SEARCH

SEARCH BY CITATION

Keywords:

  • FVIII;
  • genetics;
  • guidelines;
  • haemophilia A;
  • mutation analysis;
  • UKHCDO

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Aims of the guideline
  5. Materials and methods
  6. References

Summary.  Haemophilia A is a common inherited bleeding disorder that has a well-understood pathophysiology. Our understanding of the molecular genetics of the disease has allowed the development of comprehensive carrier and prenatal diagnosis for this single gene defect. Continuing technological developments improve our ability to provide genetic analysis in a rapid and cost effective manner. This guideline aims to provide advice on current best laboratory practice when approaching genetic diagnosis of haemophilia A.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Aims of the guideline
  5. Materials and methods
  6. References

Haemophilia A is an X-linked, recessively inherited bleeding disorder which results from deficiency of procoagulant factor VIII (FVIII). Affected males suffer from joint and muscle bleeds and easy bruising, the severity of which is closely correlated with the level of activity of coagulation factor VIII (FVIII:C) in their blood. Haemophilia severity is defined by FVIII:C level in plasma, where severely affected individuals have <0.01 i.u. dL−1 (<1% of normal); moderate 0.01–0.05 i.u. dL−1 (1–5% of normal); and mild >0.05 to <0.40 i.u. dL−1 (>5 to <40% of normal) [1]. The disease affects approximately 1 in 5000 males world-wide [2,3]. Family history of the disease is an indicator for referral, however, approximately one third of cases have no prior history of haemophilia A (sporadic disease). In severe haemophilia A, diagnosis often follows the observation of unexplained severe bruising or bleeding in young males, who frequently present when they first become mobile around 1 year of age. Their haemophilia status can readily be assessed by measurement of plasma FVIII:C level. Where there is a prior family history of haemophilia, male cord blood can be tested at birth to determine FVIII:C. Males with moderate to mild haemophilia may not present until adult life. It is recommended that all males with haemophilia be investigated to establish the causative FVIII gene mutation. For detailed discussion of genetic service provision in inherited bleeding disorders, reference should be made to the UKHCDO document ‘Clinical Genetics Services for Haemophilia’ [4].

Genetic analysis is required to reliably determine female carrier status, as Lyonization can markedly skew female FVIII:C levels. Female relatives may request carrier analysis when a male relative is first diagnosed as having haemophilia, when they wish to start a family, or frequently, when in early pregnancy. Genetic counselling should be performed by suitably qualified health professionals with in-depth knowledge of haemophilia. Ideally, a professional with experience of managing and treating patients with haemophilia and their families should be involved. It is recommended that genetic testing for haemophilia in the UK should be performed in a member laboratory of the UKHCDO Haemophilia Genetics Laboratory Network, details of which are hosted by the British Society for Haematology (http://www.b-s-h.org.uk/DirectoryV2.June2003.pdf). This is a consortium of laboratories, mostly within Comprehensive Care Haemophilia Centres, which work to agreed peer-reviewed standards of quality.

Aims of the guideline

  1. Top of page
  2. Abstract
  3. Introduction
  4. Aims of the guideline
  5. Materials and methods
  6. References

This guideline aims to provide advice on a rational approach to genetic diagnosis in haemophilia A using currently available laboratory techniques and best practice.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Aims of the guideline
  5. Materials and methods
  6. References

This guideline document was prepared on behalf of the UKHCDO Haemophilia Genetics Laboratory Network in response to a workshop meeting held at the UKHCDO annual meeting, 9 October 2003, Newcastle upon Tyne, UK. The workshop was attended by a range of UK based health care scientists working in the field of haemophilia genetic diagnosis. Diagnostic approaches and issues were discussed within the group. The guideline-writing group, consisting of UK based scientific experts in the field of haemophilia genetic diagnosis, used the discussion as a basis for the preparation of draft guidelines. This draft was prepared with reference to relevant literature reports, reviews and web-based resources relating to the subject. The draft was circulated to the workshop attendees for comment and the final document approved by the UKHCDO Advisory Committee. The resulting guidelines are hosted by the Clinical Molecular Genetics Society (CMGS) website (http://www.cmgs.org/new_cmgs/) from where this document is derived.

The FVIII gene

The FVIII gene spans 186 kb and is comprised of 26 exons, which range from 69 bp (exon 5) to 3.1 kb (exon 14) in size. The FVIII message is nearly 9 kb in size and encodes a mature protein of 2332 amino acids. Mild/moderate haemophilia A and approximately half of all severe haemophilia A results from heterogeneous mutations, which occur throughout the FVIII gene. For a review of the molecular aspects of haemophilia A see [5]. Key information resources for the FVIII gene are given in Table 1.

Table 1.  Key nomenclature and reference sequence identifiers for the FVIII gene.
Gene name (HUGO nomenclature)FVIII (F8)
OMIM number306700
GeneCards IDF8
Ensembl gene IDENSG00000165769
Chromosomal locationXq28
Medline MESH termHaemophilia A, factor-VIII
NCBI LocusLinkHsF8 (Locus ID 2157)

Diagnostic strategy

The severity of haemophilia A in the pedigree should be determined first as this will influence the diagnostic strategy employed. Severe haemophilics should be screened for the intron 22 inversion mutation [6,7] followed by the intron 1 inversion mutation [8]. This approach should identify the underlying mutation in 45–50% of severe haemophilia A patients. Remaining severe haemophilia A pedigrees should then be analysed further either by full mutation or linkage analysis. Moderate and mild haemophilia A is not associated with a common mutational mechanism and patients require either full mutation or linkage analysis. Disease in these remaining severe, moderate and mild patients is predominantly due to point mutations, small insertions and deletions. Large deletions and insertions are rare. A listing of mutation types can be found at The Haemophilia A Mutation, Structure, Test and Resource Site (HAMSTeRS) online resource (http://europium.csc.mrc.ac.uk/WebPages/Main/main.htm).

