Communicated by: Stephan C. Kowalczykowski
Identification, developmental expression and regulation of the Xenopus ortholog of human FANCG/XRCC9
Article first published online: 20 JUN 2007
DOI: 10.1111/j.1365-2443.2007.01096.x
Additional Information
How to Cite
Stone, S., Sobeck, A., Van Kogelenberg, M., De Graaf, B., Joenje, H., Christian, J. and Hoatlin, M. E. (2007), Identification, developmental expression and regulation of the Xenopus ortholog of human FANCG/XRCC9. Genes to Cells, 12: 841–851. doi: 10.1111/j.1365-2443.2007.01096.x
Publication History
- Issue published online: 20 JUN 2007
- Article first published online: 20 JUN 2007
- Received: 26 January 2007; Accepted: 26 March 2007
- Abstract
- Article
- References
- Cited By
Abstract
Fanconi anemia (FA) is associated with variable developmental abnormalities, bone marrow failure and cancer susceptibility. FANCG/XRCC9 is member of the FA core complex, a group of proteins that control the monoubiquitylation of FANCD2, an event that plays a critical role in maintaining genomic stability. Here we report the identification of the Xenopus laevis ortholog of human FANCG (xFANCG), its expression during development, and its molecular interactions with a partner protein, xFANCA. The xFANCG protein sequence is 47% similar to its human ortholog, with highest conservation in the two putative N-terminal leucine zippers and the tetratricopeptide repeat (TPR) motifs. xFANCG is maternally and zygotically transcribed. Prior to the midblastula stage, a single xFANCG transcript is observed but two additional alternatively spliced mRNAs are detected after the midblastula transition. One of the variants is predicted to encode a novel isoform of xFANCG lacking exon 2. The mutual association between FANCG and FANCA required for their nuclear import is conserved in Xenopus egg extracts. Our data demonstrate that interactions between FANCA and FANCG occur at the earliest stage of vertebrate development and raise the possibility that functionally different isoforms of xFANCG may play a role in early development.
Introduction
The hereditary syndrome Fanconi anemia (FA) belongs to the groupof caretaker gene diseases that are characterized by genomic instabilityand increased susceptibility to cancer. The FA patient phenotype is highly variable featuring impaired growth, hypogonadism, and developmental abnormalities of the skeleton, kidney and heart. On a cellular level, the hallmark of FA is hypersensitivity to DNA interstrand cross-linking agents, such as mitomycin C, suggesting a defect in the DNA damage response (Auerbach et al. 1997; Joenje & Patel 2001). This idea is further supported by the identification of a member of the FA pathway FANCD1 as BRCA2, a protein that is indispensable for DNA repair by homologous recombination (Howlett et al. 2002).
Despite recent progress in FA research, the function of the majority of members of the FA pathway has not been elucidated. Thirteen FA complementation groups have been identified, and all of the corresponding genes, except FANCI, have been cloned (FANCA,FANCB, FANCC, FANCD1 (BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (BRIP1), FANCL, FANCM and FANCN) (reviewed in Thompson 2005; Reid et al. 2007; Xia et al. 2007). The FANCA/B/C/E/F/G/L/M proteins interact in a nuclear multi-protein “core” complex, which is required for the monoubiquitylation of FANCD2 (Garcia-Higuera et al. 2001). FA proteins typically lack recognizable functional domains, except for FANCJ/BRIP1, which has a DEAH-box helicase domain; FANCM, which contains a DNA helicase and endonuclease domain; FANCL, which contains a WD40 repeat, a PHD-finger and a E3 ubiquitin ligase domain; FANCN which contains an N-terminal prefoldin like domain and two C-terminal WD40-like repeats; and FANCG which has at least seven tetratricopeptide repeat (TPR) motifs (Meetei et al. 2003a, 2005; Blom et al. 2004; Levitus et al. 2005; Levran et al. 2005; Reid et al. 2007; Xia et al. 2007).
TPR motifs are often found in multi-protein complexes such as the FA core complex; the tertiary structure forms superhelical structures that mediate protein–protein interactions. Human FANCG is believed to bind FANCA through TPR motifs 1, 2, 5 and 6 (Blom et al. 2004). The FANCA–FANCG interaction is required for stabilization and entry of either protein into the nucleus and has been suggested to be an early event in the nuclear assembly of the FA core complex (de Winter et al. 2000). Though the exact function of the FANCG protein is unknown, it has been shown to be required for the assembly of the FA core complex, and for the interaction between XRCC3 and FANCD1/BRCA2, proteins involved in homologous recombination (Waisfisz et al. 1999; Garcia-Higuera et al. 2000; Hussain et al. 2006).
We recently described several orthologs of the Xenopus FA genes and showed that they are required for maintenance of genomic stability in Xenopus cell-free extracts (Sobeck et al. 2006). In this paper, we extend the Xenopus model for FA with the identification and characterization of the Xenopus ortholog of FANCG/XRCC9 (xFANCG) (Liu et al. 1997; de Winter et al. 1998). We found three differently spliced transcripts of xFANCG in Xenopus, all of which were expressed after the midblastula transition during early vertebrate development. We show that xFANCG and the core complex protein xFANCA associate in egg extracts and that they are mutually dependent for nuclear import, as described previously for human cells (Waisfisz et al. 1999; Garcia-Higuera et al. 2000). Moreover, both proteins are required for the monoubiquitylation of Xenopus FANCD2 (xFANCD2).
