SEARCH

SEARCH BY CITATION

Keywords:

  • complement;
  • human CD4+ T cells;
  • immune complexes;
  • Syk signalling

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflict of interest
  9. References
  10. Supporting Information

In systemic lupus erythematosus (SLE), the autoantibodies that form immune complexes (ICs) trigger activation of the complement system. This results in the formation of membrane attack complex (MAC) on cell membrane and the soluble terminal complement complex (TCC). Hyperactive T cell responses are hallmark of SLE pathogenesis. How complement activation influences the T cell responses in SLE is not fully understood. We observed that aggregated human γ-globulin (AHG) bound to a subset of CD4+ T cells in peripheral blood mononuclear cells and this population increased in the SLE patients. Human naive CD4+ T cells, when treated with purified ICs and TCC, triggered recruitment of the FcRγ chain with the membrane receptor and co-localized with phosphorylated Syk. These events were also associated with aggregation of membrane rafts. Thus, results presented suggest a role for ICs and complement in the activation of Syk in CD4+ T cells. Thus, we propose that the shift in signalling from ζ-chain-ZAP70 to FcRγ chain-Syk observed in T cells of SLE patients is triggered by ICs and complement. These results demonstrate a link among ICs, complement activation and phosphorylation of Syk in CD4+ T cells.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflict of interest
  9. References
  10. Supporting Information

Spleen tyrosine kinase (Syk) is a non-receptor tyrosine kinase expressed by haematopoietic cells that play a crucial role in adaptive immunity [1]. Syk activation is important for cellular adhesion, vascular development, osteoclast maturation and innate immune recognition. Syk activation targets pathways such as the CARD9-BCl-10-MALT1 and the NLRP3 inflammasome [2]. In autoimmunity, altered T lymphocyte responses are observed [3,4]. Enhanced T cell antigen receptor (TCR) signalling and immune complexes (ICs) contribute to the disease pathogenesis in systemic lupus erythematosus (SLE) [5]. ICs bind to its ligand, the low-affinity FcγRIIIA membrane receptor, which induces phosphorylation of the FcRγ chain, the signalling subunit for FcγRIIIA. The FcRγ chain mediates signalling via immunoreceptor tyrosine-based activation motif (ITAM), which upon phosphorylation recruits Syk in B cells and platelets. Syk-mediated signalling is an important event for B cell activation [6]. Interestingly, FcRγ chain in T cells associates with the ζ-chain, forming heterodimers in the TCR complex, and the FcRγ chain is able to support independently the development of the peripheral T cells in mice lacking endogenous TCR ζ-chain [7].

The FcRγ chain containing TCR complexes are present in activated γδ+ T cells, natural killer (NK)-like T (NK T) cells, SLE T cells and in certain populations of human T effector cells [8–11]. An association of FcRγ chain with the TCR complex is also observed in TCRαβ+CD4CD8 double-negative regulatory T cells (Tregs) [12]. In these cells, TCR ligation results in the phosphorylation of both FcRγ chain and Syk, and this event is shown to be necessary for their suppressive activity [12]. TCR in CD4+ T effector cells show association of FcRγ chain with Syk [11]. Such events are also observed in antigen-induced arthritis (AIA), a chronic arthritis regulated by ICs and T cells [13]. In AIA, inflammation and cartilage erosion is dependent on FcRγ chain-mediated signalling [14]. Also, for the full development of experimental autoimmune encephalomyelitis (EAE), expression of FcRγ chain by γδ T cells in association with the TCR/CD3 complex is required [15]. Both these diseases show elevated levels of ICs. However, the ligand that triggers the Syk phosphorylation is unknown.

In this report, we show that a subset of peripheral human CD4+ T cells bind to labelled aggregated human γ-globulin (AHG). SLE patients show a two–fourfold increase in this population when compared to the normal subjects. Thus, we explored whether ICs acts as a ligand for the activation of Syk signalling pathway in CD4+ T cells via engagement of low-affinity membrane Fc receptors (FcRs).

The terminal complement complex (TCC), also referred to as soluble C5b-9, is a non-cytolytic by-product of the terminal complement activation pathway that triggers proinflammatory responses, cytokine release and vascular leakage [16]. We observed that, in human CD4+ T cells, in the presence of ICs, TCC synergistically enhances the phosphorylation of Syk. In addition, cells treated with TCC or non-lytic C5b-9 demonstrated aggregation of the membrane rafts (MRs) (Fig. 5). MRs are membrane structures that are crucial for lymphocyte signalling, i.e. TCR signalling involving Lyn, Syk and Btk kinases [17,18]. In activated T cells, signalling molecules such as Syk associate with the MRs. The lateral diffusion of MRs by decreasing receptor proximity allows protein interactions, initiating cell signalling [19]. A similar role of CD28 co-stimulatory molecule has been suggested for MRs during T cell activation [20].

image

Figure 5. Co-localization of FcγRIIIA/B (blue), FcγRIIIB (red) with membrane raft (MR) stained using cholera toxin-B (CTB)–fluorescein isothiocyanate (FITC) (green) in CD4+ T cells. Membrane raft (MR) and FcγRIIIA/B (a), MR and FcγRIIIB (b), combined (c) and on differential interference contrast (DIC) image (d). Aggregation of MR and receptor marked with arrows.

