The increased mucosal mRNA expressions of complement C3 and interleukin-17 in inflammatory bowel disease

Authors


Akira Andoh, Department of Medicine, Shiga University of Medical Science, Seta Tsukinowa, Otsu 520-2192, Japan.
E-mail andoh@belle.shiga-med.ac.jp

Summary

Recent studies have demonstrated that the complement system participates in the regulation of T cell functions. To address the local biosynthesis of complement components in inflammatory bowel disease (IBD) mucosa, we investigated C3 and interleukin (IL)-17 mRNA expression in mucosal samples obtained from patients with IBD. The molecular mechanisms underlying C3 induction were investigated in human colonic subepithelial myofibroblasts (SEMFs). IL-17 and C3 mRNA expressions in the IBD mucosa were evaluated by real-time polymerase chain reaction. The C3 levels in the supernatant were determined by enzyme-linked immunosorbent assay. IL-17 and C3 mRNA expressions were elevated significantly in the active lesions from ulcerative colitis (UC) and Crohn's disease (CD) patients. There was a significant positive correlation between IL-17 and C3 mRNA expression in the IBD mucosa. IL-17 stimulated a dose- and time-dependent increase in C3 mRNA expression and C3 secretion in colonic SEMFs. The C3 molecules secreted by colonic SEMFs were a 115-kDa α-chain linked to a 70-kDa β-chain by disulphide bonds, which was identical to serum C3. The IL-17-induced C3 mRNA expression was blocked by p42/44 mitogen-activated protein kinase (MAPK) inhibitors (PD98059 and U0216) and a p38 MAPK inhibitor (SB203580). Furthermore, IL-17-induced C3 mRNA expression was inhibited by an adenovirus containing a stable mutant form of IκBα. C3 and IL-17 mRNA expressions are enhanced, with a strong correlation, in the inflamed mucosa of IBD patients. Part of these clinical findings was considered to be mediated by the colonic SEMF response to IL-17.

Introduction

Inflammatory bowel disease (IBD), ulcerative colitis (UC) and Crohn's disease (CD) are characterized by chronic inflammation, in which a dysfunction of the host immune response against common antigens such as dietary factors and/or bacteria is involved [1,2]. Recently, an increasing number of studies focused upon a critical role of T helper type 17 (Th17) cells and interleukin (IL)-17 in the pathogenesis of IBD [3–11]. Th17 cells are novel subsets of CD4+ T cells, characterized by IL-17 secretion and the expression of the transcription factor retinoic acid-related orphan receptor (ROR)γ[8,10,12–14]. IL-17 is a pleiotropic cytokine which acts on both immune and non-immune cells [11,15,16], including osteoblasts, fibroblasts, epithelial and endothelial cells [15,17,18]. IL-17 stimulates production of various inflammatory mediators and chemokines in vitro, thus contributing to host defence against bacteria and fungi, particularly at mucosal surfaces, by favouring the local recruitment of immune cells [15,16,19].

The complement system plays an important role as an effector of innate immunity, which was extended with early observations of opsonization and participation in cellular immunity [20,21]. Like the more recently identified Toll-like receptors [22,23], the complement system is regarded as pattern-recognition receptors that have evolved to recognize pathogen-associated molecular patterns (PAMPs). It is now appreciated that the complement system represents a complex pathway of more than 30 serum proteins and cell surface receptors that interact over a range of functions, from direct cell lysis to the enhancement of B and T cell responses [20,21]. Recent studies have demonstrated that the complement system participates in the regulation of T cell functions by multiple mechanisms such as the direct opsonization of foreign antigens by antigen-presenting cells, a modulation of cytokine release and by stimulating the differentiation of regulatory T cells [20,21].