Results
Isolation of Xenopus laevis FANCG (xFANCG) cDNA
To isolate xFANCG cDNA we performed a TblastN search of a X. tropicalis protein database <http://www.xenbase.org> with the amino acid (aa) sequence of human FANCG. We found two X. tropicalis sequence fragments that aligned with the central region of human FANCG (hFANCG) (aa 120–308 and 396–487). Based on the corresponding nucleotide sequence of the X. tropicalis matches, we designed primers for reverse transcription-PCR (RT-PCR). The full-length X. laevis FANCG cDNA sequence (xFANCG) was isolated from a X. laevis cDNA made from pooled stages 8–13 embryos (Nieuwkoop & Faber 1967) by PCR and 5′ and 3′ RACE-PCR. The full-length sequence was then confirmed by sequencing cDNA from the tadpole-derived Xenopus XTC-2 cell line (Pudney et al. 1973) and submitted to NCBI (accession number EF107711). The primer sets described in Materials and methods amplified the full-length xFANCG and a shorter version of xFANCG termed xFANCGshort.
Comparison of the full-length xFANCG and hFANCG protein sequences revealed 34% identity and 47% similarity overall (Fig. 1 and Table 1). Although the overall homology between human and xFANCG is low, the amino acid similarity of the two N-terminal leucine zippers is 64% and 72%, and TPR motifs 3, 4 and 5 are 68%, 74% and 68%, respectively, suggesting that these domains could be critical for FANCG function (Fig. 1 and Table 1).
Figure 1. Comparative sequence analysis of Xenopus and human FANCG. A ClustalW alignment of full-length Xenopus laevis FANCG (xFANCG) with full-length human FANCG (hFANCG). Dark grey shading indicates amino acid identity; light grey shading indicates amino acid similarity. The exons described in this paper are outlined with black boxes—labeled (on top) 1, 2 and 3. Asterisks indicate positions of serines shown to be important for hFANCG function (Mi et al. 2004; Qiao et al. 2004). Black arrows indicate the critical leucine residues of the previously described leucine zipper motifs (Demuth et al. 2000). Grey boxes indicate TPR motifs—labeled (on bottom) 1–7 (Blom et al. 2002). The black underlined sequence (amino acids 378–407) shares homology with the transcriptional co-repressor NAB1(van De Vrugt et al. 2002).
| Domain | % Similarity | % Identity |
|---|---|---|
| Entire sequence | 47 | 34 |
| Leucine zipper 1 | 64 | 59 |
| Leucine zipper 2 | 72 | 48 |
| TPR 1 | 41 | 29 |
| TPR 2 | 53 | 47 |
| TPR 3 | 68 | 53 |
| TPR 4 | 74 | 59 |
| TPR 5 | 68 | 41 |
| TPR 6 | 47 | 32 |
| TPR 7 | 29 | 26 |
| NAB1-like | 53 | 40 |
Isolation of a xFANCG variant that skips exon 2
Sequence analysis revealed that xFANCGshort was missing 92 bp beginning at nucleotide 63 (Fig. 2A). Because this position corresponds to the junction of exon 2 of hFANCG, we hypothesized this sequence could be a splice variant that skips exon 2. We sequenced X. laevis genomic DNA in this region and found that acceptor and donor sites were conserved between X. laevis and hFANCG for exon 2 (shown schematically in Fig. 2B) confirming the position of exon 2 and suggesting that exon 2 was deleted in the variant xFANCGshort. Further analysis of the splice variant showed that the splicing event disrupted the open reading frame of exon 1. However, we identified a potential downstream alternative start codon in exon 1 that is in-frame with exon 3 that could encode the xFANCGshort isoform shown in Fig. 2C.
Figure 2. An mRNA splice variant of Xenopus FANCG, lacking exon 2 is present during embryo development. (A) A ClustalW alignment shows the nucleotide sequence of hFANCG cDNA compared with full length xFANCG and an xFANCG deletion variant that lacks exon 2 (xFANCGshort). The borders of exons 1, 2 and 3 are conserved between human and Xenopus as indicated by black arrows. (B) A schematic of the alternative splice event that leads to skipping of exon 2 in xFANCGshort. Line 1: 5′ cDNA sequence of full-length xFANCG encompassing exons 1–3. Line 2: Exon–intron structure of xFANCG on the genomic level. Introns are indicated as black lines. The boxed region represents the start codon (ATG) for full-length xFANCG. Line 3: cDNA sequence of the alternative splice variant xFANCGshort, which is missing exon 2. A putative start codon is indicated by a boxed ATG located at the end of exon 1 which is in frame with exon 3 (+2 reading frame) but not with the original start codon at the beginning of exon 1. (C) A ClustalW alignment shows the translation product of exons 1–3 of hFANCG compared with that of full-length xFANCG and xFANCGshort. Black arrows indicate the borders of exons 1, 2 and 3.
