Gene expression of cytokines and cytokine receptors is modulated by the common variability of the mitochondrial DNA in cybrid cell lines

Authors


  • Communicated by: Fuyuki Ishikawa

* Correspondence: E-mail: g.debenedictis@unical.it

Abstract

Some lines of evidence indicate that common polymorphisms of mitochondrial DNA (mtDNA) act as susceptibility factors in complex traits, such as age-related common diseases. There is also evidence that the cell capability to compensate ravages caused by intrinsic or extrinsic stress factors could contribute to some of these diseases. The cross-talk between nuclear and mitochondrial genome may link the above observations if we assume that the transcription of stress-responder nuclear genes is modulated according to the mtDNA common variability. Cytokines and cytokine receptors are key molecules in stress response. We could, therefore, check the above hypothesis by analyzing expression patterns of cytokine and cytokine receptor genes in response to stress in cell lines sharing the same nuclear genome but different mtDNA. By using a cybrid model (143B.TK osteosarcoma cells depleted of their own mtDNA and repopulated with foreign mitochondria) we show that the transcription patterns of some of such genes are specifically modulated by the variability of the mitochondrial genome not only under stress conditions (interleukin-6) but also at basal conditions (interleukin-1β and tumor necrosis factor receptor 2). These findings provide a first experimental evidence of a relationship between mtDNA common variability and expression pattern of stress responder nuclear genes in human cells.

Introduction

Mitochondria play a central role in cell biology by converting dietary calories into usable energy. This process generates reactive oxidative species (ROS) as a toxic by-product. As ROS are detrimental to the integrity of the mitochondrial DNA (mtDNA), a ‘mitochondrial paradigm’ of degenerative diseases, aging and cancer has been proposed, which assumes that the late onset and progressive course of age-related diseases result from the accumulation of somatic mutations in the mtDNA of postmitotic tissues (Linnane et al. 1989; Wallace 2005). Two clues suggest that the mtDNA inherited variability also has a role in this performance. First, significant associations have been found between mtDNA common polymorphisms and age-related complex traits, such as Parkinson disease (van der Walt et al. 2003; Autere et al. 2004; Otaegui et al. 2004; Ghezzi et al. 2005), Alzheimer disease (Chagnon et al. 1999; van der Walt et al. 2004), cardiovascular diseases (Takagi et al. 2004), longevity (Tanaka et al. 1998; De Benedictis et al. 1999; Ross et al. 2001; Niemi et al. 2005); second, significant differences in oxidative phosphorylation performance have been found between sperm having mtDNA of different haplogroups (Ruiz-Pesini et al. 2000). Therefore, not only somatic but also inherited mtDNA variability could act as a susceptibility factor in complex phenotypes, according to the cell capability to cope with oxidative stress. In line with this perspective, studies in model organisms showed that signals from mitochondria to nucleus are able to modulate both the expression of stress-responder genes and lifespan (Kirchman et al. 1999).

Cytokines are small secreted proteins which play a pivotal role in the homeostasis of the organism, by mediating and regulating immunity, inflammation and hematopoiesis. They act by binding to specific membrane receptors, which, through secondary messengers, modulate the expression of a series of downstream genes. Therefore, an appropriate expression of cytokine and cytokine receptor genes is crucial for coping with a variety of intrinsic and extrinsic stress factors. If the variability of the mtDNA does play a role in stress-response, cell lines sharing the same nuclear genome but different mtDNAs (cybrid cell lines) should show different expression profiles of these master genes under stress conditions. We checked this hypothesis by analyzing the transcription patterns of cytokine and cytokine receptor genes in cybrid cell lines repopulated with foreign mitochondria having different mtDNA sequences. The results here reported show that, at both basal and stress conditions, some of the above genes are expressed according to mtDNA common variability.

Results

Cell fusion and mtDNA variability in cybrid cell lines

We produced cybrid cell lines by fusing platelets from two young donors with 143B.TK osteosarcoma cells depleted of mitochondrial DNA (rho0 cells). The absence of mtDNA in the rho0 cells was verified by two approaches. First, the cells were unable to grow without added uridine, and died within 10 days, thus showing loss of functional mitochondria. Second, PCR amplification of the 15996–16401 mtDNA region gave negative results in DNA extracted from the rho0 cells (results not shown). Positive mtDNA repopulation was confirmed by the growth of clones in selective medium lacking of uridine.