Intron 22 and intron 1 inversion screening  The FVIII gene intron 22 inversion mutation [6,7] accounts for disease in 20% of all patients and always produces severe disease (causative mutation in approximately 45% of severe haemophilia A). It results from homologous recombination between copies of a repeated DNA sequence, the intron 22 homologous region (int22h), one copy located in intron 22 of FVIII, the other two copies distal and telomeric to FVIII. In families with severe haemophilia A, the affected male(s) should first be tested for the presence of the FVIII intron 22 gene inversion. The inversion is detectable by Southern blotting [6] or more recently by long PCR based protocols [9,10]. The long PCR method allows results to be obtained within 24 h and uses a small amount of DNA, an important consideration when performing prenatal diagnosis on a limited quantity of chorionic villus biopsy (CVB). The second most common mutation in severe haemophilia A is the intron 1 inversion mutation. This was initially reported to be present in approximately 5% of patients [8], but in the UK severe haemophilia A population it was subsequently reported to have a frequency of 1.8% [11]. Where no affected male is available, an obligate carrier female can be tested instead to determine the presence of an inversion mutation in the family. If the intron 1 or intron 22 inversion is present in a family, carrier status of any female relative can be readily determined.

Mutation detection strategies

Intron 22 inversion detection by long PCR  Long PCR protocols for detection of the intron 22 inversion are now in common usage (Fig. 1, Table 2). This method for detection of the FVIII gene intron 22 inversion removes the requirement for southern blotting and results can be obtained within 24 h. It should be noted that the PCR method does not discriminate between types 1 and 2 (distal and proximal) rearrangements and may give unpredictable results where ‘type 3’ inversion events [12] or rarer mechanisms involving intron 22 recombination/deletion events [13] are present. Modifications from standard long-range PCR protocols include the addition of DMSO and incorporation of deaza dGTP to enable read through of a high GC content region of the FVIII gene. The method is most often performed as a multiplex PCR and generates a constant PCR product, which appears with all templates. This band acts as a control to show that the reaction has worked efficiently. The largest amplification product seen using this method is 12 kb, well within the range of the long PCR DNA polymerase mixes that should be utilized. Establishing the method can prove technically demanding. The most informative reference for the standard method is Liu and Sommer [10]. Of paramount importance is the quality of template DNA. Degraded or sheared DNA will not amplify. DNA quality can be monitored by electrophoresis, on a 1% agarose gel it should run with a size estimate of >50 kb. Protocols involving sub-cycling parameters may improve amplifcation. Success may also be achieved when using the described primers above [10] (Table 2) but in modified protocols [14]. Amplification of each int22 copy using specific primer pairs [14] may elucidate the precise nature of the rare intron 22 mediated recombination/deletion events discussed above [12,13]. Further specific and general considerations when detecting the intron 22 inversion by long PCR can be found on HAMSTeRS.

image

Figure 1. Long PCR for the FVIII gene intron 22 inversion.

Download figure to PowerPoint

Table 2.  PCR primer sequences for detection of the FVIII gene intron 22 gene inversion long PCR and intron 1 inversion PCR.
Primer designationSequence 5′–3′PCR product sizesRef.
Intron 22 long PCR
 Int22 PGCCCTGCCTGTCCATTACACTGATGACATTATGCTGAC10, 11 and 12 kb[9,10]
 Int22 QGGCCCTACAACCATTCTGCCTTTCACTTTCAGTGCAATA  
 Int22 ACACAAGGGGGAAGAGTGTGAGGGTGTGGGATAAGAA  
 Int22 BCCCCAAACTATAACCAGCACCTTGAACTTCCCCTCTCATA  
Intron 1 inversion PCR – Fragment 1: Int1h-1
 9FGTTGTTGGGAATGGTTACGG1.5 and 2 kb[8]
 Int1h-2FGGCAGGGATCTTGTTGGTAAA  
 9cRCTAGCTTGAGCTCCCTGTGG  
Intron 1 inversion PCR – Fragment 2: Int1h-2
 9FGTTGTTGGGAATGGTTACGG1.5 and 2 kb[8]
 Int1h-2FGGCAGGGATCTTGTTGGTAAA  
 Int1h-2RTGGGTGATATAAGCTGCTGAGCTA  

FVIII gene intron 22 inversion detection by Southern blot  To detect the intron 22 inversion mutation by Southern blot, 10 μg genomic DNA is restricted with 15–20 U BclI overnight at 50 °C, electrophoresed, typically on an 0.6% agarose gel (1400 V h) and probed typically with the 1.0 kb EcoRI-SacI fragment of p482.6 (ATCC codes 57202 and 57203 http://www.lgcpromochem.com/atcc/). The gel should clearly resolve fragments of 21.5, 20.0, 17.5, 16.0 15.5 and 14.0 kb.

