6B, differ both in genetic sequence (90% similarity) and biological features (Ablashi et al, 1991; Schirmer et al, 1991; Dominguez et al, 1999; Santoro et al, 1999). While the majority of clinical infections in immune competent hosts are apparently due to the HHV-6B variant, disease in immunocompromised patients and patients with neurological presentations are sometimes due to the HHV-6A variant (Hall et al, 1998).

Patients and methods

  1. Top of page
  2. Summary
  3. Patients and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. Authorship
  8. Conflicts of interest
  9. References

Case materials

Following Yale-New Haven Hospital Institutional Review Board approval, paraffin blocks of 31 lymph node cases of HL were selected from the Surgical Pathology files of Yale-New Haven Hospital.

Cell lines

HSB-2 T cells (HHV6A infected and uninfected) and MOLT-3 T cells (HHV6B infected and uninfected) were propagated in suspension cell culture according to supplier instructions (HHV-6 Foundation, Santa Barbara, CA, USA). Formalin-fixed paraffin-embedded (FFPE) cell pellets were used as controls for HHV-6 immunohistochemistry and HHV-6 FISH. DNA extracted from fresh cells was used as controls for PCR and Southern blotting.

Immunohistochemistry and colourimetric in situ hybridization

Four micrometer sections of FFPE tissue affixed to charged glass slides were sequentially subjected to deparaffinization in xylene, rehydration in aqueous ethanol, and antigen retrieval, followed by overnight incubation with primary antibody. After rinsing, bound primary antibody was detected with a standard avidin-biotin complex technique [Vectastain Universal Elite ABC Kit (HRP); Vector Laboratories Inc., Burlingame, CA, USA] using either 3,3′-diaminobenzidine (DAB) or very intense purple (VIP) substrate, and followed by haematoxylin counterstain. HHV-6 immunostaining was routinely performed with a murine monoclonal antibody to HHV6 viral lysate [HHV-6 (20), sc-57804; Santa Cruz Biotechnology, Santa Cruz, CA, USA]. Additional antibodies used included monoclonal antibodies to HHV-6 p37 latent protein (HHV-6 Foundation), p98 late antigen (HHV-6 Foundation), and p140 capsid polypeptide (35-552; Prosci, Poway, CA, USA). To ensure antibody reactivity with FFPE tissue, HHV-6 antibodies were first tested for reactivity on FFPE sections of HHV-6B positive MOLT3 and HHV-6A positive HSB-2 cells (Fig 1). Colourimetric EBV in situ hybridization (ISH) was performed on protease-treated tissue sections with a digoxigenin-labelled EBV–encoded small RNA (EBER) probe cocktail according to manufacturer instructions (EBER ISH kit; Dako, Carpenteria, CA, USA) using EBV-positive nasopharyngeal carcinoma or HL tissue as positive control.

image

Figure 1. HHV-6 immunohistochemistry of formalin-fixed paraffin-embedded positive control cell lines. (A) HHV-6 (20) whole virus lysate antibody (Santa Cruz Biotechnology); HHV6A+ HSB-2 cell line (late culture). (B) HHV-6 (20) whole virus lysate antibody (Santa Cruz Biotechnology); HHV6B+ MOLT3 cell line (early culture). (C) HSB-2 cell line (uninfected). (D) MOLT3 cell line (uninfected). Original magnification ×400.

Download figure to PowerPoint

Laser capture microdissection (LCM) of RS cells

Five micrometer sections of selected HHV-6 positive NSHL cases were affixed to membrane-coated glass slides (Arcturus PEN Membrane Glass Slides; Applied Biosystems, Life Technologies, Carlsbad, CA, USA) and subjected to either cresyl violet staining or immunoperoxidase staining for CD30 [BerH2 clone (Dako), Ventana Benchmark]. Laser capture microdissection of large lacunar RS cells was performed using a Leica DM6000B instrument according to manufacturer instructions. Approximately 50–100 lacunar RS cells were collected from each case, subjected to DNA extraction (Recover All Total Nucleic Acid Isolation Kit, Ambion; Life Technologies), and amplified by whole genome amplification (Genome Plex WGA Reamplification Kit; Sigma-Aldrich, St. Louis, MO, USA).