According to the variability at evolutionary conserved positions (RFLP analyses), the mtDNA of the native cell was classified as belonging to the X haplogroup, while those of the donor platelets to H and J haplogroups (Torroni et al. 1996). Accordingly, we named the two cybrid cell lines H and J.

MtDNA molecules of both native and cybrid cells were then entirely sequenced to assess their diversity. Results are shown in Table 1. With respect to the revised Cambridge reference sequence (rCRS) (Andrews et al. 1999; <http://www.mitomap.org>), 58 variant sites were found: 24 sites occurred in the-non-coding region, at key points involved in the regulation of mtDNA replication and transcription; 8 sites were in 12S rRNA, 16S rRNA and 1 in the tRNAThr genes; 25 sites were in the coding region, and 9 of them changed conserved amino acids.

Table 1.  Variant sites found in mtDNA molecules from 143B.TK, H and J cybrid lines
Position (nt)LocusNucleotide change*143B.TKCybrid HCybrid JAmino acid change
  • *

    Nucleotide changes are reported with respect to the revised Cambridge reference sequence (rCRS) (<http://www.mitomap.org>). Cn, stretch of numerous (n) cytosines; Cins and Ccins, insertion of 1 (Cins) or 2 (Ccins) cytosines; Syn, synonymous mutation.

73HV2A → GGGNon coding
114HV2C → TTNon coding
146HV2T → CCCNon coding
152HV2T → CCCNon coding
153HV2A → GGNon coding
195HV2T → CCCNon coding
225CSB1G → AANon coding
226CSB1T → CCNon coding
295TFYC → TTNon coding
309CSB2Cn→CC insCC insNon coding
315CSB2Cn→C insC insC insNon coding
462D-loopC → TTNon coding
489D-loopT → CCNon coding
499D-loopG → AANon coding
70912SG → AANon coding
143812SA → GANon coding
171916SG → AANon coding
173316SC → TTNon coding
262816ST → CCNon coding
270616SA → GGGNon coding
301016SG → AANon coding
3330ND1C → TTSyn
4216ND1T → CCY → H
6221CO1T → CCSyn
6267CO1G → AAA → T
6371CO1C → TTSyn
7028CO1C → TTTSyn
8269CO2G → AANon coding
9141ATP6T → CCSyn
10398ND3A → GGT → A
11251ND4A → GAASyn
11719ND4G → AAASyn
11932ND4C → TCCSyn
12612ND5A → GGSyn
12705ND5C → TTSyn
13101ND5A → CCSyn
13135ND5G → AAA → T
13708ND5G → AAA → T
13711ND5G → AAA → T
13966ND5A → GGT → A
14470ND6T → CCSyn
14766CytBC → TTTI → T
15034CytBA → GGSyn
15310CytBT → CCSyn
15397CytBA → GGSyn
15452CytBC → AAL → I
15894tRNAThrG → AANon coding
16069HV1C → TTNon coding
16126HV1-7SDNAT → CCNon coding
16145HV1-7SDNAG → AANon coding
16189HV1-7SDNAT → AANon coding
16222HV1-7SDNAC → TTNon coding
16261HV1-7SDNAC → TTNon coding
16278HV1-7SDNAC → TTNon coding
16288HV1-7SDNAT → CCNon coding
16302HV1-7SDNAA → GGNon coding
16362HV1-7SDNAT → CCNon coding
165197SDNAT → CCNon coding

Control experiments

Before starting with the analysis of gene expression profiles, we carried out a series of control experiments on the four lines (parental 143B.TK, rho0, H and J), to assess the quality of the experimental conditions.

Cell growth and quantification of mtDNA

The growth curve was not substantially different among the four cell lines, with uridine in the rho0 culture (Supplementary Fig. S1). In order to verify that the amount of mtDNA did not differ among 143B.TK, H, and J cell lines, we estimated the number of copies of mtDNA per cell in each line by using Quantitative Competitive-PCR (QC-PCR). No significant difference was observed among the three lines (Supplementary Fig. S2).