The distal inversion (type 1) involves the copy of int22h furthest from FVIII, whereas the proximal inversion (type 2) involves the int22h copy closer to the FVIII gene. Occasional individuals have more than two extragenic copies of int22h and recombination can also occur with these (type 3), giving rise to more complex banding patterns [12]. As with the long PCR protocol care should be taken when interpreting abnormal patterns. Females with the inversion mutation are heterozygous carriers of severe haemophilia A.

The inversion can also be detected indirectly in males by the RT–PCR as a lack of message across exons 22 and 23 of FVIII [15], but female carrier status cannot be determined by this method. It is recommended that confirmation of inversion status in any male diagnosed by this process be obtained by a direct assay method.

Factor VIII gene intron 1 inversion PCR amplification  Since this mutation is the second most common described it should be sought in all families with severe haemophilia A during initial genetic diagnosis. A dual PCR assay has been devised for the detection of this mutation [8]. Both assays are designed to amplify sequence flanking the int1h (intron 1 homologous) regions independently. Int1h-1 specifies the assay for the copy in the FVIII gene and int1h-2 the homologous region 140 kb more telomeric. This assay can be performed by standard PCR and is robust (Table 2). However, there has been a report of partial gene deletions or int1h duplications which may give abnormal or unexpected banding patterns [16]; therefore it is recommended that the assay should always be carried out for both int1h-1 and 2 to reveal these anomalies.

Other mutation detection strategies

Previously characterized mutations  Many laboratories are now screening their patients for mutations in the FVIII gene (see the UKHCDO Directory of Molecular Diagnostic Services for Inherited Bleeding Disorders, on the British Society for Haematology website (http://www.b-s-h.org.uk/DirectoryV2.June2003.pdf). The UKHCDO haemophilia patient database, an annually updated reference to all UK registered patients, notes whether a mutation has been detected in a particular patient. Details of the mutation characterized in a patient of interest are only available from their Haemophilia Centre Director (listed on UK Haemophilia Society website (http://www.haemophilia.org.uk/)).

Unknown mutation detection  Unknown mutation detection strategies require the PCR amplification of the essential regions of the FVIII gene. Several primers sets have been used to achieve this (e.g. see Refs 17 and 18). A set of primers, designed to amplify at a common annealing temperature and now in use by several laboratories, can be found at the haemophilia A database (HAMSTeRS, see above).

Mutations are generally sought in an affected male and then confirmed or excluded in female relatives. The method selected will be dependent on resources and expertise available in a particular laboratory. Current methods which have been applied by many centres performing mutation prescreening in the UK haemophilia A population rely on heteroduplex formation and subsequent detection of mismatched heteroduplexes. There are two major heteroduplex formation methods in current use in the UK; conformation sensitive gel electrophoresis (CSGE) and denaturing high performance liquid chromatography (dHPLC). Other mutation prescreening methods may be used but are not currently employed by the Network.

Conformation sensitive gel electrophoresis

Conformation sensitive gel electrophoresis [19] is a variant of heteroduplex analysis, which has been applied to screening the FVIII gene for mutations [20]. It has the advantages of being simple and relatively rapid to perform and does not require the use of radiolabel. Despite this apparent simplicity, the technique requires a great deal of skill, both technical and interpretive, to achieve good sensitivity. PCR products subjected to CSGE should optimally be no greater than 500 bp and have a high degree of overlap (>100 bp is desirable) when amplifying large exons such as 14 and 26. Given careful design and application, an expected mutation detection sensitivity of >90% can be expected.

Denaturing high performance liquid chromatography

Denaturing high performance liquid chromatography [21] separates hetero and homoduplexes due to their differences in melting behaviour and subsequent retention time on a non-porous polystyrene-divinylbenzene matrix. DHPLC requires specialist equipment (most commonly used is the Transgenomic Wave System) but is otherwise a technically straightforward and rapid way to screen for mutations in the FVIII gene [22]. Care should be taken with assay design. Good primer design, assisted by software analysis of amplicon melting characteristics, is essential if high detection sensitivity is to be achieved. An experienced scientist should expect >95% sensitivity (150–500 bp). Fragments less than 110–120 bp in size are liable to loss of detection sensitivity. Larger fragments (up to 1–1.2 kb) can be studied but this invariably results in the need to accommodate more melt domains and hence more injections per sample at a range of oven temperatures. Best Practice Guidelines have been produced for dHPLC and can be found on the CMGS website (http://www.cmgs.org/BPG/Default.htm).

Chemical Cleavage of Mismatch

Although not in routine use in a diagnostic context, mutation analysis in haemophilia A by the RT–PCR methods followed by Chemical Cleavage of Mismatch has been used to good effect [23]. Such methodology may be of interest in cases where no mutation has been identified at the genomic DNA level.

Direct DNA sequencing

DNA sequencing is the gold standard for mutation detection in DNA from males. In the case of female carriers, heterozygosity for a mutation may not be readily detected with some sequencing approaches. Using streamlined procedures, the essential regions of the FVIII gene are now amenable to direct DNA sequence analysis in a rapid and cost effective fashion, given the appropriate infrastructure. Streamlined methods, including automated or semi-automated procedures can generate full sequence data for the FVIII gene within the rapid timescale often required in a diagnostic setting. Normally, a candidate mutation would be identified in a hemizygous male haemophilic before applying DNA sequencing to determine the presence or absence of a nucleotide alteration in at-risk family members. Failing this, a known obligate carrier female can be used for initial mutation identification, with the reservation noted above.