Hepatocytes are the primary source of complement components that circulate through the bloodstream [24]. Conversely, it has been generally accepted that complements are produced locally and contribute to host defence in the tissue sites [24–26]. Because the intestinal mucosa is one of the tissues in which a large number of immune cells are resident, it is likely that the locally biosynthesized complements in the intestine might contribute to the immune and inflammatory responses of the intestinal mucosa via modulation of T cell responses.

The potential importance of complements in the pathophysiology of IBD emerges from the clinical findings of enhanced local secretion of complement components in the intestinal tracts and the increased deposition of terminal complement complexes in the inflamed mucosa of IBD [27–30]. In addition, observations in experimental models of IBD suggest a critical role for complement activation in the pathogenesis of IBD [29,31]. For example, the development of dextran sulphate sodium (DSS) colitis was aggravated in genetically C5-deficient DBA2/J mice, suggesting a protective role of the complement system in the development of DSS colitis [31]. However, to our knowledge, there have been no reports on the local biosynthesis of complement components in IBD mucosa. Furthermore, the role of IL-17 in the stimulation of complement biosynthesis has not yet been investigated fully in any cell types resident in the intestinal mucosa.

In this study, in order to examine the local biosynthesis of complement components in the IBD mucosa, we investigated C3 and IL-17 mRNA expression in biopsy samples obtained from IBD patients. Also, to define the molecular mechanisms underlying C3 expression in inflamed mucosa of IBD patients, we focused upon the effects of IL-17 on C3 induction by human colonic subepithelial myofibroblasts (SEMFs).

Materials and methods

Reagents

Recombinant human IL-17 was obtained from R&D Systems (Minneapolis, MN, USA). All other reagents used in this study were purchased from Sigma Chemical Co. (St Louis, MO, USA).

Tissue samples

The diagnosis of IBD was based on conventional clinical and endoscopic criteria. Biopsied specimens from 23 patients with UC and 28 patients with CD were used with informed consent. The ethics committee of the Shiga University of Medical Science approved this project.

During the sample collection period, all patients were active, clinically and endoscopically, with colitis activity index for UC [32] and Crohn's disease activity index [33]. Histological examinations were performed in macroscopically and microscopically non-affected or affected areas from each patient. All patients were treated with salicylates, and 11 of 23 UC and 10 of 28 CD patients received treatment with corticosteroids. Seven UC and seven CD patients were treated with azathioprine. Biopsy samples derived from infectious colitis (n = 8) were obtained by colonoscopy. Normal colorectal tissues were obtained by the surgical resection of colon cancer at distal tumour sites (n = 10).

Culture of human colonic subepithelial myofibroblasts

Primary colonic SEMF cultures were prepared according to the method reported by Mahida et al. [34]. The cellular characteristics and culture conditions have also been described in our previous report [35]. Samples of the human adult colonic mucosa were obtained from surgical specimens (>5 cm from the tumour margin) from patients undergoing a partial colectomy for carcinoma, with their informed consent. The studies were performed on passages three to six of myofibroblasts isolated from six resection specimens. The human colon cancer cell lines HT-29 [36] were obtained from the American Type Culture Collection (Manassas, VA, USA).

Enzyme-linked immunosorbent assay (ELISA) for the quantification of antigenic C3 and factor B

Antigenic C3 in the samples was quantified by ELISA, as described previously [25]. The lower limit of detection was 5 ng/ml of C3.

Real-time polymerase chain reaction (PCR)

The expression of mRNA in the samples was assessed by real-time PCR analyses. The oligonucleotide primers used in this study are human C3 (sense: GCTGAAGCACCTCATTGTGA, anti-sense: CTGGGTGTACCCCTTCTTGA) [37] and human IL-17 (sense: AGGCACAAACTCATCCATCC, anti-sense: CCCACGGACACCAGTATTT) [38]. Real-time PCR was performed using a LightCycler 2·0 system (Roche Applied Science, Tokyo, Japan). The PCR was performed using a SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA). The data were normalized versusβ-actin for human C3.