Download figure to PowerPoint

In this study, we show that in human CD4+ T cells, ICs and late complement pathway plays a role in the activation of Syk via recruitment of FcRγ chain with the membrane FcγRIIIA.

Materials and methods

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflict of interest
  9. References
  10. Supporting Information

Human subjects

Blood from normal and SLE patients was collected with informed consent in the Saint Louis University Rheumatology clinics. The normal group consisted of female volunteers in the 24–35-year age group. The SLE patients were in the 18–45-year age group, with disease duration ranging from 3 to 10 years. The patients fulfilled the 1982 revised criteria for diagnosis of SLE [21]. The blood was collected in heparinized tubes and cells were isolated within 4 h of sample collection.

Antibodies and reagents

Affinity-purified antibodies against FcγRIIIB/CD16, FcγRI/CD64 and a monoclonal recognizing FcγRIIIA/B were purchased from R&D Systems (Minneapolis, MN, USA). Anti-FcRγ antibody was from Upstate Cell Signaling Solutions (Beverley, MA, USA) and anti-pSyk was from Cell Signaling Technology. Cholera toxin-B (CTB)–fluorescein isothiocyanate (FITC) was purchased from Sigma Chemicals (St Louis, MO, USA). Other common reagents and cell culture reagents were obtained from Invitrogen (Carlsbad, CA, USA) and Sigma Chemicals. The reagents to purify the human naive CD4+ T cells were procured from Miltenyi Biotec (Bergisch Gladbach, Germany). Anti-CD3 and anti-CD 28 antibodies were purchased from eBiosciences (San Diego, CA, USA).

Cell lines and preparation of human naive CD4+ T cells

Human CD4+ cells were purified from peripheral blood mononuclear cells (PBMC) isolated from normal or SLE patients using Histopaque gradient. The monocytes were removed by plating the cells for 6 h in Nunc culture dishes; thereafter, CD4+ cells were purified by positive selection using magnetic beads and human naive CD4+ T cells by negative selection, using magnetic bead cell isolation kits (Miltenyi Biotec). The purified CD4+ T cells were maintained in interleukin (IL)-2 (20 ng/ml) supplemented complete RPMI-1640 medium. The purity of these cells was analysed by staining for CD4+, CD3+ and CD45RA+. The purified cells were 94–96% positive for these three markers. The cell viability was more than 97%, as indicated by staining with vital dye trypan blue. These purified cells were expanded using plates coated with 0·5 µg/ml of anti-CD3 and 0·5 µg/ml of soluble anti-CD28. Thereafter, cells were maintained in culture for 10 days after stimulation in the presence of IL-2 (20 IU/ml); such cells are referred as ‘expanded cells’.

Preparation of AlexaFluor® 488-labelled AHG

AHG was prepared as described previously [22]. One mg of the AHG protein was labelled with AlexaFluor® 488 using the protein labelling kit, as per the manufacturer's protocol (Invitrogen). In experiments where the purified ICs were used, the source was plasma from SLE patients [23,24].

Binding of AlexaFluor® 488-labelled AHG to CD4+ T cells in PBMC

PBMC, 1 × 106, were stained using a total of 5 µg of AHG- AlexaFluor® 488; 5 µl of anti-CD4-Pacific Blue™ or allophycocyanin (APC) and 5 µl of either phycoerythrin (PE) or PE-cyanin 7 (Cy7™) anti-human CD25 for 20 min at room temperature (RT). The fluorescence was acquired using a fluorescence activate cell sorter (FACS)Caliber (BD Bioscience). The data were analysed using FlowJo software from Treestar (Ashland, OR, USA). First the gates were drawn using forward- and side-scatter. The lymphocyte population was then gated for the CD4+ lymphocytes. Thereafter, the CD4+ gated population was analysed further for CD25+ and AlexaFluor® 488–AHG binding population.

Purification of pre-assembled TCC

TCC was isolated from pooled normal sera, as described previously [25]. An additional step to purify TCC further was performed by subjecting the TCC to chromatographic separation on Superose™ 6 YK (GE Healthcare, Los Angeles, CA, USA). The TCC-containing fractions were examined for C9 polymerization by monitoring the generation of the neo-epitope (using clone aE11) using an enzyme-linked immunosorbent assay (ELISA) system. The TCC-containing fractions were pooled, concentrated and then stored at −70°C. The non-lytic dose of TCC was determined by incubating 1 × 106 Jurkat cells with varying concentrations from 0·25 to 5 µg of protein for 4 h and monitoring of apoptosis and necrosis using Vybrant® Apoptosis Assay #3 from Invitrogen, as per the manufacturer's suggested protocol. From these experiments a dose of 2·5 µg was considered optimal, as more than 95% cells remained viable with trypan blue dye and propidium iodide staining.

Cell stimulation with ICs and TCC

The expanded human naive CD4+ T cells purified from normal donors were used; 1 × 106 cells were activated by placing in serum-free medium for 4 h and treated with ICs (2·0 µg) or ICs (2·0 µg) in the presence of non-lytic TCC (2·5 µg). The cells were collected post-2 h and used directly for experiments. The 2 h time interval was selected based on our previous observation of the T cell activation in response to treatment with ICs and TCC [26].