DNA Sequencing Best Practice  Refer to the CMGS website Sequencing Best Practice Guidelines (http://www.cmgs.org/new_cmgs/) for guidance on minimum sequence quality and interpretation standards. It is recommended that that the following points be given particular attention:

  • 1
    Software analysis tools (those which facilitate comparative sequence analysis such as the Staden Package (http://staden.sourceforge.net/)) should be employed when analysing large quantities of DNA sequence data.
  • 2
    Sequence analyses should always be performed on both forward and reverse strands and any sequence change used for diagnosis should be confirmed by repeat sequencing in relevant family members. As a minimum, this should be done with recourse to the original DNA (or stored blood) sample and re-amplification from the original sample. Some centres may wish to issue an interim report until they have been able to verify a base change in an independent sample from relevant individuals.

Mutation validation

When a novel nucleotide change is found, caution should be exercised before deciding that it is the one responsible for disease. The entire FVIII gene should be analysed for sequence alterations. Whereas termination, deletion and insertion mutations may obviously be causative, missense and other changes may not. The haemophilia A database (HAMSTeRS, see Diagnostic Strategy section for web address), maintained by Dr Kemball-Cook at the MRC Clinical Sciences Centre, London acts as an online repository of information of interest to those involved in haemophilia A genetic analysis. This should be consulted to determine whether the change has been previously reported. Entries on the HAMSTeRS database need to be interpreted with a degree of caution. Minimum checks should include the following questions:

  • 1
    Does the previously reported disease severity agree with the FVIII level in the patient being analysed?
  • 2
    Has the candidate mutation been reported previously as a polymorphism?
  • 3
    For missense mutations, does the nature and location of the amino acid substitution confer a high risk of being detrimental to protein structure/function?
  • 4
    Is the changed amino acid conserved across species?
  • 5
    Could the candidate mutation affect splicing? Software tools, e.g. StrataSplice (http://www.sanger.ac.uk/Software/analysis/stratasplice/) or the NetGene2 server (http://www.cbs.dtu.dk/services/NetGene2/) can be used to allow alternative splice site prediction.
  • 6
    Could the ethnic origin of the patient affect interpretation of polymorphism/candidate mutation status for a given base change?

Interpretation of the significance of a DNA base change, particularly amino acid substitutions, should draw upon all information resources available, including interpretation of FVIII life cycle and structure/function data (see Refs 24, 25 and 26 for discussion/examples).

Where uncertainty remains, the family should be tested to determnine whether the nucleotide alteration tracks with the disease. Further corroboration may be obtained by genotyping a panel of normal DNA samples of the same ethnic origin, where available, to rule out a polymorphic change (at minimum, 50 alleles). Wherever possible, candidate mutations should be confirmed in affected and excluded in unaffected males on the maternal side of the family. Candidate mutations can still be used as bespoke genetic markers if they track appropriately within the family, irrespective of their disease association.

Although DNA sequencing of the essential regions of the FVIII gene should have a very high degree of sensitivity, there remains the possibility that a proportion of patients will have a mutation, which lies outwith the regions being analysed. Data suggest that current DNA sequencing strategies will detect mutations or candidate mutations in 98% of haemophilia A males [27]. In a very small proportion or patients, the possibility remains that their haemophilia does not result from mutations in the FVIII gene [28]. This potential for non-linkage of haemophilia A phenotype should be taken into consideration if linked markers are used as an alternative diagnostic tool.

Linkage analysis

Historically, linkage analysis was the method most commonly used to determine female carrier status in families with haemophilia A. Linkage studies are being superseded by direct mutation analysis protocols. However, intragenic linked markers are still useful and may be of particular value under certain circumstances, such as:

  • 1
    Where a family has previously been investigated by linked markers and the mutation has not been identified.
  • 2
    Where a mutation has not been verified.
  • 3
    Where a mutation has not been found.
  • 4
    In families with a large deletion, where a mutation-specific PCR product cannot readily be amplified.

Only intragenic markers should be considered for use. There are two dinucleotide repeats and several dimorphisms within the FVIII gene. When three or four markers are used in combination, carrier status can be determined in approximately 80% of affected families. In those families with sporadic haemophilia (one third of families), female relatives can only be excluded from being carriers where they do not share an allele with the affected male.

Dinucleotide repeats  Dinucleotide repeats in introns 13 and 22 [29,30] are generally the first choice of markers as they have the highest rates of heterozygosity. A wide variety of methods can be used for their analysis; the method selected will depend upon laboratory circumstances. The simplest method involves PCR amplification followed by electrophoresis on a native polyacrylamide gel, and detection by ethidium bromide staining. Silver staining obviates the need for darkroom facilities. Alternatively, one primer can be end labelled with 32P, and labelled PCR products detected following electrophoresis on a denaturing polyacrylamide gel. This method is tedious, but effective at allele discrimination. For fluorescent detection, one primer is end fluorescent labelled, product is detected following analysis using an automated DNA sequencer for genotyping [31]. All analysis of the dinucleotide repeats suffers to an extent from stutter bands, which occur due to polymerase slippage during PCR amplification. These additional bands can complicate allele size identification. The possibility exists that expansion or contraction of dinucleotide repeats may occur between generations and this should be recognized.