Adenovirus-mediated gene transfers

We used a recombinant adenovirus expressing a stable mutant form of IκBα (Ad-IκBΔN) [39], a recombinant adenovirus expressing a dominant negative mutant of c-Jun (Ad-DN-c-Jun) [40], and a recombinant adenovirus containing bacterial β-galactosidase cDNA (Ad-LacZ). The stable mutant form of IκBα (IκBΔN) lacks the 54 NH2-terminal amino acids of the wild-type IκBα, and is neither phosphorylated nor proteolyzed in response to signal induction, but fully inhibits nuclear factor-κB (NF-κB) activation. The dominant negative mutant c-Jun (TAM67) lacks the transactivational domain of amino acids 3–122 of the wild-type c-Jun, but retains the DNA-binding domain. In preliminary experiments, Ad-LacZ infections of colonic myofibroblasts with a multiplicity of infection (MOI) of 10 showed a maximal expression (85% positive) of β-galactosidase (data not shown). The recombinant adenovirus was transferred into the cells, and the cells were made quiescent for 48 h before being assessed for the effects of the transferred gene.

Statistical analysis

The statistical significance of the differences was determined by the Mann–Whitney U-test (Statview version 4·5). Differences resulting in P-values less than 0·05 were considered to be statistically significant.

Results

C3 and IL-17 mRNA expression in IBD mucosa

Expression of C3 and IL-17 mRNA in the IBD mucosa was analysed by real-time PCR. As shown in Fig. 1, real-time PCR analyses revealed a significant increase in C3 mRNA expression in samples from the active lesions of UC and CD patients, compared with samples from the normal mucosa. Significant elevation was not detected in samples from the inactive mucosa. Furthermore, C3 mRNA expression was also elevated significantly in samples of infectious colitis.

Figure 1.

Complement C3 mRNA expression in the inflammatory bowel disease (IBD) mucosa. Total RNA was extracted from biopsy samples, and the C3 mRNA expression was evaluated by real-time polymerase chain reaction (PCR) analyses. Data from the real-time PCR were normalized versusβ-actin for human C3. All values are expressed as means ± standard deviation. *P < 0·05, **P < 0·01.

Similarly, IL-17 mRNA expression was increased significantly in the active lesions from UC and CD patients (Fig. 2). In contrast to C3 mRNA expression, there was no significant elevation of IL-17 mRNA expression in samples of infectious colitis.

Figure 2.

Interleukin (IL)-17 mRNA expression in the inflammatory bowel disease (IBD) mucosa. Total RNA was extracted from biopsy samples, and the IL-17 mRNA expression was evaluated by real-time polymerase chain reaction (PCR) analyses. The data from the real-time PCR were normalized versusβ-actin for human IL-17. All values are expressed as means ± standard deviation. *P < 0·05.

In all enrolled patients, a significant correlation was found between C3 and IL-17 mRNA expression (Spearman's correlation, R = 0·71, P < 0·001, n = 70) (Fig. 3).

Figure 3.

Correlation between C3 and interleukin (IL)-17 mRNA expression in the mucosa. Data from the real-time polymerase chain reaction analyses were normalized versusβ-actin for human IL-17 and C3. A significant positive correlation was observed between the C3 and IL-17 mRNA levels (Spearman's correlation R = 0·71, P < 0·001, n = 70).

IL-17 stimulates C3 secretion from human colonic SEMFs

Based on the in vivo expression of C3 mRNA in inflamed IBD mucosa, we examined C3 expression in the colon cancer cell line (HT-29 cells) and isolated human colonic SEMFs. Previous study showed that HT-29 cells secrete C3 in response to inflammatory cytokines [41], but stimulation with IL-17 (100 ng/ml) for 24 h failed to stimulate C3 mRNA expression in these cells. Conversely, in colonic SEMFs, IL-17 induced a dose- and time-dependent increase in C3 mRNA expression (Fig. 4a and b). These responses were also confirmed at the protein level. As shown in Fig. 4c and d, IL-17 induced a dose- and time-dependent increase in C3 secretion from colonic SEMFs.