To determine if and when the different splice isoforms of xFANCG are expressed during embryonic development, we examined xFANCG expression by RT-PCR using mRNA isolated from eggs or developmentally staged embryos ranging from blastula through tadpole stages (Nieukoop stages 1, 5, 8, 20, 24, 33, 39 and 41) (Nieuwkoop & Faber 1967). The different splice isoforms were amplified from cDNAs isolated from staged embryos using primers that directly flanked exon 2.
xFANCG mRNA of the expected size was expressed throughout development from stages 1–41 (Fig. 3A, panel 1: termed xFANCG-1). Two additional xFANCG mRNA transcripts were detected in stage 20 embryos (Fig. 3A, panel 1: termed xFANCG-2 and xFANCG-3). Sequencing analysis of the transcripts revealed that xFANCG-1 corresponded to full-length xFANCG, whereas xFANCG-3 corresponded to xFANCGshort. The sequence of xFANCG-2 was not determined (shown in Fig. 3A, panel 1). However, since the PCR to amplify xFANCG at different stages was performed with primers directly flanking exon 2, we suspect xFANCG-2 is a splice variant of xFANCG that contains part of exon 2. We also investigated whether mRNA transcripts of xFANCA, -D2, -F and -L were expressed during development. As shown in Fig. 3A, panels 2–5, respectively, transcripts of all xFA genes were detected at all embryonic stages 1–41; however, no variants were detected for these genes.
Figure 3. xFA genes are expressed maternally and during embryonic development. (A) An agarose gel shows the RT-PCR products for xFANCG -A, -D2, -F and -L from different developmental stages (as indicated at the top of panel 1) using the primers listed in Materials and methods. Transcripts of all FA genes were expressed throughout development (panels 1–5). Three alternative transcripts were detected for xFANCG at stages 20, 24, 33, 39 and 41 (after the midblastula transition at stage 8, panel 1). (B) An immunoblot probed with anti-xFANCG, anti-xFANCA, and xFANCD2 indicated on the left of each panel, shows that xFANCG, xFANCA and xFANCD2 are expressed throughout the developmental stages indicated (top). The right-most lane is a negative control (labeled “Pre”) consisting of a re-probe of the same immunoblots with the pre-immune antisera corresponding to the antibody listed at the left of each panel.
xFANCG protein is expressed maternally and throughout development
To investigate the protein expression of xFANCG during development, we made a polyclonal antibody against xFANCG amino acids 354–374. This sequence is common among full-length xFANCG and the variants we describe in this paper. The antibody specifically recognized a band of the expected size (69 kDa) in egg extracts by immunoblot. This band was confirmed as xFANCG by mass spectrometry analysis (data not shown).
xFANCG was present in protein lysates prepared from whole embryos throughout development, from stage 0 (oocyte) to stage 31. As in egg extracts, only a single protein product was detected for xFANCG (Fig. 3B, panel 1). Proteins predicted to be expressed by the shorter splice variants were not detectable by immunoblot. Similar to xFANCG, xFANCA and xFANCD2 were detected throughout development from stages 0 through 31 (Fig. 3B, panels 2 and 3, respectively) consistent with the robust amounts of FANCA and FANCD2 in egg extracts as we described previously (Sobeck et al. 2006).
The interaction of xFANCG with xFANCA is conserved in Xenopus
To determine if the interaction between FANCG and FANCA observed in human cells (Waisfisz et al. 1999) is conserved in Xenopus interphase egg extracts, we performed reciprocal co-immunoprecipitations of xFANCA with xFANCG (Fig. 4A). We found that xFANCG co-immunoprecipitated xFANCA in the extracts (Fig. 4A: panel 1, lane 3), and the reciprocal immunoprecipitation by xFANCA co-immunoprecipitated xFANCG (Fig. 4A: panel 2, lane 4). Immunoprecipitation of xFANCD2 did not detectably co-immunoprecipitate xFANCA or xFANCG, as expected from previous studies with human cell lysates (Fig. 4A: panel 3, lanes 3 and 4) (de Winter et al. 2000). In addition, xFANCG and xFANCA co-migrated in predominantly one complex of ∼900 kDa on a Superose-6 size exclusion column (Fig. 4B). These data demonstrated that the interaction between endogenous xFANCG and xFANCA was conserved in Xenopus egg extracts.
Figure 4. Interactions between human FANCA and FANCG are conserved in Xenopus egg extracts. (A) An immunoblot (antibodies used are indicated on left of each panel) shows that an immunoprecipitation (IP) with anti-xFANCG (lane 3, panel 2), co-immunoprecipitated (co-IPed) xFANCA (lane 3, panel 1) but not xFANCD2 (lane 3, panel 3). An IP with anti-xFANCA (lane 4, panel 1) co-IPed xFANCG (lane 4, panel 2) but not xFANCD2 (lane 4, panel 3). An IP with anti-xFANCD2 (lane 2, panel 3) did not co-IP xFANCA (lane 2, panel 1) or xFANCG (lane 2, panel 2). One microliter of egg extract was used as a positive control for all three proteins (lane 1, all panels). Lane 5 is a mock control IP with xFANCG pre-immune sera. (B) An immunoblot (antibodies used are indicated on left of each panel) shows the protein complex elution profile of egg extract from a Superose 6 gel filtration column. The majority of xFANCG and xFANCA proteins co-eluted similarly at ∼900 kDa. (C) An immunoblot (antibodies used are indicated on left of each panel) shows that in Xenopus extracts (lanes 1–3) depletion of xFANCA (lane 1, panel 2) partially co-depleted xFANCG (lane 1, panel 3) and a depletion of xFANCG (lane 2, panel 3) partially co-depleted xFANCA (lane 2, panel 2) when compared to an IgG control depletion (lane 3, panels 2 and 3). The bands indicated as xFANCG have been identified by mass spectrometry (S. Stone, unpublished data). xFANCD2 was used as a loading control for the first three lanes (panel 1). After the formation of nuclei in the depleted extracts (lanes 4–6), there was no nuclear import of residual non-depleted xFANCA or xFANCG (lanes 4 and 5, panels 2 and 3) following the depletion of either protein, whereas the IgG control depleted nuclei shows normal import of xFANCA and xFANCG (lane 6, panels 2 and 3). Although imported into the nuclei (panel 1, lanes 4–6), xFANCD2 was not monoubiquitylated in the absence of xFANCA or xFANCG (lanes 4 and 5, panel 1) but was monoubiquitylated in the IgG control depleted nuclei (lane 6, panel 1).