Dimorphisms-standard PCR analysis  Commonly used dimorphisms in the FVIII gene which can be analysed by PCR include those detected by digestion with BclI in intron 18 [32], HindIII in intron 19 [33] and G/A in intron 7, which can be detected using an introduced AlwNI site [34]. Of these, BclI is the most widely used. HindIII is in strong linkage disequilibrium with BclI, so only one of these two markers should be analysed. The fragment amplified for HindIII dimorphism analysis also contains a constant HindIII restriction enzyme site.

A further dimorphism within intron 22, MspA1I has been described which, despite close proximity to the XbaI dimorphism (below), is not in complete linkage disequilibrium and may be useful in some family studies [35]. Primer sequences for commonly analysed dimorphisms are given in Table 3.

Table 3.  FVIII gene intragenic polymorphism PCR primer sequences.
Primer designationSequence 5′–3′PCR product size/bp*Ref.
  1. *+, presence of restriction site; −, indicates absence. For Caucasian allele frequencies refer to the HAMSTeRS database listing of known polymorphisms. See [45,46] for other ethnic groups.

AlwNI forwardTAATGTACCCAAGTTTTAGG260 bp (−) 232 and 28 bp (+)[34]
AlwNI reverseTATAGAACAGCCTAATATAGCAACAGACTC  
Intron 13 forwardTGCATCACTGTACATATGTATCTT(CA)n 20 repeats = 141 bp[29]
Intron 13 reverseCCAAATTACATATGAATAAGCC  
BclI forwardTAAAAGCTTTAAATGGTCTAGGC142 bp (−) 99 and 43 bp (+)[32]
BclI reverseTTCGAATTCTGAAATTATCTTGTTC  
HindIII forwardAAGGTCCTCGAGGGCGAGCATProduct = 717 bp[33]
HindIII reverseAAGGTCGGATCCGTCCAGAAG469 and 248 bp (−) 469, 167 and 81 bp (+) 
Intron 22 forwardTTCTAAGAATGTAGTGTGTG(GT)n (AG)n 26 repeats = 83 bp[30]
Intron 22 reverseTAATGCCCACATTATAGA  
XbaI Intragenic: Product 6.6 kb[36]
 Forward XEFCTGGAGAATCTAAGAGGATAGAGGACAACATTTACC6.1 + 0.5 kb (–) 
 Reverse XERAGTACTTCTCCAGGGTCTGGGCGTGCTC1.3 + 4.8 + 0.5 kb (+) 
Msp1 Intragenic: Product 176 bp[35]
 DWF forwardGGTGCTCAGTAGCCTGTCGTTGTG141 + 35 bp (–) 
 DWR reverseGCCACTACGCTCAGGTCCTGAGTC96 + 45 + 35 bp (+) 
 (Nested PCR: first round XbaI Intragenic PCR above, followed by second round using these primers)  

Dimorphisms-Southern blot and long PCR analysis  The XbaI dimorphism in intron 22 is detectable by Southern blotting or more recently by long PCR [36,37] as it lies in the int22h repeated DNA region. Most ethnic groups have a heterozygosity rate of close to 0.5. There is also an XbaI polymorphic site in each of the two extragenic copies of the int22h region, with heterozygosity rates in Caucasians of about 0.1. As the extragenic copies of int22h are telomeric to the FVIII locus by ∼400 kb, the recombination rate between them and the FVIII gene should be less than 1%.

To detect the polymorphisms by Southern blot, digest genomic DNA with 15 units each of XbaI and KpnI, or Asp718 (isoschisomer of KpnI), overnight at 37 °C, and electrophorese on an 0.8% agarose gel ∼1200 V h. Probe with the 1.0 kb EcoRI/SacI fragment of p482.6 (same probe as used for the intron 22 inversion blotting protocol).

Extragenic polymorphisms  Markers at St14 and DX13 were the first reported markers for FVIII gene tracking. However, their distance from the FVIII gene results in a risk of recombination of ∼5% per meiosis. For this reason extragenic markers should not be used. Where demonstration of linkage using intragenic markers fails the use of mutation screening is indicated.

Linkage analysis problems

Linkage analysis fails in a number of families for one of the following reasons:

  • 1
    Lack of prior family history.
  • 2
    Key pedigree members not available.
  • 3
    Polymorphisms uninformative in key female(s).
  • 4
    Non-paternity.

In these families, mutation detection should be used.

Linkage analysis cannot determine the carrier status of the mother of a haemophilic.

Wherever possible, mutation detection should be used for genetic counselling in haemophilia A families. However, this is not always practicable. Where direct mutation detection is not feasible, linkage analysis provides an acceptable alternative, which offers a high degree of diagnostic confidence. Further discussion of the application and utility of linked markers is contained in Peake et al. [38].

Prenatal diagnosis

Prenatal diagnosis is generally performed by chorionic villus sampling at between 11 and 13 weeks gestation. Direct karyotype analysis can be performed to determine foetal sex and to ensure that there are no chromosomal abnormalities. Rapid PCR based sexing protocols using amelogenin (AMXY) specific primer sets are in common usage. Female foetuses sexed by this method require confirmation that no maternal contamination is present in the sample. Female foetuses require no further analysis. Male haemophilia status can be determined by analysis of a previously determined familial mutation or informative marker. For analyses, which involve PCR amplification, results should be provided within 2–3 days of the CVS sample being taken. Where Southern blotting is required the analysis may take up to 10 days to complete. More detailed discussion on general issues relating to prenatal diagnosis can be found in the UKHCDO document ‘Clinical Genetics Services for Haemophilia’ [4].