Figure 4.

Interleukin (IL)-17 expression in colonic subepithelial myofibroblasts (SEMFs). (a) Dose-dependent effects of IL-17 on C3 mRNA expression. Colonic SEMFs were incubated for 12 h with increasing concentrations of IL-17. The levels of C3 mRNA expression were determined by real-time polymerase chain reaction (PCR). The data were normalized versusβ-actin for C3.All values are expressed as means ± standard deviation (s.d.) (n = 5). *P < 0·05, **P < 0·01; a significant difference from the values for medium alone. (b) Kinetics of C3 mRNA expression. Colonic SEMFs were stimulated with IL-17 (100 ng/ml) for the predetermined times, and then the C3 mRNA levels were determined by real-time PCR. The data were normalized versusβ-actin for C3. All values are expressed as means ± s.d. (n = 5). *P < 0·05, **P < 0·01; a significant difference from the values of culture start. (c) Dose-dependent effects of IL-17 on C3 secretion. Colonic SEMFs were incubated for 24 h with increasing concentrations of IL-17. The levels of C3 protein levels in supernatants were determined by enzyme-linked immunosorbent assay (ELISA). All values are expressed as means ± s.d. (n = 5). *P < 0·05, **P < 0·01; a significant difference from the values for medium alone. (d) Kinetics of C3 secretion. Colonic SEMFs were stimulated with IL-17 (100 ng/ml) for the predetermined times, and then the C3 levels in the supernatant were determined by ELISA. All values are expressed as means ± s.d. (n = 5).

C3 molecule secreted by colonic SEMFs

C3 molecules secreted into the supernatant by colonic SEMFs were analysed by sodium dodecyl sulphate-polyacrylamide gel electophoresis (SDS-PAGE) under reducing conditions and Western blotting. As shown in Fig. 5, the secreted C3 was a 115-kDa α-chain linked to a 70-kDa β-chain by disulphide bonds, which was the same as the C3 molecule in the serum.

Figure 5.

C3 molecules secreted by colonic subepithelial myofibroblasts (SEMFs). C3 molecules in the supernatant from SEMFs were analysed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis under reducing conditions and Western blotting. Serum C3 was used as the control.

Role of mitogen-activated protein kinase (MAPK) activation in C3 induction

Previously, we demonstrated that IL-17 induces MAPK activation in colonic SEMFs [15]. To investigate the role of MAPK in IL-17-induced C3 mRNA expression in SEMFs, we evaluated the effects of p42/44 inhibitors (PD98059 and U0216) [42,43] and a p38 MAPK inhibitor (SB203580) [44]. As shown in Fig. 6a, the p42/44 and p38 MAPK inhibitors reduced the IL-17-induced C3 mRNA expression significantly.

Figure 6.

(a) Effects of mitogen-activated protein kinase (MAPK) inhibitors on C3 mRNA expression in colonic SEMFs. The cells were pretreated with 5 µM MAPK inhibitors (SB203580, PD098059 or U02016) for 15 min, and then stimulated with interleukin (IL)-17 (100 ng/ml) for 12 h. The C3 mRNA expression was then determined by real-time polymerase chain reaction (PCR). All values are expressed as means ± standard deviation (s.d.) (n = 5). *P < 0·05, **P < 0·01; a significant difference from the values for IL-17 stimulation. (b) Effects of a recombinant adenovirus expressing a stable mutant form of IκBα (Ad-IκBΔN), a dominant negative mutant of c-Jun (Ad-DN-c-Jun) and β-galactosidase cDNA (Ad-LacZ). Forty-eight hours after infection with the adenovirus, colonic SEMFs were stimulated with IL-17 (100 ng/ml) for 12 h. The C3 mRNA expression was then determined by real-time PCR. The data were normalized versusβ-actin for human C3. All values are expressed as means ± s.d. (n = 5). *P < 0·05, **P < 0·01; a significant difference from the values for IL-17 stimulation.