Next we wanted to test if the absence of xFANCG affected nuclear import of xFANCA or the monoubiquitylation of xFANCD2 as described in human cells (Garcia-Higuera et al. 2000). To analyze this, we used extracts prepared from Xenopus eggs as described by Murray (1991). Briefly, these extracts are arrested at the end of meiosisand contain only negligible amounts of DNA. Upon chemical activation,the extracts are released into interphase in tight synchrony. Whensperm chromatin is added to these extracts, the DNA decondensesand a nuclear membrane forms around the DNA, followed by one roundof semi-conservative chromosomal replication. Following replication, we reisolated the nuclei that formed in the extract and examined the nuclear accumulation of xFANCA, and xFANCG, as well as the non-monoubiquitylated (short) and monoubiquitylated (long) form of xFANCD2 in depleted extracts (Sobeck et al. 2006). A quantitative depletion of xFANCG only partially co-depleted xFANCA but prevented the residual xFANCA protein remaining in the extract from entry into the nuclei (Fig. 4C, lanes 2 and 5). Similarly, quantitative depletion of xFANCA prevented residual xFANCG from entering the nuclei (Fig. 4C, lanes 1 and 4). Moreover, depletion of either xFANCA or xFANCG prevented the shift of xFANCD2 from short to long form in the nuclei, a mobility shift that is concomitant with monoubiquitylation of FANCD2. In contrast a mock-depleted control was capable of supporting the shift of FANCD2 (Fig. 4C, compare lanes 4–6). It is important to note here that FANCG is sometimes observed as two or three isoforms (as is seen in Fig. 4C) in Xenopus extracts, in human cells, and in Chinese hamster ovary cells (Qiao et al. 2001; Tebbs et al. 2005). We believe the multiple bands are not the products of the alternative transcripts we describe since the extracts are derived from unfertilized eggs that contain only the full-length xFANCG transcript. Future work will determine if these multiple bands are due to phosphorylation, degradation or other protein modification.
Discussion
We identified the X. laevis ortholog of human FANCG, and examined its expression during embryonic development and its molecular interactions in egg extracts. Our results suggest that several FA Xenopus orthologs are co-ordinately expressed during early development and participate in protein complexes that are conserved in vertebrates from frog to man.
Fanconi anemia (FA) patients have an increased incidence of cancer, bone marrow failure and a variety of developmental abnormalities. Little is known about how the FA proteins participate in these processes. Xenopus is an attractive model system for FA because extracts from the Xenopus eggs provide a biochemical platform to dissect the functions of the FA proteins in a cell-free and replication-competent context, and because Xenopus is an excellent model organism for primitive hematopoiesis. Unlike other vertebrate models, the Xenopus embryo has been precisely fate-mapped, making it possible to mis-regulate the expression of proteins in single blastomeres within embryos so that the fate of specific tissues can be studied (Galloway & Zon 2003; Maeno 2003; Moore 2004; Lane & Sheets 2005). We previously described Xenopus orthologs for xFANCD2, -A, -F and -L, and established that FA proteins are required for maintenance of genomic stability during unperturbed replication in Xenopus cell free extracts (Sobeck et al. 2006). The results described here further develop Xenopus as model organism for FA by cloning and characterizing xFANCG, by establishing the expression pattern of several FA genes during early development, and by establishing that the architecture of the FA core complex proteins is conserved in egg extracts with regard to another key feature: the FANCA–FANCG interaction.
To date, FA gene expression has not been well characterized in the developing embryo. Here we report that xFANCD2 and the core complex genes xFANCA, -L, -F and -G are expressed maternally and throughout early development. Interestingly, by the neurula stage of development, two shorter xFANCG transcripts are expressed. The variants of xFANCG are present after the midblastula transition until the tadpole stage, while the majority of the maternal sequences were full-length xFANCG. Sequence analysis revealed that one of the shorter variants is an alternative version of xFANCG that lacks exon 2, which encodes the beginning of one of the putative leucine zippers.