PCR and Southern blot

DNA extracted from 10-μm tissue sections according to manufacturer instructions (Recover All Total Nucleic Acid Isolation Kit, Ambion) was subjected to PCR using primers to HHV-6 genes B3, DR6, U86, and U94 (Table 1). PCR products were initially eluted from gels and sequenced to confirm their identity. In selected cases, Southern blotting was also performed with biotinylated probes. As U94 PCR was used as our initial screen of HL tissues, we confirmed the high sensitivity of the assay by PCR of 10-fold serial dilutions of positive control DNA (1 pg of HHV-6+ cell line DNA, roughly translating to 1 infected cell per 105 uninfected cells). The size of the U86 PCR product was used to differentiate between HHV-6A (209 bp) and HHV-6B (311 bp) strains as previously described (Isegawa et al, 1999). In order to compare viral load in LCM-isolated RS cells and whole tissue, real time PCR was performed on 1 ng of DNA from both isolated RS cells and whole tissue from two cases of HL in the presence of the DNA-binding fluorescent dye SYBR Green.

Table 1. HHV-6 polymerase chain reaction (PCR) primer sequences and product sizes
PCR oligoPrimer sequenceProduct size (bp)
B3FTGTGCGCGTGACCGTATCCC93
B3RACGGCACGTAAGCACATTGTGTGT 
DR6FGCCGACGAACACGACCTGCT199
DR6RGGTGTCCCGCGTACAGGTGC 
U86FAACTCTTACAAAAAACATCATGAC209(A) or 311(B)
U86RCCTTCTTCAGAGCTACTGGAAT 
U94FCAGTTCCAATGGGCGTGGACAAAT215
U94RATCCACGCGTCTTCCGTGACTATT 

HHV-6 FISH

Two non-overlapping HHV-6B DNA fragments (27 and 38 kb) isolated from cosmid clones (pMF147-31 and pMF210-8, HHV-6 Foundation) were directly labelled with Alexa Fluor 488 according to manufacturer instructions (FISH Tag DNA Green Kit; Invitrogen, Life Technologies). In some cases, a chromosome 3 probe [CEP3 (D3Z1), 3p11.1-q11.1 Alpha Satellite DNA, spectrum orange conjugate; Abbott Molecular, Abbott Park, IL, USA] was used as an internal control. Controls consisted of normal tonsil sections as well as FFPE pellets of HHV-6 infected and uninfected cell lines HSB-2 and MOLT-3 (HHV-6 Foundation). FISH on paraffin sections was performed as per manufacturer instructions with the Paraffin Pretreatment Kit (Abbott Molecular).

Results

  1. Top of page
  2. Summary
  3. Patients and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. Authorship
  8. Conflicts of interest
  9. References

HHV-6 DNA is frequently detected in NSHL by PCR

Twenty-seven of 31 (87%) HL tissues were initially screened for HHV-6 positivity by PCR using primers to the HHV-6 gene U94 (Fig 2). As judged by staining intensity the viral load varied tremendously, with a high viral load in 14 cases and a low viral load in 13 cases. All U94 positive cases were confirmed by B3 and/or DR6 PCR positivity. In cases with ambiguous PCR results, Southern blotting or product sequencing was performed. Based upon tissue sufficiency, 21 of the initial 31 cases were subjected to further analysis (Table 2). Eighteen of the 21 selected cases (86%) were HHV-6 U94 PCR positive. Of 10 cases with interpretable U86 PCR results, four were HHV-6A positive, three were HHV-6B positive, and three were positive for both HHV-6 A and HHV-6B. In order to determine the frequency of HHV-6 positivity in non-neoplastic lymphoid tissue, six cases of reactive lymphoid hyperplasia were subjected to U94 PCR. Not surprisingly, given its frequent detection in normal lymphoid tissues (Chen & Hudnall, 2006), five of these six cases (83%) were U94 PCR positive (Fig 3).

image

Figure 2. HHV-6 U94 PCR of Hodgkin lymphoma. Twenty seven of 31 (87%) of HL cases were positive for HHV-6 using primers to the U94 gene. The 19 lanes in the top gel are loaded with PCR product from 19 cases of HL. The 19 lanes in the bottom gel are loaded (from left to right) with PCR product from an additional 12 cases of HL, one empty lane, two positive controls (HHV-6A, HHV-6B), one empty lane, a negative (water) control, and two empty lanes. Viral load appears to vary tremendously from case to case – in 14 cases the viral load is quite high, while in another 13 cases the viral load is very low.

Download figure to PowerPoint

image

Figure 3. HHV-6 U94 PCR of reactive lymphoid hyperplasia (RLH). Five of six cases were positive for HHV-6 (three strong, two faint).