Immunoprecipitation and Western blotting for phosphorylated Syk

Lysates from cells treated with various stimuli were prepared from 1 × 106 cells using 0·5 ml of radioimmunoprecipitation assay (RIPA) buffer (50 mm Tris-HCL; 1% NP40; 0·25% Na-deoxycholate; 1 mm tetraacetic acid (EDTA); 1 mm phenylmethylsulphonyl fluoride (PMSF); 1 mm Na3VO4; 1 mm sodium fluoride (NaF); and 1 µg/ml each aprotinin, leupeptin, pepstatin). Thereafter, 2 µg of monoclonal anti-FcγRIIIA/B antibody was added to the lysates and this mixture was then incubated at RT for 1 h. A 50-µl suspension of Protein G sepharose beads in saline (PBS) was then added and the mixture was incubated further at 4°C overnight. Subsequently, the Protein G beads were washed with excessive RIPA buffer and suspended into 1X reducing loading buffer from Invitrogen. These samples were heated and beads were separated by centrifugation. Protein content of samples was measured with micro bicinchoninic acid method (Sigma). A total of 5 µg protein from each sample was electrophoresed on either 10% or 4–12% precast gradient gel (Invitrogen). The gels were either stained with silver staining or proteins were transferred to polyvinylidene fluoride (PVDF) membrane. The blots prepared from the immunoprecipitates were then probed using anti-pSyk antibodies and blots were developed using Millipore chemiluminscent substrate. After Western analysis, blots were stained with Coommasie blue R250 to ensure uniform protein loading.

Co-localization of FcγRIIIA/B with pSyk in CD4+ T cells

A total of 0·5 × 106 cells were treated with various stimuli and washed with cold PBS; cells were then fixed in 3% formaldehyde for 15 min at RT. Fixed cells were then permeabilized using 95% methanol for 30 min on ice and 10 min at −20°C. After washing, blocking was performed with 1% serum albumin (BSA) and 2·5% species-specific serum diluted in PBS at RT for 1 h. These cells were incubated further with the appropriate primary antibody at a dilution of 1 : 100 for 1 h at RT. For co-staining, a monoclonal antibody recognizing the FcγRIIIA/B and a rabbit polyclonal recognizing the pSyk was used for staining. Subsequently cells were incubated with AlexaFluor® 488- and 594-conjugated secondary anti-mouse and anti-rabbit at a dilution of 1 : 200 at RT for 1 h. Co-localization for FcγRIIIA/B with pSyk was carried out using Olympus FV-1000 software. Cells were examined from three fields in three experiments in all co-localization studies. Cells were examined at ×400 and ×630 magnification in fluorescent (Leica, DM400B) or confocal microscope (Olympus, FV-1000). In certain cases optical zoom was employed to gain access to cellular details.

Co-localization of FcγRIIIA/B with FcRγ chain in CD4+ T cells

The staining for co-localization of FcγRIIIA/B and intracellular FcRγ chain was essentially carried out as described in the earlier section. All serial Z-series sections were included for the analysis (Olympus FV-1000, co-localization software).

Co-localization of AHG with FcγRIIIB and FcγRIIIA/B staining on CD4+ T cells

To co-localize the FcγRIIIA/B, FcγRIIIB with ICs or AHG, a 5 µg/ml of AlexaFlour 488–AHG was used prior to staining of cells with anti-FcγRIIIA/B monoclonal and/or anti-FcγRIIIB antibody. Percentage staining was calculated from three independent fields by enumerating total cells, cells stained with anti-FcγRIIIA/B and anti-FcγRIIIB.

Staining of MRs and FcγRIIIA/B on CD4+ T cells

Activated cells were washed with cold PBS and resuspended in 0·1% BSA–PBS. To 1 × 106 cells, a total of 0·2 µg of CTB conjugated with FITC was added and cells were incubated for 20 min in an ice bath. Thereafter, the cells were fixed and stained for FcγRIIIA/B and mounted using SlowFade Gold anti-fade reagent containing 4',6-diamidino-2-phenylindole (DAPI) (Molecular Probes, Eugene, OR, USA) or without DAPI when using AlexaFluor® 350 conjugate.

Reverse transcription–polymerase chai8n reaction (RT–PCR) for FcγRIIIA/B transcripts

RT–PCR was performed on the total cellular RNA using the RNA isolation kit (Agilent Technologies, Santa Clara, CA, USA). Using a total of 200 ng of the RNA, the PCR product was generated using the Access RT–PCR system (Promega, Madison, WI, USA). The first strand was synthesized at 45°C for 45 min and further amplification was carried out as per the manufacturer's recommendation. The FcγRIII and control tubulin primers were used as reported previously [27]. A second set of primers were designed using the gene ID NM_000570·3 (FCGR3B) and NM_001127596·1 (FCGRA). The forward primer AGCTGGAAGAACACTGCTCTGCA and reverse primer AAGAGACTTGGTACCCCAGGTGGAG amplified the 244 to 543 nucleotide of FCGR3A, giving a 242 nucleotide length product. For sequencing, amplification was performed using the primer set reported earlier [27]. Thereafter, the PCR product from this amplification was purified from the gel slice using Purelink gel extraction kit (Invitrogen). This PCR product was again amplified using M13-FcγRIIIA/B hybrid primers, forward primer TGTAAAACGACGGCCAGTCAAATGTTTGTCTTCACAG and reverse primer AGGAAACAGCTATGACCATATTCACGTGAGGTGTCACAG. The amplified product obtained using these primers was sequenced with M13 primers, forward TGTAAAACGACGGCCAGT and reverse AGGAAACAGCTATGACCAT using big dye in automated sequencing.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflict of interest
  9. References
  10. Supporting Information