NF-κB activation is required for C3 mRNA induction

The promotor sequences analysed by the Genome Browser created by the Genome Bioinformatics Group of University of California Santa Cruz (UCSC) (University of California, Santa Cruz, CA, USA) showed consensus binding sites for NF-κB [at base pairs (bp) −88 to −97, −742 to −751 and −740 to −753] and activator protein-1 (AP-1) (at bp −978 to −988) in the promoter regions of the human C3 gene. To assess the role of the transcription factors NF-κB and AP-1, we evaluated the effects of a recombinant adenovirus containing a stable mutant form of IkBα (Ad-IκBΔN) and a dominant negative mutant of c-Jun (Ad-DN-c-Jun) on IL-17-induced C3 mRNA expression. As shown in Fig. 6b, the cells were infected with the recombinant adenovirus, and were then cultured for 48 h. The cells were stimulated for 12 h with IL-17 (100 ng/ml), and the expression of C3 mRNA was determined by real-time PCR. Ad-IκBΔN inhibited the effects of IL-17 on C3 mRNA expression, but Ad-DN-c-Jun had no effect. Inhibitory effects were not induced by the Ad-LacZ gene, which was used as a negative control. These findings suggest that NF-κB plays a role in IL-17-induced C3 mRNA expression.

Discussion

In the present study, we demonstrated a correlated elevation of C3 and IL-17 mRNA expression in the inflamed mucosa of IBD patients. Early studies focused upon local complement deposition on the mucosal surfaces as a factor contributing to the pathophysiology of IBD [27,28]. However, a clinical study of complement biosynthesis has not yet been investigated in IBD mucosa. To our knowledge, this is the first description of a significant elevation of C3 mRNA expression in the inflamed mucosa of IBD patients. In addition, this is the first clinical report demonstrating a strong correlation between increased C3 and IL-17 mRNA expression in the IBD mucosa.

The behaviour of C3 mRNA expression in the IBD mucosa was different from other factors described previously [4,45,46]. Elevation of C3 mRNA expression was observed not only in active IBD mucosa but also in infectious colitis, although many factors have been reported to be elevated specifically in IBD mucosa [4,45–47]. This suggests that C3 biosynthesis may be dependent upon molecular mechanisms specific and non-specific for IBD, as complements are major factors in innate immune responses against a huge number of antigens.

An increasing number of studies have focused upon the role of Th17 cells in the pathogenesis of IBD [8,10,12–14,47], due to its unique differentiation processes under the stimulus of transforming growth factor (TGF)-β and IL-6 [3–11]. Th17 cells develop from naive T lymphocytes through distinct pathways from classical Th1 and Th2 cells. Th17 cells secrete IL-17, which promotes the recruitment of inflammatory cells into the intestinal mucosa via its ability to enhance the synthesis of chemoattractants and adhesion molecules on epithelial, endothelial and mesenchymal cells. In this study, we confirmed a significant elevation of IL-17 mRNA expression in the inflamed mucosa of IBD patients. These agree with previous observations [4,6,7], and suggest the involvement of IL-17 in the pathophysiology of IBD.

The local secretion of complements in the intestine was reported initially by Ahrenstedt et al. in 1990 [27]. They showed an increased secretion of complement components into the jejunal fluid of patients with CD. Previous studies using colon cancer cell lines suggested that intestinal epithelial cells may be a local source of complement components [25,41], but there are no reports using non-transformed, primary-cultured cells. In this study, we demonstrated C3 secretion from colonic SEMFs isolated from the human colon. Colonic SEMFs are located immediately subjacent to the basement membrane in the normal intestinal mucosa, juxtaposed against the bottom of the epithelial cells [16,48,49]. These cells are considered to play a role in the regulation of a number of epithelial cell functions, such as epithelial proliferation and differentiation. Isolated SEMFs retain their representative and differentiated phenotypes [16]. Our observation of C3 secretion by human colonic SEMFs in response to IL-17 indicates that these cells are one of the local biosynthetic sites for C3 in the intestinal mucosa. This supports the clinical finding of a correlation between increased C3 and IL-17 mRNA expression in the inflamed mucosa of IBD. Concerning complement secretion by intestinal epithelial cells, IL-17 failed to stimulate C3 secretion by intestinal epithelial cell lines, HT-29 and Caco-2 cells (data not shown).

