SEARCH

SEARCH BY CITATION

Keywords:

  • haem oxygenase-1;
  • monocyte;
  • systemic lupus erythematosus

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Disclosures
  9. References
  10. Supporting Information

Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by multiple functional alterations affecting immune cells, such as B cells, T cells, dendritic cells (DCs) and monocytes. During SLE, the immunogenicity of monocytes and DCs is significantly up-regulated, promoting the activation of self-reactive T cells. Accordingly, it is important to understand the contribution of these cells to the pathogenesis of SLE and the mechanisms responsible for their altered functionality during disease. One of the key enzymes that control monocyte and DC function is haem oxygenase-1 (HO-1), which catalyses the degradation of the haem group into biliverdin, carbon monoxide and free iron. These products possess immunosuppressive and anti-inflammatory capacities. The main goal of this work was to determine HO-1 expression in monocytes and DCs from patients with SLE and healthy controls. Hence, peripheral blood mononuclear cells were obtained from 43 patients with SLE and 30 healthy controls. CD14+ monocytes and CD4+ T cells were sorted by FACS and HO-1 expression was measured by RT-PCR. In addition, HO-1 protein expression was determined by FACS. HO-1 levels in monocytes were significantly reduced in patients with SLE compared with healthy controls. These results were confirmed by flow cytometry. No differences were observed in other cell types, such as DCs or CD4+ T cells, although decreased MHC-II levels were observed in DCs from patients with SLE. In conclusion, we found a significant decrease in HO-1 expression, specifically in monocytes from patients with SLE, suggesting that an imbalance of monocyte function could be partly the result of a decrease in HO-1 expression.


Abbreviations:
APC

allophycocyanin

DCs

dendritic cells

FcγR

Fcγ receptor

GM-CSF

granulocyte–macrophage colony-stimulating factor

HO-1

haem oxygenase-1

IFN

interferon

IL-4

interleukin-4

LPS

lipopolysaccharide

PBMC

peripheral blood mononuclear cells

PE

phycoerythrin

PerCP

peridinin chlorophyll protein complex

SEA

staphylococcal enterotoxin A

SLE

systemic lupus erythematosus

Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Disclosures
  9. References
  10. Supporting Information

Systemic lupus erythematosus (SLE) is a chronic autoimmune disease of unknown aetiology, characterized by, among other findings, the presence of autoantibodies against double-stranded DNA, nucleosomes, ribonucleoproteins and other nuclear components, as well as by the presence of circulating DNA and nucleosomes in peripheral blood.1–3 Multi-organ compromise may arise as a consequence of the deposition of immune complexes in blood vessels, which leads to macrophage and complement activation, inflammation and tissue damage.4–7 Abnormalities in almost every component of the immune system have been described in patients with SLE and in mouse models of SLE, including the presence of activated autoreactive CD4+ T cells that drive the subsequent activation of self-reactive B cells, leading to the production of autoantibodies.8–10 In addition, peripheral blood monocytes derived from patients with SLE display an abnormal phenotype, characterized by deregulated expression of HLA-DR and CD14, which could lead to defects in antigen presentation by monocyte-derived antigen-presenting cells, such as dendritic cells (DCs) or macrophages.11,12 These alterations are likely to contribute to autoreactive T-cell priming during the onset of SLE.12–15 Accordingly, expression of co-stimulatory molecules that are essential for T-cell activation, such as CD86, is significantly increased in monocytes and DCs from patients with SLE, compared with healthy individuals.16 We have previously shown that monocyte-derived DCs from patients with SLE display higher expression ratios of activating over inhibitory Fcγ receptors (FcγRs), promoting the presentation of autoantigens derived from immune complexes to previously activated self-reactive T cells and perpetuating T-cell activation.17 Hence, an unbalanced expression of activator/inhibitory molecules in monocytes and DCs could contribute to maintaining SLE pathogenesis.17,18

Haem oxygenases (HO) are microsomal enzymes that catalyse the degradation of the haem group into biliverdin, free iron and carbon monoxide (CO).19 Biliverdin is rapidly reduced to bilirubin by the enzyme biliverdin reductase and free iron is removed by ferritin, which produces a depletion in the intracellular free iron.20 Until now, three HO isoforms have been described and designated HO-1, HO-2 and HO-3.21–24 HO-1 is the only inducible stress-responsive isoform of which the expression is induced by a variety of stimuli including haem, heavy metals, inflammatory cytokines and nitric oxide, acting as a cytoprotective protein.20,25 Biliverdin and its metabolite, bilirubin, are known for their antioxidant and immunosuppressive capacity.26,27 In addition, CO has been shown to down-modulate immune responses in a variety of physiological and pathophysiological processes and it is thought to mediate most of the immunomodulatory effects of HO-1.28,29 In humans, HO-1 has been shown to be expressed in several immune cells, including DCs and monocytes.30,31 In these cells, HO-1 expression has been related to inmunosuppressive and anti-apoptotic functions.30,31 Moreover, there is an increase in HO-1 expression in monocytes during acute inflammatory diseases, which could serve as a potent anti-inflammatory stimulus to control excessive cell or tissue injury.32 Hence, HO-1 expression in monocytes and DCs could contribute to down-modulating immune inflammation. Therefore, it is possible that a decrease in HO-1 expression could exacerbate immune responses, enhancing susceptibility to developing autoimmune diseases, such as SLE.24

Here, we have evaluated HO-1 expression in monocytes, CD4+ T cells and DCs from patients with SLE and healthy donors. Our data show that HO-1 expression is significantly reduced in monocytes from patients with SLE, compared with healthy donors. No significant differences in HO-1 expression were observed in DCs or CD4+ T cells from patients, compared with healthy controls. Despite reduced expression of HO-1 in patients with SLE, the expression level did not significantly correlate with disease activity. These data suggest that HO-1 deregulation may be involved during the initial steps of SLE development contributing to a general mechanism for tolerance breaking, rather than participating in the progression of disease. Taken together, these observations underscore a potential role of HO-1 in monocyte function and SLE onset.