Download figure to PowerPoint

Table 2. Summary of findings in nodular sclerosis Hodgkin lymphoma
NSHL caseAge (years), GenderSite/StageRx/Immunosuppression/StatusU94/B3/DR6 PCR (Southern blot)HHV-6 U86 PCRaHHV-6 IHC (RSC)EBER ISH (RSC)
  1. NSHL, nodular sclerosis Hodgkin lymphoma; Rx, treatment received; PCR, polymerase chain reaction; IHC, immunohistochemistry; EBER ISH, Epstein–Barr virus–encoded small RNA in situ hybridization; RSC, Reed–Sternberg cells; M, male; F, female; NA, not available; C-MOPP, cyclophosphamide, vincristine, procarbazine, prednisone; ABVD, adriamycin, bleomycin, vinblastine, dacarbazine; ABVE-PC, adriamycin, bleomycin, vincristine, etoposide, cyclophosphamide, prednisone; CHOP, cyclophosphamide, hydroxydaunorubicin, vincristine, prednisone; R-CHOP, CHOP + rituxan; SCT, stem cell transplantation.

  2. a

    HHV-6 subtype (AB = A and B).

  3. b

    Laser capture microdissection (LCM)-captured RS cells (RSC) PCR positive.

  4. c

    Whole tissue (WT) PCR positive.

  5. d

    Steroid-nonresponsive focal segmental glomerulosclerosis treated with Ritiximab.

  6. e

    History of HIV-AIDS, hepatitis B, hepatitis C.

154/MInguinal/IIC-MOPP/No/Alive 2 yearsPOS RSCbBPOSPOS
223/MMediastinal/IVBABVD/No/Alive 1 yearPOS WTc NEGNEG
322/FMediastinal/IIABVD, SCT/No/Alive 1 yearPOS WT NEGNEG
417/FCervical/IVBABVEPC/No/Alive 1 yearPOS RSCAPOSNEG
517/FCervical/IVBABVEPC/Yesd/Alive 1 yearPOS WTAPOSNEG
612/MMediastinal/IIAABVD/No/Alive 3 yearsNEG WTBNEGNEG
714/FMediastinal/IIAABVEPC/No/Alive 1 yearNEG WT NEGNEG
816/MCervical/IIAABVD/No/Alive 4 yearsPOS RSC POSNEG
931/MCervical/NANA/NA/NAPOS WT NEGPOS
1066/MInguinal/IIBABVD/No/Alive 8 yearsPOS RSCBPOSNEG
1113/FCervical/IIBABVEPC/No/Alive 3 yearsPOS WT POSNEG
1238/MAxillary/IIIBABVD, C-MOPP, SCT/No/Alive 3 yearsPOS WT NEGNEG
1360/MSubcarinal/IIIBCHOP/Yese/Deceased 2 yearsPOS RSC POSPOS
1464/MInguinal/IIIBCHOP/No/Alive 1 yearNEG WTABNEGNEG
1516/FCervical/IVBABVEPC/No/Alive 4 yearsPOS WT NEGNEG
1620/MCervical/IIIAABVD, SCT/No/Alive 3 yearsPOS RSCANEGPOS
1739/MCervical/IIIBABVD/No/Alive 3 yearsPOS WT NEGNEG
1870/MInguinal/IVBR-CHOP/No/Alive 1 yearPOS RSCABPOSPOS
1914/MCervical/IVBABVEPC/No/Alive 1 yearPOS WTABNEGNEG
2015/MCervical/IIAABVD/No/Alive 4 yearsPOS WTAPOSNEG
2116/MCervical/IIBABVEPC/No/Alive 1 yearPOS RSC POSNEG

HHV-6 positive RS cells are identified by IHC in NSHL

Using a monoclonal antibody to whole virus lysate [HHV-6 (20), Santa Cruz Biotechnology], HHV-6 positivity was detected in 86% of the NSHL cases. Nearly half of the cases (10/21; 48%) contained HHV-6 positive RS cells (Fig 4A, B). HHV-6 positivity of RS cells was conclusively demonstrated by dual staining of tissue sections with both HHV-6 and CD30 antibodies, with numerous dual CD30/HHV-6 positive RS cells identified (Fig 4D). In NSHL cases with HHV-6 negative RS cells, virus was detected in scattered small leucocytes (Fig 4C). In addition to positivity with monoclonal antibody to whole virus lysate, scattered positive RS cells were also detected with monoclonal antibodies to HHV-6 p41 late antigen, p98 late antigen, and U94 latent antigen (Fig 5).

image

Figure 4. HHV-6 IHC positivity of RS cells and reactive leucocytes in NSHL. (A, B) Two cases of nodular sclerosis Hodgkin lymphoma (NSHL) with numerous HHV-6 positive Reed–Sternberg (RS) cells. (A) Original magnification ×400; (B) Original magnification ×600. (C) NSHL case with numerous HHV-6 positive small leucocytes. Original magnification ×400. (D) A large binucleated RS cell in the centre of the image displaying golden brown CD30 staining of the cell membrane and Golgi zone, and deep purple granular HHV-6 staining in the cytoplasm. Original magnification ×1000.