CD4+ T cells in SLE patients show binding to labelled AHG

We analysed the binding of AHG to PBMC isolated from SLE patients and normal subjects. The peripheral CD4+ T cells demonstrated binding to AHG. In SLE patients (n = 11), AHG bound to 5·38 to 12% [mean ± error of the mean (s.e.m.) of 8·855 ± 0·855] of the CD4+ T cells compared to 1·26 to 3·7% (mean ± s.e.m. of 2·80 ± 0·2589) from the normal subjects (n = 9) (Fig. S1). The difference in the two means was 6·055 ± 0·9702. This was a statistically significant increase in AHG binding at a P-value of 0·00013. The flow analysis for CD25+ expression on the CD4+ subset showed that both CD25+ as well as CD25 cells bound to AHG (Fig S1). The AHG also showed binding to the CD15+ neutrophils in the PBMC (Fig. 1a). AlexaFluor® 488-labelled ICs purified from SLE patients also showed binding to the peripheral CD4+ T cells. The AHG binding to CD4+ T cells was inhibited competitively by the treatment of cells with anti-FcγRIIIA/B monoclonal antibody (Fig. S8).

image

Figure 1. (a) Flow analysis to show aggregated human γ-globulin (AHG)–AlexaFluor® 488 binding to CD4+ T cells in purified peripheral blood mononuclear cells (PBMCs). Cells were gated using forward- and side-scatter. CD4+ lymphocytes were gated with anti-CD4-Pacific Blue. Neutrophil population was recognized with CD15+ staining. AHG showed binding to both CD4+ lymphocytes and neutrophils (bottom panels). Events marked with arrows in all figures. (b) CD4+ T cells stained with AHG–AlexaFluor® 488 (green), FcγRIIIA/B (AlexaFluor® 350, blue) and FcγRIIIB (AlexaFluor® 594, red). Receptor and AHG co-localizes on the cell membrane. Confocal differential interference contrast (DIC) images at ×630 magnification.

Download figure to PowerPoint

ICs and TCC treatment triggers phosphorylation and recruitment of phosphorylated Syk with FcγRIIIA/B

To investigate the role of IC-mediated Syk activation via the FcRγ chain in T cells, we analysed the co-localization of phosphorylated Syk (pSyk) and FcRγ chains with membrane FcγRIIIA/B in ICs and TCC-treated cells. The confocal image analysis revealed that the ICs triggered pSyk to move to the membrane FcγRIIIA/B site (Fig. 2a). Scatter-plot for pSyk co-localization with FcγRIIIA/B using all Z-series sections generated by co-localization software confirmed this finding (Olympus FV-1000) (Fig. 2b). Although the treatment of cells with ICs alone demonstrated a shift of pSyk along the y-axis (Fig. 2bii), this shift was enhanced further by the presence of TCC. This observed shift was due to an increase in the intensity of pSyk (Fig. 2biii). Due to higher fluorescent intensity of phosphorylated Syk, we observed FcγRIIIA/B aligned towards the y-axis. TCC alone was not sufficient to trigger this event. These results are consistent with previous observations of Syk activation in SLE T cells. A rewiring of the TCR signal in SLE T cells that involves replacing of ZAP-70/ζ-chain with pSyk/FcRγ chain signalling has been suggested [11]. Our results indicate that this signalling shift in T cells is triggered due to ligation of low-affinity FcRs by ICs in the presence of TCC.

image

Figure 2. (a) Co-localization of FcγRIIIA/B and pSyk in CD4+ T cells. Untreated cells (i,ii,iii,iv); treated with systemic lupus erythematosus (SLE)–immune complex (IC) (v,vi,vii,viii); and SLE–ICs + terminal complement complex (TCC) (ix,x,xi,xii). Stained for FcγRIIIA/B (i,v,vii); pSyk (ii,vi,x), FcγRIIIA/B + pSyk (iii,vii,xi); differential interference contrast (DIC) image (iv,viii,xii). (b) Scattergram of co-localization of FcγRIIIA/B and pSyk of cell images shown in 2a. Untreated cells (i); treated with ICs (ii); and treated with ICs + TCC (iii). pSyk shown on the y-axis and FcγRIIIA/B shown on the x-axis. ICs and TCC treatment show maximum association of pSyk with FcγRIII. (c) Immunoprecipitates obtained with anti-FcγRIIIA/B analysed for Syk phosphorylation. Untreated cells (lane 1), treated with TCC (lane 2), treated with TCC and ICs (lane 3) and ICs treated (lane 4) cells. Cells treated with ICs and TCC show Syk phosphorylation.