Wording of reports

Reports must be clear, concise, accurate, fully interpretive, credible and authoritative. For general guidance on report writing refer to the CMGS web site Report Writing Best Practice Guidelines. Suggested wordings are given below.

Mutation analysis reporting  Wording will depend on the confidence placed in the interpretation of any candidate mutation, as discussed above. Suggested wording for a mutation which has a high confidence attached to it may include:

Mutation analysis in males ‘x has a mutation (No.nt>nt, aaNo.aa), previously reported in the FVIII gene/not previously reported. The mutation is consistent with the severity of haemophilia A in x.’

A brief explanation as to why a novel mutation is considered causative should be included, especially for a missense mutation. For example, the altered amino acid is conserved across X (a number of) species, and/or is structurally or functionally important; this base change has been excluded as a common polymorphism by analysis of >100 normal alleles, etc.

Mutation analysis in females ‘y carries a FVIII mutation (No.nt>nt, aaNo.aa) which is consistent with the severity of haemophilia A seen in male relative x.’

Mutation nomenclature

For guidance on nomenclature conventions when reporting mutations refer to the Human Genome Variation Society (http://www.genomic.unimelb.edu.au/mdi/mutnomen/). General guidance is given below:

  • 1
    The intron or exon containing the mutation should be stated. Note that in the absence of a complete genomic sequence for the FVIII gene that intronic numbering should be given using the cDNA as +/− with respect to the relevant exon, that is: ‘−’ for intronic mutations upstream of an exon, where ‘−1’ is the intronic nucleotide immediately 5′ to the first exonic nucleotide; ‘+’ for intronic mutations downstream of an exon end, where ‘+1’ is the intronic nucleotide immediately 3′ to the last exonic nucleotide.
  • 2
    The use of lower case letters for intronic sequence is recommended to avoid confusion with cDNA numbering.
  • 3
    The numbering convention used in the HAMSTeRS database should be followed [39]:
    • a.
      For cDNA nucleotide numbering, +1 is the first base of the initiator methionine codon.
    • b.
      Amino acid numbering starts at +1 for the first codon of the mature protein. The signal peptide is numbered from −19 (initiator methionine) to −1 (serine).
    • c.
      To avoid potential confusion between single letter amino acid codes and nucleotides, the following convention is recommended: Nucleotide position 5822 A>G, corresponding amino acid postion N1992S.
    • d.
      It is recommended that in the body of the report the full name of each amino acid is specified to avoid confusion between single letter amino acid and nucleotide codes, e.g. ‘Cysteine (C) 1234 to Alanine (A), or C1234A’.

Linkage analysis using intragenic markers  The female can be diagnosed as a carrier/excluded from being a carrier, with a risk of error due to meiotic recombination of <1%.

Detection of large-scale deletions in heterozygous carriers

Large deletion mutations are readily detected in affected males due to lack of amplification of missing regions of the FVIII gene. It is particularly difficult to detect these mutations in female relatives, where the failure to amplify one of the two FVIII alleles must be detected. Possible methods for detection of female carrier status in these families include:

  • 1
    Use of linkage analysis, which may reveal loss of heterozygosity for markers in the deleted region.
  • 2
    Methods based on gene dosage analysis may be utilized.
  • 3
    Gap PCR protocols may be developed where deletion boundaries are already known.
  • 4
    Other methods, such as Multiplex Ligation-dependent Probe Amplification (MLPA) [40] could be applied to the FVIII gene.

None of the latter three methods are in routine diagnostic use and may need to be developed specifically for a given family investigation.

Mosaicism

Germline and somatic mosaicism may complicate any genetic diagnosis in haemophilia A. Particular attention should be given to the possibility of mosaicism in sporadic haemophilia where the mother of an affected male does not appear to carry the mutation in her leucocyte DNA, particularly where the apparently de novo mutation is a point mutation [41].

It is recommended not to state that the mother of a haemophilic is not a carrier, even when the mutation is not identified in her somatic DNA. Specific reference to the possibility of germline mosaicism should be added.

von Willebrand factor – FVIII binding analysis

A number of patients with von Willebrand disease (VWD) have been previously misclassified as having mild haemophilia A. This results from their VWF having a defect in its FVIII binding site (type 2N VWD), the resulting phenotype in a homozygous or compound heterozygous individual mimicking mild haemophilia A [42,43]. The VWF gene is autosomally inherited. The two disorders can be discriminated by an ELISA based FVIII binding assay [44], which determines the FVIII binding capacity of patient's VWF. Some laboratories use this assay to examine all mild haemophilia A and VWD patients prior to their genetic analysis. Alternatively, it may be used where the FVIII deficiency does not show clear X-linked inheritance.

Reference samples for test optimization and validation

An EQA scheme has been established for haemophilia A genetic investigation. Details are available from UK NEQAS for Blood Coagulation (http://www.ukneqas.org.uk/Directory/HAEM/coagul.htm). Participation in EQA is recommended. There are currently no commercially available reference materials for FVIII gene analysis. These will become available in the future through the National Institute for Biological Standards and Control (NIBSC) (http://www.nibsc.ac.uk/).