Download figure to PowerPoint

image

Figure 5. HHV-6 IHC-positive RS cells in NSHL. (A) HHV-6 p98 late antigen. (B) HHV-6 p41 late antigen. (C) HHV-6 U94 latent antigen. Original magnification ×600.

Download figure to PowerPoint

HHV-6 IHC positive RS cells contain HHV-6 DNA

In order to confirm the presence of HHV-6 within IHC-positive RS cells, PCR was performed on DNA from RS cells isolated by LCM following cresyl violet or CD30 staining (Fig 6). DNA from laser-captured RS cells yielded significantly increased U94 PCR product in comparison with DNA from whole tissue (Fig 7), a result that confirmed the presence of HHV-6 within RS cells. Furthermore, multiple copies of HHV-6 DNA were identified in large (presumably RS) cells by interphase FISH in HL tissue sections (Fig 8).

image

Figure 6. Laser capture microdissection of CD30-positive RS cells. (A) NSHL case with numerous CD30-positive RS cells (DAB brown stain). (B) Same case after laser capture microdissection (LCM) with missing CD30-positive RS cells.

Download figure to PowerPoint

image

Figure 7. HHV-6 U94 PCR from LCM-isolated cresyl violet-stained RS cells. (A) Note the increased PCR product from LCM-isolated RS cells (RS) as compared with whole tissue (WT) from two representative cases. Beta-globin PCR demonstrates that an equal amount of DNA was loaded for all PCR reactions. (B) Increased PCR product from isolated RS cells (RS) of same two cases, as compared with whole tissue (WT) is also demonstrated by quantitative real time PCR.

Download figure to PowerPoint

image

Figure 8. HHV-6 FISH positivity in NSHL. (A) HHV-6 positive MOLT 3 cell line. Note the 4 copies of chromosome 3 centromeric probe in these aneuploid cells (red) and multiple copies of HHV-6 (yellow signal). (B) Normal tonsil with rare scattered HHV-6 signals (latent infection?). (C, D) Two HHV-6 positive nodular sclerosis Hodgkin lymphoma (NSHL) cases with numerous scattered HHV-6 positive cells harbouring multiple copies of HHV-6 DNA.

Download figure to PowerPoint

Some cases of NSHL contain both HHV-6 and EBV positive RS cells

EBV–encoded small RNA ISH-positive RS cells were detected in 5 of 21 NSHL cases (24%). In three of these cases, RS cells were dual HHV6/EBV positive, while in two cases the RS cells were positive only for EBV.

HHV-6 positive NSHL trends toward a younger age than EBV positive NSHL

Ages of the 21 patients in this study ranged from 12 to 70 years with a median age of 20. The male female ratio was 2·5:1. Most patients presented with either cervical or mediastinal adenopathy. Nine patients presented with stage II disease, five with stage III, and six with stage IV disease. Most patients presented with B symptoms. Two patients were immunosuppressed – one patient carried a past history of human immunodeficiency virus (HIV), hepatitis B, and hepatitis C infection, while another patient carried a past history of steroid-unresponsive glomerulosclerosis. Initial treatment consisted of standard multi-agent chemotherapy, in three cases followed by autologous or allogeneic stem cell transplant. All but one patient is alive 1–8 years after diagnosis. The HIV-positive patient died 2 years after HL diagnosis. An interesting trend was noted when comparing ages of patients with HHV-6 positive disease and EBV-positive disease – patients with HHV-6 positive RS cells trended (P = 0·073) toward a younger age (mean age 23 years) than patients with EBV-positive RS cells (mean age 47 years). The mean age of patients with dual HHV-6/EBV negative disease was 29 years.