Download figure to PowerPoint

Phosphorylation of Syk in response to treatment with ICs and TCC

Phosphorylation of ITAM in FcRγ chain is responsible for Syk activation, which then subsequently participate in downstream activation of mitogen-activated protein kinases (MAPKs), PI3K and PLCγ activation in lymphocytes. In order to establish a role for Syk in IC-mediated T cell activation via low-affinity FcRs, we probed for phosphorylated Syk in the activation loop at Tyr525/526 in cells treated with ICs and TCC. The immunoprecipitates prepared using monoclonal anti-FcγRIIIA/B antibody from cells treated with TCC and ICs, when probed with anti-pSyk, showed phosphorylation of a protein band that migrated at 72 kD. This suggested Syk activation in T cells, in response to ICs and TCC (Fig. 2c). These findings are also supported by our previous observation of Syk phosphorylation in Jurkat cells treated with TCC and in vitro formed ovalbumin–anti-ovalbumin ICs and ICs purified from plasma of SLE patients [26]. These results are also supported by the previous observation that Syk is activated in SLE T cells [28].

FcRγ chain co-localize with membrane FcγRIIIA/B receptors in CD4+ T cells treated with ICs and TCC

Syk activation is mediated via FcRγ chain [17]. We observed that in CD4+ T cells treated with ICs or ICs and TCC, the FcRγ chain was recruited to the site of membrane receptors (Fig. 3a). The co-localization analysis of all the Z-series sections (Fig. 3biii) confirmed this finding. The presence of TCC during the IC treatment enhanced the recruitment of the FcRγ chain with membrane FcγRIIIA (Fig. 3biii). Although the observed scatter-pattern for the co-localization of FcRγ chain was different from the pSyk and FcγRIIIA/B staining, we presume that this was due to wider distribution of the staining intensity of the FcγRIIIA and FcγRIIIB receptors, both of which were recognized by the monoclonal antibody that was used for the staining (Fig. 3a). The scattergram obtained in both co-localization experiments demonstrated data where a line of best fit could be drawn confirming the association among these proteins. An antibody that recognizes both receptors was used in this study due to the unavailability of an antibody that recognizes only FcγRIIIA. TCC alone was insufficient to trigger these events. The cells stained using anti-FcγIIIA/B antibody demonstrated localized peripheral membrane staining (Fig. 1b). A similar staining pattern was also observed with an affinity-purified anti-FcγRIIIB antibody. Both FcγRIIIA and FcγRIIIB co-localized with labelled AHG on cell membrane (Fig. 1b). Co-staining of expanded naive CD4+ T cells using anti-FcγRIIIA/B and anti-FcγRIIIB demonstrated that those CD4+ T cells that expressed FcγRIIIA always expressed FcγRIIIB. However, cells that stained with anti-FcγIIIA/B did not always stain with anti-FcγRIIIB, thus suggesting that a population of cells expressed only FcγRIIIA (Fig. S2c). FcγRIIIB was expressed by a smaller percentage of CD4+ T cells (Fig. S2). The examination of three independent fields of cells expanded using anti-CD3 and anti-CD28 showed that a total of 49% of cells expressed FcγRIIIA, 27% expressed FcγRIIIB and 22% stained for MRs. Treatment of the cells with TCC, ICs purified from SLE patients (SLE–ICs) or TCC together with ICs did not alter the protein pattern of immunoprecipitates generated using anti-FcγRIIIA/B (Fig. S7).

image

Figure 3. (a) Co-localization of membrane FcγRIIIA/B with FcRγ chain in CD4+ T cells. Untreated cells (panels i,ii,iii,iv), treated with systemic lupus erythematosus (SLE)–immune complex (IC) (v,vi,vii,viii) and with SLE–ICs + terminal complement complex (TCC) (ix,x,xi,xii). (i,v,ix) Stained for FcγRIIIA/B; (ii,vi,x) stained for FcRγ chain, (iii,vii,xi) both; (iv,viii,xii) shown on differential interference contrast (DIC) background. Confocal images at ×630 magnification. (b) Scattergram of co-localization for FcγRIIIA/B and FcRγ chain of cells shown in 3a (complete Z-series). The y-axis shows the FcRγ chain and the x-axis shows the membrane FcγRIIIA/B. Untreated cells (i), treated with immune complexes (ICs) (ii) and ICs + TCC (iii). Increase in FcRγ chain co-localization with membrane FcγRIIIA/B is observed in cells treated with ICs + TCC.

Download figure to PowerPoint

Immunoprecipitates show presence of FcγRIIIA/B

Western analysis of immunoprecipitates obtained using monoclonal anti-FcγRIIIA/B from naive CD4+ T (CD45RA+) cells showed protein bands migrating at the molecular weights of 26–29 kD that correspond to a previously reported molecular mass for FcγRIIIA and B (Fig. S6) [29]. In naive CD4+ T cells, an additional band at approximately 34 kD was also observed (Fig. S6). The FcγRIIIA consists of 254 amino acids with a predicted molecular mass of 29 kD (Accession no. P08637-1) and FcRIIIB consists of 233 amino acids with a predicted molecular mass of 26 kD (Accession no. P75015-1). In addition to the light and heavy chains of immnoglobulins, faint protein bands at 72, 98 and 130 kD were also observed. These proteins were also observed in the immunoprecipitates prepared from Jurkat cells. Jurkat cells are used traditionally to study T cell activation (Fig. S6).