Functionality of the cybrid cell lines

We assessed the mitochondrial functionality of the cybrid lines by measuring the Mitochondrial Membrane Potential (MMP). Both H and J cell lines displayed a value of MMP comparable to that of the 143B.TK parental line, thus showing that the cybrid lines were metabolically active; as expected, MMP was lower in the rho0 cells (Supplementary Fig. S3).

Stress conditions

The stress experimental conditions (dosage and treatment time by 2-deoxy-d-ribose) were verified by cell viability assay and DNA fragmentation analysis. By using a viability/proliferation assay, we verified that the viability did not differ among the four cell lines at 48 h, either at basal or stress conditions (Supplementary Fig. S4). Then, we checked the efficacy of the 48 h stress by looking at the internucleosomal DNA fragmentation which is expected in an apoptotic response (Supplementary Fig. S5). After assessing the quality of the cell lines and stress experimental conditions we went on with the analysis of gene expression.

Gene expression profiles

Gene expression was analyzed at both basal and stress conditions by multiplex RT-PCR for a panel of eight genes coding for cytokines and cytokine receptors (tumor necrosis factor-α, TNF-α; tumor necrosis factor receptor 1, TNFR1; tumor necrosis factor receptor 2, TNFR2; Granulocyte Macrophage-Colony Stimulating Factor, GM-CSF; Granulocyte Macrophage-Colony Stimulating Factor Receptor, GM-CSFR; interleukin-1β, IL-1β; interleukin-6, IL-6; interleukin-6 receptor, IL-6R). We replicated the experiments three times, starting from the same clone for each cell line: the data were consistent in the three experiments, according to genes, cells, basal/stress conditions. An example of the expression patterns is shown in Fig. 1, while Table 2 summarizes the average densitometric measures over the three experiments. By applying a pair-wise test (t-Student) for each gene we found significant differences between H and J lines at both basal (IL1β, P = 0.001; TNFR2, P = 0.012) and stress conditions (IL-6, P = 0.009). As we used a multiplex RT-PCR (see Experimental procedures) the possibility that PCR did not reach the stationary level for some of the checked genes could not be excluded. However, since the same conditions were applied in each experiment, the differences observed by comparing gene specific mRNAs between the two cybrid lines could be considered reliable.

Figure 1.

RT-PCR electrophoresis pattern of cytokines and cytokine receptors in 143B.TK, Rho0, cybrid H and cybrid J cells at basal and stress conditions. Stress was carried out with 2-deoxy-d-ribose 20 mm for 48 h. Ctr: control cDNA supplied by the kit; GAPDH: Glyceraldehyde phosphate dehydrogenase; TNF-α: tumor necrosis factor-alpha; GM-CSFR: Granulocyte Macrophage-Colony Stimulating Factor receptor; IL-1β: interleukin 1-beta; TNFR1: tumor necrosis factor receptor 1; GM-CSF: Granulocyte Macrophage-Colony Stimulating Factor; IL-6: interleukin-6; IL-6R: interleukin-6 receptor; TNFR2: tumor necrosis factor receptor 2; MW: Molecular Weight 100 bp ladder.

Table 2.  Densitometer analysis of gene expression of cytokines and cytokine receptors in 143B.TK, Rho0, cybrid H and cybrid J cell lines at basal and stress conditions. Average values over three experiments (Standard Deviation in parentheses) are reported
 Basal conditionsStress conditions
143B.TK M (SD)Rho0 M (SD)H M (SD)J M (SD)143B.TK M (SD)Rho0 M (SD)H M (SD)J M (SD)
TNF-α0.000 (0.000)0.000 (0.0000.000 (0.000)0.000 (0.000)0.000 (0.000)0.000 (0.000)0.000 (0.000)0.000 (0.000)
GM-CSFR0.000 (0.000)0.000 (0.000)0.000 (0.000)0.000 (0.000)0.000 (0.000)0.000 (0.000)0.000 (0.000)0.000 (0.000)
IL-1β0.859 (0.160)0.562 (0.061)0.312 (0.119)1.321 (0.163)0.000 (0.000)0.000 (0.000)0.000 (0.000)0.000 (0.000)
TNFR11.248 (0.345)1.187 (0.207)1.161 (0.285)1.252 (0.379)1.023 (0.245)1.043 (0.231)1.284 (0.180)1.203 (0.185)
GM-CSF0.000 (0.000)0.000 (0.000)0.000 (0.000)0.000 (0.000)0.000 (0.000)0.000 (0.000)0.000 (0.000)0.000 (0.000)
IL-60.291 (0.007)0.000 (0.000)0.803 (0.108)0.503 (0.061)0.000 (0.000)0.389 (0.104)0.951 (0.161)0.327 (0.159)
IL-6R1.544 (0.411)1.422 (0.170)1.506 (0.487)2.080 (0.163)1.262 (0.264)1.238 (0.161)1.753 (0.400)1.285 (0.173)
TNFR20.202 (0.065)0.000 (0.000)0.000 (0.000)0.144 (0.056)0.000 (0.000)0.000 (0.000)0.000 (0.000)0.000 (0.000)