Discussion

  1. Top of page
  2. Summary
  3. Patients and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. Authorship
  8. Conflicts of interest
  9. References

The bimodal age distribution of cHL has been offered as evidence that the disease may be related to an infectious agent. It is now clear that approximately 40% of all cases of cHL are associated with infection by EBV, a human herpesvirus that is also associated with a number of other tumours, including endemic Burkitt lymphoma and nasopharyngeal carcinoma. EBV has been shown to be an oncogenic virus, capable of transforming B-lymphocytes in vitro due to the concerted actions of latent genes EBNA 1-6, LMP1, and EBER1-2. In EBV-positive cases of cHL the virus can be demonstrated in the malignant RS (RS) cells by LMP-1 immunostaining and EBER ISH. Despite the strong association of cHL with EBV, a relatively large number of cHL cases are EBV-negative. In particular, most cases of the most common subtype of cHL, the nodular sclerosis subtype (NSHL), are EBV-negative. Some previous studies have identified an association of HHV-6 with cHL using a variety of techniques, including IHC and PCR.

Increased HHV-6 antibody titres have been described in patients with HL (Levine et al, 1992; Alexander et al, 1995). In addition, several studies have reported HHV-6 positivity in HL tissue by PCR, IHC, or ISH (Marasca et al, 1990; Torelli et al, 1991; Maeda et al, 1993; Krueger et al, 1994, 2001; Rojo et al, 1994; Trovato et al, 1994; Valente et al, 1996; Luppi et al, 1998; Schmidt et al, 2000; Lacroix et al, 2007). In these studies, HHV-6 PCR positivity ranged widely, from 5% to 79% (Torelli et al, 1991; Trovato et al, 1994; Schmidt et al, 2000; Lacroix et al, 2007). In contrast, in two other studies, HHV-6 was not detected in HL tissues by PCR or Southern blot (Armstrong et al, 1998; Shiramizu et al, 2001). While the positive IHC studies consistently described HHV-6 positivity in reactive lymphocytes and histiocytes (Maeda et al, 1993; Krueger et al, 1994, 2001; Rojo et al, 1994; Valente et al, 1996; Luppi et al, 1998), there is no consensus regarding RS cell positivity. In some studies (Rojo et al, 1994; Kashanchi et al, 1997; Luppi et al, 1998), scattered HHV-6 IHC positive RS cells were seen, while in other studies, HHV-6 positive RS cells were not seen (Maeda et al, 1993; Valente et al, 1996).

As outlined above, previous studies did not reach consensus regarding an association of HHV-6 with HL. Some differences in HHV-6 detection in HL may be due to real biological differences in sample cohorts, including ethnic composition, age distribution (paediatric vs. adult), and HL subtype composition (e.g. NSHL vs. other cHL). Alternatively, discrepant PCR results may be due to differences in tissue quality, sample DNA preparation, Taq DNA polymerase source, amount of loaded DNA, primer design, PCR cycling conditions, gel electrophoresis, and choice of controls. Lastly, discrepant results may stem from reliance upon a single technique (PCR or IHC) for detection of HHV-6 in HL tissue. In our experience, all of these factors may contribute to discrepant HHV-6 PCR results, requiring changes in reagents and methods, use of multiple detection techniques, and confirmation by Southern blotting or sequencing of PCR products.

Our current results conclusively demonstrate the presence of HHV-6 in NSHL tissue using a variety of techniques. Positive PCR results for several different HHV-6 genes were corroborated by Southern blot and/or sequencing. In 10 cases with interpretable U86 PCR results, both HHV-6A and HHV-6B isolates were identified. Both HHV-6A and HHV-6 were identified in three cases. In these cases it is not known if the two subtypes are shared by both RS cells and reactive leucocytes or whether the subtypes segregate between reactive and neoplastic cells. In contrast to our findings, Lacroix et al (2007) reported that nearly all their isolates in HL were HHV-6B, and did not report dual positivity. While the genomes of HHV-6A and HHV-6B subtypes overall share 90% sequence identity, they nevertheless differ considerably in the right end of the genome, spanning a region encoding 15 genes (Dominguez et al, 1999). For discrimination between HHV-6A and HHV-6B, Lacroix et al (2007) utilized a PCR assay based upon a subtype-specific sequence difference in the U31 gene (Collot et al, 2002), while we have used an assay based upon a HHV-6A specific deletion in the U86 gene (Isegawa et al, 1999). Unfortunately, the Collot assay (Collot et al, 2002) is unlikely to be useful to better define the HHV-6 subtype of our cases because DNA obtained from FFPE tissue seldom exceeds 300–350 bp in length. Nevertheless, we plan in the future to develop an alternative PCR assay to confirm the HHV-6 subtype in our cases.