T cell activation has been reported to play an important role in the pathogenesis of IBD [2]. The infiltration of T cells is a characteristic feature of chronic inflammation in IBD, and neutrophil infiltration becomes more prominent in accordance with T cell infiltration. C3 secretion by colonic SEMFs in response to IL-17 emphasizes the importance of T cell products in the induction of host defence in the intestine. Furthermore, recent studies have indicated that complement is not only part of the innate immune system, but has also been implicated in adaptive immunity [20,21]. Complement and its regulatory proteins (CD46, CD55 and CD59) can influence the proliferative capacity of T cells and their ability to produce cytokines, thus affecting the outcome of a T cell response to a given antigen [20,21]. Combined with our observations in this study, these findings suggest an amplification loop of immune responses mediated by T cell-derived IL-17 and SEMF-derived C3 in the intestinal mucosa. Further investigations are required to ascertain the role of this possible linkage between innate (complement) and adaptive (IL-17) immune responses in the pathophysiology of IBD.

MAPK activation has been regarded as an important signalling event in response to proinflammatory stimuli. We have shown previously that IL-17 activates p42/44 MAPKs and p38 MAPKs in human SEMFs. However, the role of MAPKs in C3 induction in response to IL-17 remains unclear. Therefore, the role of the MAPKs in IL-17-induced C3 secretion was investigated using specific inhibitors. The imidazole compound SB-203580, a specific inhibitor of p38 MAPK, caused a significant decrease in IL-17-induced C3 secretion, thus indicating that p38 activation was involved. Both PD-98059 and U-0126, p42/44 MAPK inhibitors, caused a significant inhibition of IL-17-induced C3 secretion. Hence, we concluded that p42/44 MAPKs also participate in the C3 secretion induced by IL-17 in human SEMFs.

The promoter regions of the human C3 gene have been cloned and have been shown to contain putative consensus binding motifs for NF-κB and AP-1 [50–52]. However, the contribution of these transcription factors to IL-17-mediated C3 induction remains unclear. Previously, we have shown that IL-17 induces NF-κB and AP-1 activation in human SEMFs [15,53]. In this study, the roles of these transcription factors were investigated by the inhibition of NF-κB activity by Ad-IκBΔN and the inhibition of AP-1 by Ad-DN-c-Jun. Only Ad-IκBΔN caused a marked decrease in IL-17-induced C3 mRNA expression, indicating that NF-κB-mediated transcriptional regulation is critical for IL-17-stimulated C3 mRNA expression.

In conclusion, this study has demonstrated for the first time that C3 and IL-17 mRNA expression are enhanced with a strong correlation in the inflamed mucosa of IBD patients. Part of this clinical observation was considered to be mediated by IL-17-induced C3 secretion from colonic SEMFs. Furthermore, the roles of MAPKs and NF-κB in IL-17-mediated C3 induction were also demonstrated for the first time.

IL-17-induced C3 secretion in the IBD mucosa may not only be a part of the local enhancement of the innate immune response, but also part of an ingenious amplification cascade linking innate (complement system and SEMFs) and adaptive immune responses (IL-17 and Th17 cells). Further studies on the interactions between the complement system and the T cell responses in the intestinal mucosa will be required to advance studies on the pathogenesis of IBD.

Disclosure

The authors declare no conflicts of interest.

Ancillary