Presence of FcγRIIIA/B RNA transcripts in CD4+ T and Jurkat cells

To further confirm the presence of FcγRIIIA/B in the CD4+ T cells, we analysed the presence of RNA transcripts by RT–PCR. The RT–PCR analysis of the total RNA isolated from both peripheral CD4+ T cells and naive CD4+ T cells using a primer set designed from the gene ID NM_001127596·1 (FCGRA) and a second primer set published recently [27] showed the presence of appropriate-sized products for the FcγRIII gene. These FcγRIII transcripts were also amplified from the total leucocyte RNA. Negative controls without the template RNA did not show the PCR amplification product. Both CD4+ T cells (not shown) and naive CD4+ T cells showed transcripts for the FcγRIIIA/B gene. Jurkat cells also demonstrated these RNA transcripts (Fig. 4). The sequencing of PCR-amplified cDNA confirmed it to be the FcγRIIIA/B gene product.

image

Figure 4. Reverse transcription–polymerase chain reaction (RT–PCR) for FcγRIII and tubulin transcripts in Jurkat, naive CD4+ cells and leucocytes. Appropriate size amplified product was observed in all three cell types. The amplification product was not observed in the absence of RNA template.

Download figure to PowerPoint

Recruitment of FcγRIIIA/B in MR

The staining pattern of FcRγ chain in T cells showed them to be present in microclusters, a pattern that is observed for TCR signalling proteins in activated CD4+ T cells (Fig. 3a). The treatment of cells with purified ICs triggered the microclusters to move towards one side of the cell due to capping (Fig. 3a). The presence of TCC during IC treatment further enhanced staining for the FcRγ chain. We observed that the ICs and TCC treatment triggered migration of these receptors into MRs (Figs 5 and S5). We have observed previously that the assembly of non-lytic C5b-9 using purified C5b-6, C7, C8 and C9 labelled with AlexaFluor® 594 trigger MR aggregation beneath C5b-9 deposits (Fig. S4). In quiescent cells, both FcγRIIIB and the FcγRIIIA were not observed in the MRs. In human neutrophils, the engagement of receptors with ICs moves the FcγRIIIB to the high detergent-resistant membranes (representing the MRs), and this results in activation of Syk tyrosine kinase [30]. Similar events may be initiated in T cells by ICs and complement activation in autoimmune disorders.

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflict of interest
  9. References
  10. Supporting Information

Syk has been a target for therapeutic intervention for autoimmune diseases. Syk-mediated signalling contributes to the altered T cell signalling [31]. In this report, we demonstrate that the FcγRIIIA/B receptor engagement by ICs on CD4+ T cells leads to the recruitment of the signalling subunit, the FcRγ chain, thus resulting in Syk activation. The presence of soluble TCC enhances this signalling event. TCC in fluid phase by associating with vitronectin (S protein) becomes cytolytically inactive and is regarded as irrelevant. However, recent reports have shown that TCC induces functional activities such as kinin-dependent vascular leakage, activation of endothelial cells and induction of osteoprotegerin [16,32,33]. Vitronectin facilitates the cellular adhesion of soluble TCC, providing a mechanism to trigger cellular responses [34]. Previously, we have shown elevated levels of vitronectin associated with membrane attack complex (MAC) in lupus nephritis patients [23]. Our results point to a synergistic role for TCC in IC-mediated Syk activation in CD4+ T cells. Such synergistic action of ICs and MAC in chemokine secretion during lung tissue injury has also been reported previously [35].

Binding of AHG (Fig. 1) and ICs purified from SLE to the peripheral CD4+ T cells establishes the interaction and a possible role of ICs in T cell responses. Previously, activation-dependent expression of FcγRII and FcγRIII receptors in the human T lymphocyte subpopulation has been observed [36]. This study showed a four- to 10-fold increase in the FcγRIII+ CD8+ T cell population in response to phytohaemagglutinin (PHA) treatment on day 3 post-stimulation [36]. Our results also point to a similar phenomenon, where FcγRIII+CD4+ T cells expanded in vitro using anti-CD3 and CD28, a total of more than 40% cells stained for FcγRIIIA/B in comparison to 10% directly from the PBMC.