HHV-6 specific immunohistochemistry was performed to localize virus to specific cell types. In those cases with HHV-6 positive RS cells by IHC, DNA obtained from micro-dissected RS cells was subjected to HHV-6 PCR to confirm the presence of HHV-6 in malignant RS cells. Findings of scattered positivity for late antigens p98 and p41, and multiple copies of virus detected by FISH are suggestive of viral replication in some RS cells.

While not reaching statistical significance given the small sample size, HHV6+/EBV- cases trended toward younger age than EBV+ cases, results in agreement with those of a previous study (Lacroix et al, 2007). Our findings suggest that HHV-6 may contribute to NSHL pathogenesis, particularly in the younger patient population with EBV-negative disease. A role for HHV-6 in dual EBV/HHV-6 positive cases is also possible because HHV-6 has been shown to induce EBV replication in dual-infected cells in vitro (Flamand et al, 1993). As HHV-6 has not previously been conclusively associated with cancer, very little is known regarding the potential viral oncogenicity. However, in vitro studies indicate that the HHV-6 DR7 gene product is capable of inducing cellular transformation via inhibition of p53 and activation of NFκB, and thus in some settings may act as an oncogene (Kashanchi et al, 1997; Lacroix et al, 2010).

In order to delineate the exact role played by HHV-6 in the pathogenesis of HL, more detailed analysis of the interaction of HHV-6 with RS cells will be required. As has been previously shown for EBV (Weiss et al, 1989), detection of clonal HHV-6 in the RS cells of individual HL cases would provide strong circumstantial evidence that the virus is not merely an innocent bystander, but instead is probably an aetiollogical agent in HL. Assuming that HHV-6 plays an aetiollogical role in HL, it will be important to delineate the contribution of HHV-6 viral genes with transforming ability (such as DR7) to the malignant phenotype of RS cells. It will also be important to analyse the association of HHV-6 infection of RS cells in a larger cohort of HL cases to determine whether HHV-6 positivity is, in fact, more common in young patients with NSHL.

Acknowledgements

  1. Top of page
  2. Summary
  3. Patients and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. Authorship
  8. Conflicts of interest
  9. References

This study was supported by discretionary departmental funds. The authors wish to thank the very generous supply of HHV-6 reagents provided by the HHV-6 Foundation (Santa Barbara, CA, USA).

Authorship

  1. Top of page
  2. Summary
  3. Patients and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. Authorship
  8. Conflicts of interest
  9. References

Contribution: SDH created and designed the study; LL performed immunohistochemistry, PCR, Southern blotting, cell culture, and prepared FISH probes; SDH and AS performed laser capture micro-dissection; AM performed FISH analysis SDH, AS, and LL collected and assembled the data; all authors assisted in the analysis and/or interpretation as well as read and approved the final draft of the manuscript.