Disclaimer

The information and advice contained within this guideline are believed to be true and accurate at the time of going to press. Neither the authors nor the publishers can accept any legal responsibility for any errors or omissions that may have occurred.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Aims of the guideline
  5. Materials and methods
  6. References
  • 1
    White GC II, Rosendaal F, Aledort LM, Lusher JM, Rothschild C, Ingerslev J. Factor VIII and Factor IX Subcommittee. Definitions in hemophilia. Recommendation of the scientific subcommittee on factor VIII and factor IX of the scientific and standardization committee of the International Society on Thrombosis and Haemostasis. Thromb Haemost 2001; 85: 560.
  • 2
    Forbes CD. The early history of hemophilia. In: ForbesCD, AledortL, MadhokR, eds. Hemophilia. London: Chapman & Hall, 1997: 36.
  • 3
    Bolton-Maggs PHB, Pasi JK. Haemophilias A and B. Lancet 2003; 361: 18019.
  • 4
    Clinical Genetics Services for Haemophilia 2004. Prepared by the UKHCDO, ISBN 901787 079.
  • 5
    Bowen DJ. Haemophilia A and haemophilia B: molecular insights. Mol Pathol 2002; 55: 12744.
  • 6
    Lakich D, Kazazian HH Jr, Antonarakis SE, Gitschier J. Inversions disrupting the factor VIII gene are a common cause of severe haemophilia A. Nat Genet 1993; 5: 23641.
  • 7
    Naylor J, Brinke A, Hassock S, Green PM, Giannelli F. Characteristic mRNA abnormality found in half the patients with severe haemophilia A is due to large DNA inversions. Hum Mol Genet 1993; 2: 17738.
  • 8
    Bagnall RD, Waseem N, Green PM, Giannelli F. Recurrent inversion breaking intron 1 of the factor VIII gene is a frequent cause of severe hemophilia A. Blood 2002; 99: 16874.
  • 9
    Liu Q, Nozari G, Sommer SS. Single-tube polymerase chain reaction for rapid diagnosis of the inversion hotspot of mutation in hemophilia A. Blood 1998; 92: 14589. Erratum in Blood 1999; 93: 2141.
  • 10
    Liu Q, Sommer SS. Subcycling-PCR for multiplex long distance amplification of regions with high and low GC content: application to the inversion hotspot in the FVIII gene. Biotechniques 1998; 25: 10228.
  • 11
    Cumming AM. UK Haemophilia Centre Doctors’ Organization Haemophilia Genetics Laboratory Network. The factor VIII gene intron 1 inversion mutation: prevalence in severe hemophilia A patients in the UK. J Thromb Haemost 2004; 2: 2056.
  • 12
    Antonarakis SE, Rossiter JP, Young M et al. Factor VIII gene inversions in severe hemophilia A: results of an international consortium study. Blood 1995; 86: 220612.
  • 13
    Andrikovics H, Klein I, Bors A et al. Analysis of large structural changes of the factor VIII gene, involving intron 1 and 22, in severe hemophilia A. Haematologica 2003; 88: 77884.
  • 14
    Bowen DJ, Keeney S. Unleashing the long-distance PCR for detection of the intron 22 inversion of the factor VIII gene in severe haemophilia A. Thromb Haemost 2003; 89: 2012.
  • 15
    Naylor J, Brinke A, Hassock S, Green PM, Giannelli F. Characteristic mRNA abnormality found in half the patients with severe haemophilia A is due to large DNA inversions. Hum Mol Genet 1993; 2: 17738.
  • 16
    Vinciguerra C, Zawadsky C, Macchi L, Dargaud Y, Negrier C. Three abnormal patterns for inversion breaking intron 1 of the FVIII gene. J Thromb Haemost 2003; 1(Suppl. 1): OC128.
  • 17
    David D, Moreira I, Lalloz MR et al. Analysis of the essential sequences of the factor VIII gene in twelve haemophilia A patients by single-stranded conformation polymorphism. Blood Coagul Fibrinolysis 1994; 5: 25764.
  • 18
    Vidal F, Farssac E, Altisent C, Puig L, Gallardo D. Rapid hemophilia A molecular diagnosis by a simple DNA sequencing procedure: identification of 14 novel mutations. Thromb Haemost 2001; 85: 5803. Erratum in: Thromb Haemost 2001; 86: 727.
  • 19
    Ganguly A, Rock MJ, Prockop DJ. Conformation sensitive gel electrophoresis for rapid detection of single base differences in double-stranded PCR products and DNA fragments: Evidence for solvent-induced bends in DNA heteroduplexes. Proc Natl Acad Sci USA 1993; 90: 1032529. Erratum in: Proc Natl Acad Sci USA 1994; 91: 5217.
  • 20
    Williams IJ, Abuzenadah A, Winship PR et al. Precise carrier diagnosis in families with haemophilia A: use of conformation sensitive gel electrophoresis for mutation screening and polymorphism analysis. Thromb Haemost 1998; 79: 7236.
  • 21
    Oefner PJ, Underhill PA. Comparative DNA sequence by denaturing high performance liquid chromatography (DHPLC). Am J Hum Genet 1995; 57: A266.
  • 22
    Oldenburg J, Ivaskevicius V, Rost S, Fregin A, White K, Holinski-Feder E, Muller CR, Weber BH. Evaluation of DHPLC in the analysis of hemophilia A. J Biochem Biophys Methods 2001; 47: 3951.