Because FANCG and other core complex proteins functionally interact, expression of developmentally regulated alternative versions of FANCG may be important for early development in vertebrates. Evolutionary conservation of exon-skipping events has previously been shown to represent functional alternative splicing from mouse to human (reviewed in Lareau et al. 2004). Although splice variants for FANCG have not been described in human or mouse, an alternative FANCG transcript, also involving exon 2, has been reported in chicken DT40 cells (Yamamoto et al. 2003). Thus, alternative splicing events affecting exon 2 appear to be common between frog and chicken, reinforcing the idea that these variants may be functional. The alternative FANCG transcript in chicken lacks the nucleotides encoding 11 amino acids in the 3′ region of exon 2, and is predicted to encode a version of FANCG that is missing the beginning of the first of two putative N-terminal leucine zippers. Ectopic expression of this variant was not able to complement chicken FANCG-deficient cells, suggesting that exon 2-encoded sequences are required for FANCG function (Yamamoto et al. 2003). In a survey of FANCG protein expression during development we did not observe protein corresponding to the multiple xFANCG isoforms expected from expression of the splice variants. However, if the predicted variants are translated detection might be difficult. First, the RT-PCR method we used was not quantitative so it may be that these transcripts and/or the encoded proteins are only weakly expressed. The proteins may be quickly post-transcriptionally degraded (by a process termed “RUST” or “regulated unproductive splicing and translation” used to regulate gene expression (Lareau et al. 2004)). The variant proteins might also be post-translationally modified and unable to be detected by our antibodies in the modified form. It is also possible that the full-length and variant proteins, if they are expressed, were not separated by our methods. Further studies will be required to resolve this issue.
The X. laevis ortholog of FANCG is 47% similar and 34% identical to human FANCG. The previously published TPR domains 3, 4 and 5, and leucine zippers 1 and 2 are the most similar between human and Xenopus with 68%, 74%, 68%, 64% and 72% homology, respectively. Interestingly the serines known to be important for FANCG phosphorylation (serines 7, 383, 387) are not conserved in Xenopus (Mi et al. 2004; Qiao et al. 2004). However both the full-length xFANCG and the splice variant have a threonine at position 7, raising the possibility that phosphorylation at these sites substitutes for the serine phosphorylation observed in the human FANCG protein. In addition, a glutamic acid residue is located in the Xenopus sequence at the human serine 387 position, which has been reported to mimic the addition of a phosphate moiety to a protein (Wagner et al. 2004).
Co-immunoprecipitation of FANCA and FANCG was also conserved in Xenopus. In addition, we show that quantitative depletion of xFANCA in a Xenopus egg extract results in a partial co-depletion of xFANCG (∼50%) and vice versa, suggesting that xFANCA and xFANCG do not form a stoichiometric (1 : 1) complex in Xenopus extracts (Fig. 4A,C). This was not a surprising result, since human FANCA has previously been shown to reside in at least three different complexes in unsynchronized HeLa nuclear extracts (Meetei et al. 2003b). Interestingly, analysis of xFANCA and xFANCG complexes in the naturally synchronized Xenopus interphase extracts by Superose-6 size exclusion chromatography, revealed that both proteins eluted in a complex of ∼900 kDa. Though this does not rule out the possibility that multiple xFANCA- or xFANCG-containing complexes might elute at 900 kDa, the larger 1.5–2 MDa (BRAFT complex) and the smaller 500 kDa FANCA complex, present in HeLa nuclear extracts, were not detected (Meetei et al. 2003b). One possible explanation is that the 900-kDa complex might be the predominant FANCA-containing complex in cell-cycle synchronous Xenopus interphase extracts. Further experiments are necessary to determine if BRAFT and other FA complexes exist in Xenopus extracts.
Although ∼50% of residual xFANCA and xFANCG protein remains in xFANCG, and xFANCA immunodepleted extracts, respectively, the residual xFANCA or xFANCG protein can no longer enter the nucleus. This observation supports the existing data that xFANCA and xFANCG depend on one another for nuclear entry (Waisfisz et al. 1999; Garcia-Higuera et al. 2000). Thus, several hallmarks of the functional molecular interactions of these FA proteins are conserved in egg extracts, underscoring the idea that egg extracts faithfully reproduce critical molecular interactions in the FA protein network.
Fanconi anemia (FA) research is still in the pathway-building stages with little known about the functions of the FA proteins, in particular the FA core complex proteins. With the many advantages Xenopus offers for cell-free biochemical analysis and as a classical developmental model, further studies to develop the Xenopus model for FA should be a valuable part of the research effort to understand the role of these proteins in supporting primitive hematopoiesis, development of the early embryo and cancer susceptibility in humans.
Experimental procedures
RT-PCR from Xenopus laevis embryo RNAs
Xenopus eggs were obtained, and embryos were cultured as described (Moon & Christian 1989). Embryos were staged according to Nieuwkoop & Faber (1967).
To make mixed developmental stage mRNA, total RNA was isolated from 60 embryos ranging from stages 8 to 13 (10 embryos from each stage). To make individual developmental stage mRNA, we isolated embryos of developmental stages ranging from one-cell stage to swimming tadpole (stages 1–41). For each mRNA preparation, 15 embryos of the same developmental stage were homogenized in buffer containing 50 mm NaCl, 50 mm Tris–HCl, pH 7.5, 5 mm EDTA, 0.5% SDS and 200 µg/mL proteinase K. After incubation on ice for 1 h, total nucleic acids were isolated by phenol–chloroform extraction and subsequent ethanol precipitation. RNA was selectively precipitated in 4 M LiCl. Total RNA samples were treated with RNase-free DNase. The RT-PCR was done in a two-step reaction using the Ambion RETROscript™ kit (Ambion). Following the recommendations of the manufacturer. Specific primers are listed in Table 2.
| Gene | 5′ to 3′ primer sets (forward and reverse) | NCBI Accession |
|---|---|---|
| xFANCA | ACATGTTTCTTAAGGATG TTAAAAGACAGGCTCAAAGAA | AY633664 |
| xFANCD2 | GATGTCATTAAATCGTCTG CCAGGTAATCTAATATACCC | AY633665 |
| xFANCF | ATGACTGCCTCAGAAATGCTCTT TTAAATCCTTTTCACTTCAAGTA | AY547288 |
| xFANCG | ATGGCAGGAGACTGTCTGACG CACTCTCCATGCTTTCAGCAG | EF107711 |
| xFANCL | ACTGGAGTCATTGAAAGGTT AGGCTGCCCACAACGGGGGT | AY633666 |
All PCRs were performed using the proofreading polymerase, Elongase (Invitrogen) according to the manufacturer's protocol. For sequencing, products separated by agarose gel were purified using the QIAquick kit (Qiagen) according to the manufacturer's protocol.