References

  1. Top of page
  2. Summary
  3. Patients and methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. Authorship
  8. Conflicts of interest
  9. References
  • Ablashi, D.V., Balachandran, N., Josephs, S.F., Hung, C.L., Krueger, G.R., Kramarsky, B., Salahuddin, S.Z. & Gallo, R.C. (1991) Genomic polymorphism, growth properties, and immunologic variations in human herpesvirus-6 isolates. Virology, 184, 545552.
  • Alexander, F.E., Daniel, C.P., Armstrong, A.A., Clark, D.A., Onions, D.E., Cartwright, R.A. & Jarrett, R.F. (1995) Case clustering, Epstein–Barr virus Reed–Sternberg cell status and herpes virus serology in Hodgkin's disease: results of a case–control study. European Journal of Cancer, 31A, 14791486.
  • Armstrong, A.A., Shield, L., Gallagher, A. & Jarrett, R.F. (1998) Lack of involvement of known oncogenic DNA viruses in Epstein–Barr virus-negative Hodgkin's disease. British Journal of Cancer, 77, 10451047.
  • Berneman, Z.N., Ablashi, D.V., Li, G., Eger-Fletcher, M., Reitz, Jr, M.S., Hung, C.L., Brus, I., Komaroff, A.L. & Gallo, R.C. (1992) Human herpesvirus 7 is a T-lymphotropic virus and is related to, but significantly different from, human herpesvirus 6 and human cytomegalovirus. Proceedings of the National Academy of Science of the United States of America, 89, 1055210556.
  • Bräuninger, A., Schmitz, R., Bechtel, D., Renné, C., Hansmann, M.L. & Küppers, R. (2006) Molecular biology of Hodgkin's and Reed/Sternberg cells in Hodgkin's lymphoma. International Journal of Cancer, 118, 18531861.
  • Chen, T. & Hudnall, S.D. (2006) Anatomical mapping of human herpesvirus reservoirs of infection. Modern Pathology, 19, 726737.
  • Collot, S., Petit, B., Bordessoule, D., Alain, S., Touati, M., Denis, F. & Ranger-Rogez, S. (2002) Real-time PCR for quantification of human herpesvirus 6 DNA from lymph nodes and saliva. Journal of Clinical Microbiology, 40, 24452451.
  • De Bolle, L., Naesens, L. & De Clercq, E. (2005) Update on human herpesvirus 6 biology clinical features, and therapy. Clinical Microbiology Reviews, 18, 217245.
  • Dominguez, G., Dambaugh, T.R., Stamey, F.R., Dewhurst, S., Inoue, N. & Pellett, P.E. (1999) Human herpesvirus 6B genome sequence: coding content and comparison with human herpesvirus 6A. Journal of Virology, 73, 80408052.
  • Flamand, L., Stefanescu, I., Ablashi, D.V. & Menezes, J. (1993) Activation of the Epstein–Barr virus replicative cycle by human herpesvirus 6. Journal of Virology, 67, 67686777.
  • Grufferman, S. & Delzell, E. (1984) Epidemiology of Hodgkin's disease. Epidemiologic Reviews, 6, 76106.
  • Hall, C.B., Caserta, M.T., Schnabel, K.C., Long, C., Epstein, L.G., Insel, R.A. & Dewhurst, S. (1998) Persistence of human herpesvirus 6 according to site and variant: possible greater neurotropism of variant A. Clinical Infectious Disease, 26, 132137.
  • Hummel, M., Anagnostopoulos, I., Dallenbach, F., Korbjuhn, P., Dimmler, C. & Stein, H. (1992) EBV infection patterns in Hodgkin's disease and normal lymphoid tissue: expression and cellular localization of EBV gene products. British Journal of Haematology, 82, 689694.
  • Isegawa, Y., Mukai, T., Nakano, K., Kagawa, M., Chen, J., Mori, Y., Sunagawa, T., Kawanishi, K., Sashihara, J., Hata, A., Zou, P., Kosuge, H. & Yamanishi, K. (1999) Comparison of the complete DNA sequences of human herpesvirus 6 variants A and B. Journal of Virology, 73, 80538063.
  • Kashanchi, F., Araujo, J., Doniger, J., Muralidhar, S., Hoch, R., Khleif, S., Mendelson, E., Thompson, J., Azumi, N., Brady, J.N., Luppi, M., Torelli, G. & Rosenthal, L.J. (1997) Human herpesvirus 6 (HHV-6) ORF-1 transactivating gene exhibits malignant transforming activity and its protein binds to p53. Oncogene, 14, 359367.
  • Krueger, G.R., Guenther, A., Knuefermann, R., Kluppelberg, U., Luka, J., Pearson, G.R., Ablashi, D.V., Juecker, M. & Tesch, H. (1994) Human herpesvirus-6 (HHV-6) in Hodgkin's disease: cellular expression of viral antigens as compared to oncogenes met and fes, tumor suppressor gene product p53, and interleukins 2 and 6. In Vivo, 8, 501505.
  • Krueger, G.R., Huetter, M.L., Rojo, J., Romero, M. & Cruz-Ortiz, H. (2001) Human herpesviruses HHV-4 (EBV) and HHV-6 in Hodgkin's and Kikuchi's diseases and their relation to proliferation and apoptosis. Anticancer Research, 21, 21552161.