To exclude the possibility that the observed differences were caused by genetic instability of the nuclear genes (as well as by alteration of the transcription patterns due to experimental manipulation in producing the cybrid lines) we replicated two times the experiment on a further clone from each of the H and J lines, and again obtained consisting results (Supplementary Table S1). Thus, from the whole set of experiments, we concluded that some cytokine and cytokine receptor genes are expressed according to mtDNA variability, at both basal and stress conditions (Table 2: compare H and J lines as it regards IL1-β and TNFR2 at basal conditions; compare H and J lines as it regards IL6 at stress conditions).

To verify whether the different patterns observed in the above experiments were due to a differential expression of mtDNA genes in cybrid cell lines we analyzed the expression profiles of the 13 genes encoding for the mitochondrial peptides. Results are shown in Fig. 2. We have not observed significant differences between the cell lines at either basal or stress conditions.

Figure 2.

RT-PCR electrophoresis pattern of mitochondrial genes coding for peptides in 143B.TK, Rho0, cybrid H and cybrid J cells at basal and stress conditions. Stress was carried out with 2-deoxy-d-ribose 20 mm for 48 h. 1: ND1 (NADH Dehydrogenase, subunit 1); 2: ND2; 3: ND3; 4: ND4; 5: ND4L; 6: ND5; 7: ND6; 8: COI (Cytochrome c oxidase I); 9: COII; 10: COIII; 11: CytB (Cytochrome b); 12: ATP6 (ATP Synthase 6); 13: ATP8 (ATP Synthase 8).

Discussion

The cross-talk between nucleus and mitochondria is fundamental in cell biology (Rose et al. 2002). Cybrid technology provides a powerful tool to explore if the common variability of the mitochondrial DNA plays a role in this cross-talk. However, cybrid technology requires some caution: first, the effect of a possible genomic instability of the nuclear DNA has to be taken into account; second, gene transcription patterns may be altered by the experimental manipulation (re-introduction of foreign mitochondria into cells depleted of their own mitochondria). For these reasons, before starting with the experiments on gene expression, we carefully checked the quality of native, rho0, cybrid cell lines (see control experiments).

What is more, to escape artefacts due to technical manipulation, we repeated the experiment three and two times on two independent cybrid clones. As we obtained consistent results in all the cases, we are confident that the differences in gene expression patterns (Fig. 1) are reliable and not due to stochastic factors. In any case, as the H and J cybrid lines were equally manipulated, the different gene expression patterns observed between the cybrid lines should be due to the different mtDNA used to repopulate the rho0 cell.

In the 143B.TK cell line the gene expression profiles of cytokines and their receptors were consistent with those observed in other osteosarcoma cells (Bilbe et al. 1996). Also the change of the expression patterns observed in the rho0 cells with respect to the native cells (Fig. 1, Table 2) was in line with recent data showing that the rho0 cells modulate the expression of specific genes to compensate their status of oxidative stress (Miceli & Jazwinski 2005).

Let us now compare the cybrid lines. We see that, at basal conditions, the IL-1β gene is expressed about three times more in the J than in the H line. Likewise, the TNFR2 gene is expressed in the J but not in the H line. Therefore, the J cell line expresses both the genes more than the H line. Interestingly, the differences observed between the cybrid lines at basal conditions disappear under stress conditions, because neither the H nor the J line expresses IL-1β or TNFR2. This finding is in agreement with literature data reporting a repression of gene expression by oxidative stress (Morel & Barouki 1999).