Isolation of full length Xenopus laevis FANCG cDNA
An amino acid search (TblastN) of the X. laevis NCBI database <http://www.ncbi.nlm.nih.gov> with the human FANCG protein sequence did not provide any relevant matches. A similar search of a species closely related to X. laevis, X. tropicalis, <http://www.xenbase.org> showed several sequence matches within amino acids 120–490 of human FANCG. Based on sequence similarity between human and X. tropicalis the following primer set was designed (5′F-GCACAGAGTGGCGGGCCTG-3′, 5′R-AGGTGGGCAGCCGATGCCC-3′) which amplified a 1000-bp PCR product from the X. laevis stages 8–13 cDNA library.
To determine the nucleotide sequence of the 5′ and 3′ regions of X. laevis FANCG we generated a pool of adaptor-ligated double stranded cDNAs for RACE PCR, as previously described (Schaefer 1995). Briefly, X. laevis stages 8–13 total RNA was treated with Tobacco Acid Pyrophosphatase (TAP) to remove the guanine cap from full-length mRNA leaving a 5′-monophosphate. A 45 base RNA adapter (5′-GCUGAUGGCGAUGAAUGAACACUGCGUUUGCUGGCUUUGAUGAAA-3′) was ligated to the free 5′-monophosphate with T4 RNA ligase. The 3′ RACE cDNA was synthesized from mRNA after annealing a 3′ RACE adapter sequence. (5′-GCGAGCACAGAATTAATACGACTCACTATAGGT12VN-3′) that binds to the poly A tail.
Following the protocol of the manufacturer of FirstChoice® RLM-RACE Kit (Ambion), a 5′ RACE PCR was performed using outer and inner adapter binding primers (5′F-GCTGATGGCGATGAATGAACACTG-3′, 5′F-CGCGGATCCGAACACT GCGTTTGCTGGCTTTGATG-3′), and outer and inner xFANCG-specific primers (5′R-CTTATAGAGCAAGTTCAGCGCC-3′, 5′R-CACTCTCCATGCTTTCAGCAG-3′). It is important to note here that the above primer sets amplified predominantly the 5′ truncated form of xFANCG missing exon 2 (termed xFANCGshort). After sequencing the product, an underlying second nucleotide sequence was identified and a new primer set was designed against this underlying sequence (5′F-GGAGGAGAATAACGTCATAGT-3′, 5′R-CTTATAGAGCAAGTTCAG CGCC-3′). This amplified the second exon of the 5′xFANCG sequence. The 3′ RACE PCR was performed using outer and inner adapter binding primers (5′R-GCGAGCACAGAATTAATACGACT-3′, 5′R-CGCGGATCCGAATTAATA CGACTCACTATAGG-3′), and outer and inner xFANCG-specific primers (5′F-CTGCTGAAAGCATGGAGAGTG-3′, 5′F-GGCGCTGAACTT GCTCTATAAG-3′).
Antibody production
A polyclonal rabbit antibody was raised against a synthetic xFANCG peptide ([H]-CLENKRGEEAVEHYLDLLALL-[OH]) conjugated to Keyhole Limpet Hemocyanin (KLH) (Covance) corresponding to amino acids 354–374 of X. laevis FANCG. The antibody was affinity purified using the same (non-KLH-bound ) synthetic peptide immobilized on an AminoLink® Plus column(Pierce) according to the manufacturer's instructions. The xFANCA and xFANCD2 antibodies have been previously described (Sobeck et al. 2006).
Preparation of egg extracts
Extracts were prepared from Xenopus eggs according to the methodof Murray (1991). In brief, eggs were dejellied in 2% cysteine,pH 7.8; washed 3 times in XB buffer (10 mm KCl, 1 mm MgCl2,100 nm CaCl2, 10 mm HEPES, 5 mm EGTA, 1.75%[wt/vol] sucrose,pH 7.8); and washed 3 times in CSF-XB buffer (XB buffercontaining 5 mm EGTA and 2 mm MgCl2). Eggs were crushed by low-speedcentrifugation (10 000 g; 10 min), and the cytoplasmic fractionwas cleared by centrifugation (16 000 g; 20 min) after theaddition of energy mix (15 mm creatine phosphate, 2 mm ATP,2 mm MgCl2), cytochalasin B (10 µg/mL), cycloheximide(100 µg/mL) and Pefabloc (100 µg/mL). To releaseextracts from M to S phase, CaCl2 was added to a final concentrationof 0.4 mm, and the extracts were incubated for 20 min at 23 °C.