  • Lacroix, A., Jaccard, A., Rouzioux, C., Piguet, C., Petit, B., Bordessoule, D. & Ranger-Rogez, S. (2007) HHV-6 and EBV DNA quantitation in lymph nodes of 86 patients with Hodgkin's lymphoma. Journal of Medical Virology, 79, 13491356.
  • Lacroix, A., Collot-Teixeira, S., Mardivirin, L., Jaccard, A., Petit, B., Piguet, C., Sturtz, F., Preux, P.M., Bordessoule, D. & Ranger-Rogez, S. (2010) Involvement of human herpesvirus-6 variant B in classic Hodgkin's lymphoma via DR7 oncoprotein. Clinical Cancer Research, 16, 47114721.
  • Levine, P.H., Ebbesen, P., Ablashi, D.V., Saxinger, W.C., Nordentoft, A. & Connelly, R.R. (1992) Antibodies to human herpes virus-6 and clinical course in patients with Hodgkin's disease. International Journal of Cancer, 51, 5357.
  • Levy, J.A., Ferro, F., Greenspan, D. & Lennette, E.T. (1990) Frequent isolation of HHV-6 from saliva and high seroprevalence of the virus in the population. Lancet, 335, 10471050.
  • Luppi, M., Barozzi, P., Garber, R., Maiorana, A., Bonacorsi, G., Artusi, T., Trovato, R., Marasca, R. & Torelli, G. (1998) Expression of human herpesvirus-6 antigens in benign and malignant lymphoproliferative diseases. American Journal of Pathology, 153, 815823.
  • Maeda, A., Sata, T., Enzan, H., Tanaka, K., Wakiguchi, H., Kurashige, T., Yamanishi, K. & Kurata, T. (1993) The evidence of human herpesvirus 6 infection in the lymph nodes of Hodgkin's disease. Virchows Archiv A, Pathological Anatomy and Histopathology, 423, 7175.
  • Marasca, R., Luppi, M., Montorsi, M., Fancinelli, M., Sabbatini, R., Mariano, M.T. & Selleri, L. (1990) Identification of human herpesvirus HHV-6 sequence in a case of Hodgkin's disease by polymerase chain reaction. Medicina (Firenze), 10, 4345.
  • Rojo, J., Ferrer Argote, V.E., Klueppelberg, U., Krueger, G.R., Eidt, E., Ablashi, D.V., Luka, J. & Tesch, H. (1994) Semi-quantitative in situ hybridization and immunohistology for antigen expression of human herpesvirus-6 in various lymphoproliferative diseases. In Vivo, 8, 517526.
  • Santoro, F., Kennedy, P.E., Locatelli, G., Malnati, M.S., Berger, E.A. & Lusso, P. (1999) CD46 is a cellular receptor for human herpesvirus 6. Cell, 99, 817827.
  • Saxinger, C., Polesky, H., Eby, N., Grufferman, S., Murphy, R., Tegtmeir, G., Parekh, V., Memon, S. & Hung, C. (1988) Antibody reactivity with HBLV (HHV-6) in U.S. populations. Journal of Virologic Methods, 21, 199208.
  • Schirmer, E.C., Wyatt, L.S., Yamanishi, K., Rodriguez, W.J. & Frenkel, N. (1991) Differentiation between two distinct classes of viruses now classified as human herpesvirus 6. Proceedings of the National Academy of Science of the United States of America, 88, 59225926.
  • Schmidt, C.A., Oettle, H., Peng, R., Binder, T., Wilborn, F., Huhn, D., Siegert, W. & Herbst, H. (2000) Presence of human beta- and gamma-herpes virus DNA in Hodgkin's disease. Leukemia Research, 24, 865870.
  • Shiramizu, B., Chang, C.W. & Cairo, M.S. (2001) Absence of human herpesvirus-6 genome by polymerase chain reaction in children with Hodgkin disease: a Children's Cancer Group Lymphoma Biology Study. Journal of Pediatric Hematology/Oncology, 23, 282285.
  • Torelli, G., Marasca, R., Luppi, M., Selleri, L., Ferrari, S., Narni, F., Mariano, M.T., Federico, M., Ceccherini-Nelli, L. & Bendinelli, M. (1991) Human herpesvirus-6 in human lymphomas: identification of specific sequences in Hodgkin's lymphomas by polymerase chain reaction. Blood, 77, 22512258.
  • Trovato, R., Di Lollo, S., Calzolari, A., Torelli, G. & Ceccherini-Nelli, L. (1994) Detection of human herpesvirus-6 and Epstein–Barr virus genome in childhood Hodgkin's disease. Pathologica, 86, 500503.
  • Valente, G., Secchiero, P., Lusso, P., Abete, M.C., Jemma, C., Reato, G., Kerim, S., Gallo, R.C. & Palestro, G. (1996) Human herpesvirus 6 and Epstein–Barr virus in Hodgkin's disease: a controlled study by polymerase chain reaction and in situ hybridization. American Journal of Pathology, 149, 15011510.
  • Weiss, L.M., Movahed, L.A., Warnke, R.A. & Sklar, J. (1989) Detection of Epstein–Barr viral genomes in Reed–Sternberg cells of Hodgkin's disease. New England Journal of Medicine, 320, 502506.
  • Yamanishi, K., Okuno, T., Shiraki, K., Takahashi, M., Kondo, T., Asano, Y. & Kurata, T. (1988) Identification of human herpesvirus-6 as a causal agent for exanthem subitum. Lancet, 1, 10651067.