Now, let us look at the expression profile of IL-6. For this gene the H and J cell lines do not show different expression patterns at basal conditions; but, under stress conditions, the H line activates IL-6 transcription more than the J line (P = 0.009). Therefore, the connection between mtDNA variability and IL6 expression pattern seems to be activated under stress conditions only. This hypothesis agrees with the IL-6 expression patterns shown by the native and the rho0 cells, which clearly show that the stress condition modifies the expression profile of this gene. Indeed, at basal conditions, IL-6 is expressed in the native cell while not in the rho0 cell; vice versa, under stress conditions, the gene transcription is suppressed in the native cell, but activated in the rho0 cell. The comparison of IL-6 expression between native and rho0 cells provides a further evidence for the existence in human cells of a stress-dependent retrograde response (Miceli & Jazwinski 2005).

Of course, it would be incautious to infer from this data a direct effect of mtDNA diversity on complex phenotypes at organism level. In any case, taking into account the pleiotropic effects that IL-1β, TNFR2 and IL-6 genes exert on a myriad of cell pathways crucial in age-related common diseases, we believe that the findings described above deserve further functional studies.

In conclusion, the analysis of expression of cytokine and cytokine receptor genes at basal and stress conditions revealed mitochondrial-specific effects for the expression of IL-1β, TNFR2 and IL-6 genes. Although the findings obtained by means of the cybrid technology cannot be immediately transferred to the situation at organism level, our results provide a first experimental evidence that mtDNA common variability could modulate nuclear gene expression through still unknown mechanisms.

Experimental procedures

Cell lines and culture conditions

143B.TK osteosarcoma cells were kindly provided by G. Attardi of the California Institute of Technology, Pasadena, CA, USA. The cells were maintained in DMEM (Dulbecco's Modified Eagle Medium) (Gibco) containing 4.5 g/L glucose and 110 µg/mL pyruvate, supplemented with 10% FBS (Fetal Bovine Serum) (Gibco), 100 µg/mL 5-bromo-2′-deoxy uridine (Sigma) and 50 µg/mL gentamicin (Gibco).

The rho0 cell line was obtained by culturing 143B.TK in the routine growth medium containing 50 ng/mL ethidium bromide (0.22 µm-filtered) with regular replenishment of medium for about 2 months (King & Attardi 1996). After ethidium bromide treatment, the cells were maintained in DMEM supplemented with 10% FBS, 100 µg/mL 5-bromo-2′-deoxy uridine and 50 µg/mL uridine (Sigma). At this stage the cells were plated at low density and individual clones were isolated.

Both 143B.TK and rho0 cells were cultured in a water-humidified incubator at 37 °C in 5% CO2/95% air.

Experiments for quality control of mtDNA depletion

The complete depletion of mtDNA in rho0 cells was assayed by both auxotrophic test and PCR amplification of the D-loop mtDNA.

  • • For auxoptrophic test 6 × 108 rho0 cells were grown in uridine-free DMEM supplemented with 10% dialyzed FBS (Gibco) and 100 µg/mL 5-bromo-2′-deoxy uridine. Medium was changed at regular intervals (2 days). Cell survival was checked every 48 h.
  • • D-loop PCR amplification was performed with primers encompassing the mtDNA region comprised between nucleotides 15996 and 16401 (primer forward 5′ CTCCACCATTAGCACCCAAAGC 3′; primer reverse 5′ TGATTTCACGGAGGATGGTG 3′).

Production of transmitochondrial cybrids

Transmitochondrial cell lines were obtained by the method of Chomyn (1996). Platelets were isolated by differential centrifugation from blood of two 27-years-old donors, and the pellet was utilized to generate cybrids. Platelet donors gave written informed consent, according to the guidelines of the Ethical Committee of the University of Calabria.

rho0 cells were collected by low-speed centrifugation, re-suspended in DMEM and counted. 106 rho0 cells were mixed with an equal number of platelets and the culture medium was eliminated by centrifugation. Cells were re-suspended for 1 min in 0.1 mL of 42% polyethyleneglycol 1500 (Sigma). The fusion mixture was cultured in standard DMEM for 48 h and then in selective medium uridine-free DMEM supplemented with 10% FBS and 100 µg/mL 5-bromo-2′-deoxy uridine. After 2–3 weeks in the selection medium, several distinct colonies emerged: 20 colonies were isolated by trypsinization in cloning rings and propagated.