Immunodepletion
To immunodeplete FANCA or FANCG from S-phase extracts, 100 µL of protein A beads (Amersham) were incubated overnight at 4 °C with 500 µL of phosphate-buffered saline and 100 µL of xFANCG,xFANCA affinity-purified antisera or pre-immune sera. The beads were pelleted from solution by centrifugationat 2500 g for 10 min at 4 °C and washed 3 times inXB buffer. A total of 100 µL of extract was added to thebeads. The extract–bead mixture was rotated for two rounds at4 °C for 40 min.
Preparation of nuclei
Fifty microlitersof egg extract (after immunodepletion by xFANCA, xFANCG or pre-immune sera) was incubated 1 h, at 23 °C with 1000 pronuclei (sperm heads)/µLand then diluted in nuclear isolation buffer (40 mm HEPES,100 mm KCl, 20 mm MgCl2) and purifiedthrough a 30% (wt/vol) sucrose cushion. Samples were centrifugedfor 20 min at 6000 g; the nuclear pellets were analyzed by SDS-PAGE gel and immunoblot.
Xenopus extract fractionation
Sixteen milligrams of interphase Xenopus extract prepared as described previously (Sobeck et al. 2006) was centrifuged (20 000 g) at 4 °C for 15 min and directly applied toa Superose-6 column (HR 16/50; Amersham) equilibrated with thecolumn running buffer containing 20 mm HEPES (pH 7.9), 200 mmNaCl, 1 mm DTT, 0.1 mm PMSF and 10% glycerol. Fractions werecollected (1.5 mL each) and analyzed by SDS-PAGE and immunoblot.
Immunoprecipitation
Two milligrams of egg extract was added to 1 mL of lysis buffer (10 mm Tris, pH 7.4, 150 mm NaCl, 1% NP40, 0.5% Deoxycholate, 1 mm EDTA, 0.5 mg/mL Pefabloc, 1 mm DTT). Ten microliters of rabbit polyclonal antibody against xFANCD2, xFANCA or xFANCG, were added and samples were mixed by rotating overnight at 4 °C. Then 100 µL of pre-swelled and washed (50% slurry in PBS) sepharose 4B beads (Amersham) were added and rotated for 30 min at 4 °C. The beads were pelleted from solution by centrifugation at 2500 rpm for 10 min at 4 °C and washed 3 times with lysis buffer.
Freon extraction of proteins from Xenopus embryos
Ten embryos of the same developmental stage were euthanized and homogenized in 300 µL of buffer containing 15 mm Tris–HCl and 2 mm PMSF. Three hundred microliters of freon (1, 1, 2-trichlorotrifluoroethane) was added to the tubes and vortexed for 60 s. The solution was then centrifuged (13 000 g) at 4 °C for 10 min to separate the top aqueous phase from the freon phase. A 1/3 volume of 4× sample buffer was added and the proteins were analyzed by SDS-PAGE and immunoblot.
Immunoblotting
Protein samples were separated on 3%–8% NuPAGE Tris–acetate gelsor 8%–16% Tris Glycine gels (Invitrogen) and transferredto Immobilon P membranes (Millipore).
Animals
Xenopus laevis were purchased from NASCO and reared at the Animal Facility of Oregon Health and Science University (OHSU). Experimental procedures were preformed in compliance with Federal Regulation and OHSU Institutional Animal Care and Use Committee (IACUC).
DNA sequencing and protein alignments
Sequencing of all PCR products were performed by the sequencing facility at OHSU with a PE/ABI automated sequencer. Protein sequence alignments and homology scores were derived from the MacVector™ 7.2.3 Clustal W alignment program.
Nucleotide sequence accession numbers
The full-length and shorter transcript encoding the X. laevis FANCG cDNA sequence has been deposited at NCBI under accession numbers EF107711 and EF519913, respectively.
Acknowledgements
We thank Dr Matt Guille for helpful comments on the manuscript. A.S. is a postdoctoral fellow of the American Heart Association (0 520 117Z). M.E.H. has received funding from the Fanconi Anemia Research Fund, the Medical Research Foundation of Oregon, and National Institutes of Health (CA112775).
References
- , & (1997) Fanconi anemia. In: The Molecular and Metabolic Basis of Inherited Disease (eds C.Scriver, A.Beaudet, W.Sly & D.Valle). New York: McGraw Hill, Inc.
- , , , , & (2004) Multiple TPR motifs characterize the Fanconi anemia FANCG protein. DNA Repair (Amst) 3, 77–84.
- , , , & (2002) Evolutionary clues to the molecular function of Fanconi anemia genes. Acta Haematol. 108, 231–236.
- , , , , , , , , & (2000) The Fanconi anemia protein FANCF forms a nuclear complex with FANCA, FANCC and FANCG. Hum. Mol. Genet. 9, 2665–2674.
- , , , et al . (1998) The Fanconi anaemia group G gene FANCG is identical with XRCC9. Nat. Genet. 20, 281–283.
- , , , et al . (2000) Spectrum of mutations in the Fanconi anaemia group G gene, FANCG/XRCC9. Eur. J. Hum. Genet. 8, 861–868.
- & (2003) Ontogeny of hematopoiesis: examining the emergence of hematopoietic cells in the vertebrate embryo. Curr. Top. Dev. Biol. 53, 139–158.
- , , & (2000) The Fanconi anemia proteins FANCA and FANCG stabilize each other and promote the nuclear accumulation of the Fanconi anemia complex [In Process Citation]. Blood 96, 3224–3230.