  • 23
    Waseem NH, Bagnall R, Green PM, Giannelli F. Haemophilia Centres. Start of UK confidential haemophilia A database: analysis of 142 patients by solid phase fluorescent chemical cleavage of mismatch. Thromb Haemost 1999; 81: 9005.
  • 24
    Oldenburg J, Ananyeva NM, Saenko EL. Molecular basis of haemophilia A. Haemophilia 2004; 10: 1339.
  • 25
    Spiegel PC, Murphy P, Stoddard BL. Surface-exposed hemophilic mutations across the factor VIII C2 domain have variable effects on stability and binding activities. J Biol Chem 2004; 279: 536918.
  • 26
    Jacquemin M, De Maeyer M, D'Oiron R, Lavend'Homme R, Peerlinck K, Saint-Remy JM. Molecular mechanisms of mild and moderate hemophilia A. J Thromb Haemost 2003; 1: 45663. Erratum in: J Thromb Haemost 2003; 1: 2722.
  • 27
    Klopp N, Oldenburg J, Uen C, Schneppenheim R, Graw J. 11 hemophilia A patients without mutations in the factor VIII encoding gene. Thromb Haemost 2002; 88: 35760.
  • 28
    El-Maarri O, Herbiniaux U, Graw J et al. Analysis of mRNA in hemophilia A patients with undetectable mutations reveals normal splicing in the factor VIII gene. J Thromb Haemost 2005; 3: 3329.
  • 29
    Lalloz MR, McVey JH, Pattinson JK, Tuddenham EG. Haemophilia A diagnosis by analysis of a hypervariable dinucleotide repeat within the factor VIII gene. Lancet 1991; 338: 20711.
  • 30
    Lalloz MR, Schwaab R, McVey JH, Michaelides K, Tuddenham EG. Haemophilia A diagnosis by simultaneous analysis of two variable dinucleotide tandem repeats within the factor VIII gene. Br J Haematol 1994; 86: 8049.
  • 31
    Noble JS. In: AutomatedGenotyping In DiagnosisElles R, ed. Methods in Molecular Medicine: Molecular Diagnosis of Genetic Diseases. Totowa, NJ: Humana Press Inc., 1996.
  • 32
    Kogan SC, Doherty M, Gitschier J. An improved method for prenatal diagnosis of genetic diseases by analysis of amplified DNA sequences. Application to hemophilia A. New Engl J Med 1987; 317: 98590.
  • 33
    Graham JB, Kunkel GR, Fowlkes DM, Lord ST. The utility of a HindIII polymorphism of factor VIII examined by rapid DNA analysis. Br J Haematol 1990; 76: 759.
  • 34
    Kogan S, Gitschier J. Mutations and a polymorphism in the FVIII gene discovered by denaturing gradient gel electrophoresis. Proc Natl Acad Sci USA 1990; 87: 20926.
  • 35
    Bowen DJ, De Brasi CD, Larripa IB, Collins PW. A new polymorphism in the human factor VIII gene: implications for linkage analysis in haemophilia A and for the evolution of int22h sequences. Br J Haematol 2000; 111: 5448.
  • 36
    El-Maarri O, Oldenburg J, Caglayan SH. Intron 22-specific long PCR for the Xba I polymorphism in the factor VIII gene. Br J Haematol 1999; 105: 11202.
  • 37
    De Brasi CD, Bowen DJ, Collins PW, Larripa IB. Specific analysis of the intron 22 XbaI polymorphism of the human factor VIII gene using long-distance PCR. Br J Haematol 1999; 107: 5668.
  • 38
    Peake IR, Lillicrap DP, Boulyjenkov V et al. Report of a joint WHO/WFH meeting on the control of haemophilia: carrier detection and prenatal diagnosis. Blood Coagul Fibrinolysis 1993; 4: 31344. Erratum in: Blood Coagul Fibrinolysis 1994; 5: 148.
  • 39
    Gitschier J, Wood WI, Goralka TM et al. Characterization of the human factor VIII gene. Nature 1984; 312: 32630.
  • 40
    Gille JJ, Hogervorst FB, Pals G et al. Genomic deletions of MSH2 and MLH1 in colorectal cancer families detected by a novel mutation detection approach. Br J Cancer 2002; 87: 8927.
  • 41
    Leuer M, Oldenburg J, Lavergne JM et al. Somatic mosaicism in hemophilia A: a fairly common event. Am J Hum Genet 2001; 69: 7587.
  • 42
    Mazurier C, Dieval J, Jorieux S, Delobel J, Goudemand M. A new von Willebrand factor (vWF) defect in a patient with factor VIII (FVIII) deficiency but with normal levels and multimeric patterns of both plasma and platelet vWF. Characterization of abnormal vWF/FVIII interaction. Blood 1990; 75: 206.
  • 43
    Gaucher C, Jorieux S, Mercier B, Oufkir D, Mazurier C. The ‘‘Normandy’’ variant of von Willebrand disease: characterization of a point mutation in the von Willebrand factor gene. Blood 1991; 77: 193741.
  • 44
    Nesbitt IM, Goodeve AC, Guilliatt AM, Makris M, Preston FE, Peake IR. Characterisation of type 2N von Willebrand disease using phenotypic and molecular techniques. Thromb Haemost 1996; 75: 95964.
  • 45
    Goodeve AC. Laboratory methods for the genetic diagnosis of bleeding disorders. Clin Lab Haematol 1998; 20: 319.
  • 46
    Goodeve AC, Peake IR. Diagnosis of haemophilia A carriers and prenatal diagnosis. In: ForbesCD, AledortL, MadhokR, eds. Hemophilia. London: Chapman & Hall, 1997: 6374.