To explore whether ICs can influence the T cell physiology, we investigated the role of these complexes in Syk activation. Syk is a homologue of non-receptor tyrosine kinase ZAP-70. Syk is activated by FcRγ chain upon ITAM phosphorylation. Syk is expressed widely in both immune and non-immune cells [37,38]. Both DAP-12 and FcγR associate with Syk and mediate β-2 integrin signalling in neutrophils and macrophages [39]. Syk phosphorylation also occurs upon engagement of pathogen recognition receptors such as FcγR, CR3 and Dectin-1 [1]. Accumulating evidence points to Syk expression in subsets of T lymphocytes such as thymocytes, naive αβ T cells and intraepithelial γδ T cells, but not in proliferating and mature T cells [31,40]. The T cells from SLE patients demonstrate up-regulation of the FcRγ chain and associate with the TCR/CD3 complex with diminished expression of the ζ-chain [10]. In addition, association of Syk with FcRγ chain is also observed in the T cells of SLE patients and not in the normal population [10,41]. Syk-deficient eosinophils do not respond to FcγR activation, suggesting the requirement for FcR-mediated signalling for the Syk activation [42]. Syk is also essential for FcγR-mediated signalling in macrophages, neutrophils and monocytes [43,44]. Thus, T cell activation via Syk upon engagement of FcγRIIIA by ICs may be an important event for the development of autoimmune pathology. The results presented show that the formation of ICs and complement activation may influence the T cell-mediated adaptive immune responses by the FcRγ–Syk-mediated signalling pathway. Syk also has the ability to act at several other levels in the TCR signalling cascade [31].

The presence of low-affinity FcRs that bind to ICs on CD4+ T cells is still considered an open question [45]. We observed a subset of CD4+ T cells that demonstrated the presence of both FcγRIIIA and FcγRIIIB receptors. In these cells, IC treatment triggered the recruitment of FcRγ chain with membrane FcγRIIIA receptors and this resulted in phosphorylation of Syk, thus suggesting a role for FcRs in T cell signalling. The staining pattern of these receptors in human CD4+ T cells was similar to that of previously observed binding of aggregated mouse globulin to mouse T lymphocytes [46].

Both the elevated levels of ICs and aberrant T cell activation are part of the autoimmune process. ICs are the only known ligands for low-affinity FcRs that contribute to lymphocyte signalling. Thus, defining a correlation among these two events is of significant importance for understanding the autoimmune pathology. Activation of Syk by ICs in T cells suggests a role for ICs in altered T cell phenotypes observed in autoimmunity. A contribution from the FcRs in T cell activation has been suggested previously by a single report [47]. The CD3 Jurkat cells that have been transfected with the transmembrane region of the FcγRIII receptor show association with Lck (p56) and ZAP-70, the TCR signalling proteins. This suggests a link between FcRs and T cell signalling pathway proteins [48,49]. The phosphorylation of ζ-chain in the CD3 complex is the primary TCR signalling event, which triggers TCR activation upon peptide–major histocompatibility complex (MHC) engagement. Activation of TCR in the absence of CD3 suggests the presence of an alternate signalling pathway for T cell activation that may utilize low-affinity FcRs. We observed phosphorylation of both Lck and ZAP-70 in Jurkat cells treated with ICs and MAC in the absence of peptide–MHC engagement [26].

The CD8+FcγRIII+ T cells show proliferation in response to receptor cross-linking with ICs [36]. We also observed proliferation of naive CD4+ T cells in response to ICs in the presence of TCC [26]. Although FcγRIIIB does not signal via the FcRγ chain, cross-linking of FcγRIIIB by ICs is shown to trigger phosphorylation of extracellular-regulated kinase (ERK) and p38 [50]. We and others have also observed ERK phosphorylation in response to treatment with non-lytic MAC and ICs in multiple cell types [51]. Comparative studies have shown that similar to the ζ-chain, the MB1 protein of the immunoglobulin (Ig)M receptor also binds to Lck and ZAP-70 in T cells and induces a strong activation response [49]. These studies also point to an alternative signalling unit for IgG and IgM, which contribute to Syk or ZAP-70 signalling without engagement of TCR.

Examination of the FcγRIIIA/B in CD4+ T cells treated with ICs and TCC also revealed recruitment of these receptors with MRs. This suggests that the complement activation can influence the outcome of T cells by MR aggregation that contributes to lymphocyte signalling. T cells isolated from SLE patients also demonstrate aggregation of the MRs [52]. Both plasma and urinary levels of MAC are increased and demonstrate correlation with the disease activity in SLE patients [53]. Previously, we have shown elevated levels of MAC that associate with the ICs in SLE patients [23]. MRs regulate the spatial organization of the structures that are involved in both T and B cell signalling [18,54]. In a mouse model of SLE, induction of MR aggregation using CTB–anti-CTB cross-linking enhanced the progression of disease, while the disruption of MR aggregation with methyl-β-cyclodextrin delayed disease progression [5]. In lieu of these findings, the complement-mediated aggregation of MRs and recruitment of FcRs with MRs in T cells may be the crucial participants in altering the T cell responses during autoimmunity. The aggregation of MRs by MAC could result from the phase separation of MRs and glycerophospholipids in the membrane. This then allows a high degree of lateral mobility of MRs, resulting in their aggregation.

The FcγRIIIB cross-linking by ICs have been shown to trigger their recruitment within MRs, which then results in the association of FcγRIIIB with complement receptor 3 (CR3, CD11b/CD18) or FcγRIIA (CD32a) for signalling [30]. Syk is also shown to move within the MRs of SLE T cells; however, it is excluded from the MRs in normal T cells [55]. We also obtained similar results in CD4+ T cells, where the ligation of FcγRIIIB by ICs moved them to the MRs. A contribution from the FcγRIIIB in Syk phosphorylation cannot be elicited from our results. In B cells, cross-linking of FcR by ligand results in aggregation of MRs, lateral clustering and recruitment of Syk to the MRs [56].