- , , , , , , & (2001) Interaction of the Fanconi anemia proteins and BRCA1 in a common pathway. Mol. Cell 7, 249–262.
- , , , , , , , , , , , & (2002) Biallelic inactivation of BRCA2 in Fanconi anemia. Science 297, 606–609.
- , , , , , , , , & (2006) Tetratricopeptide-motif-mediated interaction of FANCG with recombination proteins XRCC3 and BRCA2. DNA Repair (Amst) 5, 629–640.
- & (2001) The emerging genetic and molecular basis of Fanconi anaemia. Nat. Rev. Genet. 2, 446–457.
- & (2005) Fate mapping hematopoietic lineages in the Xenopus embryo. Methods Mol. Med. 105, 137–148.
- , , & (2004) The evolving roles of alternative splicing. Curr. Opin. Struct. Biol. 14, 273–282.
- , , , et al . (2005) The DNA helicase BRIP1 is defective in Fanconi anemia complementation group J. Nat. Genet. 37, 934–935.
- , , , , , , , , , , , , , & (2005) The BRCA1-interacting helicase BRIP1 is deficient in Fanconi anemia. Nat. Genet. 37, 931–933.
- , , , , , , & (1997) The human XRCC9 gene corrects chromosomal instability and mutagen sensitivities in CHO UV40 cells. Proc. Natl. Acad. Sci. USA 94, 9232–9237.
- (2003) Regulatory signals and tissue interactions in the early hematopoietic cell differentiation in Xenopus laevis embryo. Zool. Sci. 20, 939–946.
- , , , , , , , , , , , & (2003a) A novel ubiquitin ligase is deficient in Fanconi anemia. Nat. Genet. 35, 165–170.
- , , , , , , , , , , , , & (2005) A human ortholog of archaeal DNA repair protein Hef is defective in Fanconi anemia complementation group M. Nat. Genet. 37, 958–963.
- , , , , , , & (2003b) A multiprotein nuclear complex connects Fanconi anemia and bloom syndrome. Mol. Biol. Cell 23, 3417–3426.
- , , , , , , , , , & (2004) FANCG is phosphorylated at serines 383 and 387 during mitosis. Mol. Cell. Biol. 24, 8576–8585.
- & (1989) Microinjection and expression of synthetic mRNAs in Xenopus embryos. Technique 1, 76–89.
- (2004) Commentary: the role of cell migration in the ontogeny of the lymphoid system. Stem Cells Dev. 13, 1–21.
- (1991) Cell cycle extracts. Methods Cell Biol. 36, 581–605.
- & (1967) Normal Table of Xenopus laevis. Amsterdam: North Holland Publishing Co.
- , & (1973) Establishment of a cell line (XTC-2) from the South African clawed toad, Xenopus laevis. Experientia 29, 466–467.
- , , , , , & (2004) Phosphorylation of Fanconi anemia (FA) complementation group G protein, FANCG, at serine 7 is important for function of the FA pathway. J. Biol. Chem. 279, 46035–46045.
- , & (2001) Fanconi anemia proteins localize to chromatin and the nuclear matrix in a DNA damage-and cell cycle-regulated manner. J. Biol. Chem. 276, 23391–23396.
- , , , et al . (2007) Biallelic mutations in PALB2 cause Fanconi anemia subtype FA-N and predispose to childhood cancer. Nat. Genet. 39, 162–164.
- (1995) Revolutions in rapid amplification of cDNA ends: new strategies for polymerase chain reaction cloning of full-length cDNA ends. Anal. Biochem. 227, 255–273.
- , , , et al . (2006) Fanconi anemia proteins are required to prevent accumulation of replication-associated DNA double-strand breaks. Mol. Cell. Biol. 26, 425–437.
- , , , , , , , & (2005) New insights into the Fanconi anemia pathway from an isogenic FancG hamster CHO mutant. DNA Repair (Amst) 4, 11–22.
- (2005) Unraveling the Fanconi anemia–DNA repair connection. Nat. Genet. 37, 921–922.
- , , , , , , , , , , , , & (2002) Characterization, expression and complex formation of the murine Fanconi anaemia gene product FANCG. Genes Cells 7, 333–342.
- , 2nd, , & (2004) Functional consequences of phosphomimetic mutations at key cAMP-dependent protein kinase phosphorylation sites in the type 1 inositol 1,4,5-trisphosphate receptor. J. Biol. Chem. 279, 46242–46252.
- , , , , , , , , , , & (1999) A physical complex of the Fanconi anemia proteins FANCG/XRCC9 and FANCA. Proc. Natl. Acad. Sci. USA 96, 10320–10325.
- , , , , , , , , , , , , & (2007) Fanconi anemia is associated with a defect in the BRCA2 partner PALB2. Nat. Genet. 39, 159–161.
- , , , , , , , , & (2003) Fanconi anemia FANCG protein in mitigating radiation- and enzyme-induced DNA double-strand breaks by homologous recombination in vertebrate cells. Mol. Cell. Biol. 23, 5421–5430.

1365-2443/asset/olbannercenter.jpg?v=1&s=898fc42dd5b90fba93a045e23dee0db2ed10f6f5)
1365-2443/asset/olbannerright.jpg?v=1&s=0c52cf916836227732d593ba1cfab7d6ac4d85e4)