To ensure complete stabilization of the mtDNA amount, the functional assessment of selected clones was carried out only after at least 3 months of clone cycling.

MtDNA analyses

For both parental (143B.TK) and cybrid lines, confluent 100-cm2 plates were trypsinized and total DNA was isolated by digestion with 1.5 mg/mL proteinase K in 10 mm Tris-HCl, pH 7.4/10 mm NaCl/25 mm EDTA/1% SDS at 37 °C for 4 h. Then the DNA was extracted with phenol/chloroform, precipitated by ethanol, dried and re-suspended in TE (Tris/EDTA) buffer.

Haplogroup typing was used to verify whether the mtDNA of the cybrid lines was that of the donor platelets. By RFLP analyses of the coding region (Torroni et al. 1996) and D-loop sequencing (15996–16401 PCR fragment) the mtDNA of the native cell (143B.TK) was classified in the X haplogroup, while those of the cybrid lines in the H and J haplogroups. Accordingly, the two cybrid lines were named H and J lines.

To exactly define the whole variability of the mtDNA molecules used in our experiments, sequencing of the entire mtDNA molecule in the three cell lines was performed by the C.R.I.B.I.-BMR, DNA SEQUENCING SERVICE, University of Padua (Italy). The sequences were then aligned by Genalys 2.0 to find variations with respect to the Cambridge Reference Sequence (MITOMAP: A human mitochondrial genome database; <http://www.mitomap.org>).

Proliferation assay

143B.TK, rho0, cybrid H and cybrid J cells were seeded in 6-well plates (1 × 105/well) in regular growth medium. Adherent cells were trypsinized after 24, 48 and 72 h culture and counted on a hemocytometer with an inverted light microscope using a 10× magnification.

Quantification of mtDNA

The number of mtDNA copies per cell was estimated by a Quantitative Competitive-PCR (QC-PCR) method (Pinti et al. 1999; Salvioli et al. 2003).

Mitochondrial membrane potential (MMP) assay

Mitochondrial membrane potential (MMP) was assessed by double staining with MitoTracker Green™ (MTG, specific for mitochondrial mass) and TetraMethyl Rhodamine Methylesther (TMRM, specific for MMP) (Molecular Probes, Eugene, OR, USA).

143B.TK, rho0 and cybrid cells were collected during the log phase of growth by trypsinization, counted and reseeded in fresh complete medium in 6-well plates (2 × 105 cells/well). After 24 h, the cells were stained with MTG 100 nm and TMRM 150 nm for 20 min at 37 °C, then collected and analyzed at flow cytometer. Parameters for acquisition were set up as follows: Fl1 PMT: 389; Fl2 PMT: 461; Fl1-Fl2 compensation: 0.8%; Fl2-Fl1 compensation: 35.1%. Cells with low MMP were those having low TMRM fluorescence. Cytofluorimetric analyses were performed using a FACScalibur cytometer (BD, San José, CA, USA) equipped with an Argon ion laser tuned at 488 nm. In all analyses, a minimum of 1 × 104 cells per sample were acquired in list mode and analyzed with Cell Quest software.

Oxidative stress treatment

Oxidative stress was induced by treating cells with 2-deoxy-d-ribose (dRib). dRib, a higly reducing sugar, causes depletion of the intracellular reduced glutathione (GSH) and therefore increase of the cell level of ROS, which in turn induce cell death (Barbieri et al. 1994; Kletsas et al. 1998).

Two × 105 143B.TK, rho0 and cybrid cells were seeded in regular growth medium in 100-cm2 plates. In the exponential growth phase, the growth medium was discarded and replaced with DMEM with 2-deoxy-d-ribose 20 mm (Sigma). The cells were incubated to 37 °C for 24, 48 and 72 h. Untreated cells were also analyzed as control.

Viability/proliferation assay

Treated and untreated cell lines were assayed for viability by Trypan Blue exclusion assay.

Floating and adherent cells were collected and 200 µL of cellular suspension were added to an equal volume of 0.4% Trypan Blue solution (Sigma). Viable and-non-viable cells were then counted on a hemocytometer with an inverted light microscope using a 20× magnification.