MR-mediated regulatory control of receptor activity has been proposed for preventing inappropriate cell activation by low levels of IgG complexes [57]. In the resting myeloid cells, CD32 (FcγRII) is excluded from MRs, which then result in the decreased stability of CD32–IgG complexes. Also, in CD32a transfected Jurkat cells, MRs associates constitutively with CD32a and exhibits increased binding activity for IgG. A polymorphic form of FcγRIIB that is linked to human SLE also demonstrates loss of function due to its inability to associate with the MR [58].

We propose that the aggregation of MRs by TCC or non-lytic C5b-9 triggers FcR capping and may provide a regulatory mechanism for T cell activation in disease pathology. The mouse and human T cell lines that express FcγR upon activation release soluble FcRs which, in vitro, suppress the production of immunoglobulin [59]. The enrichment of FcRs during MR aggregation could result in enhanced receptor shedding [34]. This may then modulate the FcγR-mediated suppression of IgG, thus providing an additional control for immune regulation by complement activation. Thus, the MR mobilization and phosphorylation of Syk by ICs in T cells may be a critical first step for understanding IC-mediated immune regulation of T cell responses in autoimmunity. To our knowledge, this is the first study demonstrating the link among the ICs and complement activation with Syk tyrosine kinase-mediated signalling events in human CD4+ T cells. We speculate that these events occur commonly in other autoimmune pathologies.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflict of interest
  9. References
  10. Supporting Information

Funding was provided by the Campbell-Avery Charitable Trust, the Dorr Family Charitable Trust and Lupus/juvenile Arthritis Research Group of Saint Louis.

Conflict of interest

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflict of interest
  9. References
  10. Supporting Information

T.L.M. has no financial interest. A.K.C. has a financial interest in ProGen Biologics LLC.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflict of interest
  9. References
  10. Supporting Information

Supporting Information

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflict of interest
  9. References
  10. Supporting Information

Fig. S1. Aggregated human γ-globulin (AHG) binding to CD4+ T cells from peripheral blood mononuclear cells (PBMC) of systemic lupus erythematosus (SLE) patients. Gates were first drawn to select CD4+lymphocytes (a). Subsequently, CD4+ T cells were analysed for AHG binding in the CD25 and CD25+ populations (b).

Fig. S2. Human CD4+ T cells stained with anti-FcγRIIIA/B antibody (a), anti-FcγRIIIB antibody (b) and overlay (c). Arrows mark the receptor protein in the cells. Images captured at ×630 magnification.

Fig. S3. Membrane rafts (MR) (green) stained using cholera toxin-B (CTB)−fluorescein isothiocyanate (FITC) and anti-FcγRIIIB (red). Aggregation of MR is observed with association of FcγRIIIB. Nuclei stained with 4',6-diamidino-2-phenylindole (DAPI). Arrows point to aggregated MR and receptor.

Fig. S4. Human naive CD4+ T cells show aggregation of membrane rafts (MRs) (green) underneath the C5b-9 (red). C5b-9 assembled with purified complement proteins C5b-6, C7, C8 and AlexaFluor® 594 (red)-labelled C9. C8 omission during assembly prevented the assembly of membrane attack complex (MAC) and MR aggregation (not shown).

Fig. S5. CD4+ T cells treated with immune complexes (ICs) and terminal complement complex (TCC) show aggregation of membrane rafts (MRs) (green) and associate with FcγRIIIA/B (red). Cells stained for MR (green) and FcγRIIIA/B (red). Images captured in phase contrast. MR and FcγRIIIA/B (a) and with overlay of cell images (b). Nuclei stained with 4',6-diamidino-2-phenylindole (DAPI).

Fig. S6. Immunoprecipitates (lanes 1 and 3) and immunoblots (lanes 2 and 4) obtained using anti-FcγRIIIA/B. CD4+ T cells (lanes 1 and 2) and Jurkat cells (lanes 3 and 4). Silver staining of immunoprecipitates, CD4+ T cells (lane 1) and Jurkat cells (lane 3). Immunoprecipitates analysed by Western blotting using anti-FcγRIIIA/B, lane 2 (CD4+ T cells) and lane 4 (Jurkat cells). At 29 kD a broad band with another band at 35 kD was observed in CD4+ T cells and a single band at 29 kD in Jurkat cells.

Fig. S7. Immunoprecipitates obtained using anti-FcγRIIIA/B monoclonal antibodies. Proteins stained using silver (left) and blots stained with Coomassie Brilliant Blue R250. Untreated cells (lane 1), terminal complement complex (TCC) (lane 2), TCC and immune complexes (ICs) (lane 3) and IC-treated cells (lane 4). Arrow point to a protein migrating at approximately 72 kD (Syk).

Fig. S8. Inhibition of aggregated human γ-globulin (AHG) binding to CD4+ T cells by anti-FcγRIIIA/B monoclonal antibody. 1 × 106 cells treated with AHG-AlexaFluor®488 (5 µg), control cells treated with isotype antibody (10 µg, left panel) and monoclonal anti-FcγRIIIA/B (10 µg, right panel).

FilenameFormatSizeDescription
CEI_4505_sm_FigS1-S8.pdf1371KSupporting info item

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.