DNA fragmentation analysis

Treated and untreated cells were trypsinized and centrifuged at 3000 g for 5 min. The pellet was incubated on ice for 20 min in 400 µL of lysis buffer (10 mm Tris-HCl pH 8, 20 mm EDTA, 0.2% Triton-X100). After a 12 000 g centrifugation for 20 min, an equal volume of phenol/chloroform was added to the supernatant. Then, after a new 12 000 g centrifugation for 5 min, an equal volume of chloroform was added to supernatant and centrifuged again. The supernatant was collected and stored at −20 °C overnight after adding 0.1 volume of 3 m sodium acetate pH 5.2 and 2 volumes of ethanol to precipitate DNA.

DNA was pelleted by centrifugation at 12 000 g per 20 min, rinsed with 70% ethanol and then resuspended in TE buffer containing 100 mg/mL RNase A. After 2 h of incubation at 37 °C, the DNA samples were loaded on to a 1.5% agarose gel, electrophoresed in TAE (Tris/Acetate/EDTA) buffer and stained with ethidium bromide.

RT-PCR of cytokine and cytokine receptor genes

Total RNA was extracted from control and treated cells by using RNeasy Mini Kit (Qiagen). The RNA concentration was measured for each sample by using a spectrophotometer at an absorbance ratio of 260/280 nm. RNA samples were treated with DNA-free DNAse to remove any residual genomic DNA contamination.

The RT-PCR (Reverse Transcriptase-PCR) reactions were carried out by using the RETROscript Kit provided by Ambion.

An RT mix including 10 µg of total RNA and 100 pmoles of random decamers was preheated at 70 °C for 5 min. The reaction was carried out in a 50 µL final volume containing 1× RT Buffer, 0.4 mm of each dNTP, 25 U of RNase inhibitor, 275 U of MMLV (moloney murine leukemia virus) reverse transcriptase. The mix was incubated at 37 °C for 1 h and, successively, at 95 °C for 10 min to inactivate the reverse transcriptase.

For the cytokine analysis, we used MPCR (Multiplex PCR) Amplification kit provided by Maxim Bio. This kit has been designed to direct the simultaneous amplification of specific human inflammatory cytokine genes.

The PCR mixture in 25 µL volume contained 2.5 µL of cDNA, 1× MPCR Buffer, 1× MPCR primers specific for cytokine and cytokine receptor genes and 1.5 U Taq DNA polymerase (Eppendorf). As internal control, the MPCR primers mixture contained primers specific for human GAPDH (glyceraldehyde-3-phosphate dehydrogenase) housekeeping gene. Two control reactions were carried out: a positive control containing as template the cDNA supplied by the kit and a negative control that did not contain cDNA. After an initial denaturation step at 96 °C for 1 min, the PCR was cycled twice at 96 °C for 1 min and 67 °C for 2 min, followed by 35 cycles of 96 °C for 1 min and 67 °C for 4 min. The final step was incubation at 70 °C for 10 min. Then, PCR products were analyzed on 2.2% agarose gel containing ethidium bromide 0.5 mg/mL. Fluorescence intensity of each band was calculated using a densitometer analysis (Kodak Electrophoresis Documentation and Analysis System 290, EDAS 290) and then normalized with respect to the GAPDH band intensity.

RT-PCR of mitochondrial genes

The RT reactions were carried out as described above by using 2 µg of total RNA.

The PCRs were performed with 1 µL of cDNA in a total volume of 25 µL containing 1× amplification Buffer, 200 µm of each dNTP, 0.8 µm of specific primers (Supplementary Table S2), 1.25 U of EuroTaq DNA polymerase. Primers for GADPH gene were used as internal control. Twenty-five cycles of PCR were carried out at 92 °C for 30 s, 58 °C for 30 s and 72 °C for 1 minute. The products were loaded on to a 2% agarose gel, electrophoresed in TAE buffer and visualized with ethidium bromide staining. Fluorescence intensity of each product was calculated by Kodak densitometer and then normalized respect to GAPDH band intensity.

Acknowledgements

The work was supported by Fondo Investimenti Ricerca di Base, FIRB, 2001 (to C.F. and to G.D.B.) and by the Programmi di Ricerca Scientifica di Rilevante Interesse Nazionale, PRIN, 2004 (to G.P.).

Ancillary