Material and methods

  1. Top of page
  2. Summary
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Disclosures
  9. References
  10. Supporting Information

Antibodies and reagents

Fluorescein isothiocyanate-conjugated anti-human/mouse HO-1 monoclonal antibody (clone 13248) was purchased from Abcam (Cambridge, UK). Phycoerythrin (PE) -conjugated anti-CD11c (clone B-ly6), anti-CD14 (clone M5E2), IgG-γ1 isotype control, allophycocyanin (APC) -conjugated anti-CD4 (clone RPA-T4), peridinin chlorophyll protein complex (PerCP) -conjugated anti-CD69 (clone L78), PE-conjugated anti-interleukin-2 (IL-2) (clone MQ1-17H12), FITC-conjugated CD25 (clone M-A251), anti-mouse CD11c-APC (clone HL3), anti-mouse CD11b-PE (clone M1/70) and anti-mouse CD4-FITC (clone H129.19) were all purchased from Becton Dickinson (San Jose, CA). Recombinant human IL-4 and human granulocyte–macrophage colony-stimulating factor (GM-CSF) were purchased from Prospec-Tany Technogene Ltd (Rehovot, Israel). Staphylococcal enterotoxin A (SEA) was purchased from Sigma (St Louis, MO).

Patients

To assess HO-1 levels in monocytes, 43 non-selected patients with SLE who fulfilled the American College of Rheumatology criteria for SLE33 were recruited at Hospital Clínico de la Pontificia Universidad Católica de Chile. Exclusion criteria were pregnancy, patients undergoing dialysis or who were severely ill, such as those in the intensive-care unit or who were haemodynamically unstable, patients with infections and patients with drug-induced leucopenia or anaemia. Patient characteristics, including immunosuppressive medications and prednisone dose, are summarized in Table 1. Healthy donors (= 31) matched by age and sex were included as controls. In both groups, 90% were women and the average ages were 36·1 ± 12·2 and 32·1 ± 9·1 years in the patients with SLE and healthy controls, respectively. In addition, 16 patients with rheumatoid arthritis and five kidney-transplanted patients, undergoing similar immunosuppressive treatment to the patients with SLE, were included as controls (average ages 59·6 ± 10·41 and 45·4 ± 10·6 years, respectively). Further details regarding patient characteristics and specific medications including prednisone dose are shown in Tables 2 and 3 for patients with rheumatoid arthritis and transplanted patients, respectively. For additional experiments, including T-cell activation after SEA stimulation, an additional 31 patients with SLE with similar characteristics and treatments were evaluated. Each patient signed an informed consent form before enrolling in the study, in accordance with the regulations of the Ethics Committee from the School of Medicine of the Pontificia Universidad Católica, and the study was performed in accordance with the Declaration of Helsinki as emended in Edinburgh (2000). The SLE activity was assessed using the Systemic Lupus Erythematosus Activity Index (SLEDAI) 2K.

Table 1.   Clinical data from patients with systemic lupus erythematosus (SLE) included in the study
PatientGenderAge (years)SLEDAI 2KTreatmentArthritisImmuneCNSKidneyHaematologicalSerositisMucocutaneous*Antinuclear antibodies
  1. Forty-three non-selected patients with SLE that fulfilled the American College of Rheumatology criteria for SLE were included in this study. Exclusion criteria were pregnancy, patients undergoing dialysis or who were severely ill, such as those in the intensive care unit or who were haemodynamically unstable, patients with infections and patients with drug-induced leucopoenia or anaemia.

  2. AZT, azathioprine; MMF, mycophenolate mofetil; PDN, prednisone; HCQ, hydroxychloroquine; CQ, chloroquine; CYT, cyclophosphamide.

  3. Mean prednisone dose = 10·97 mg/day (range 5–40 mg/day).

  4. *Mucocutaneous manifestations include photosensibility, malar rash, oral and nasal ulcers and discoid rash.

SLE1F214HCQ, PDN++++
SLE2F2114AZT++ ++
SLE3F194HCQ, PDN+++++
SLE4F4716HCQ, PDN++++
SLE5F2014PDN++++
SLE6F512++++
SLE7F312AZT, HCQ++++
SLE8F224PDN, HCQ+++++
SLE9F360HCQ+++++
SLE10F324PDN+++++
SLE11F422MMF, HCQ, PDN+++++
SLE12F296PDN, HCQ++++
SLE13F401HCQ, PDN, MMF+++++++
SLE14F440HCQ, PDN+++
SLE15F454++++
SLE16F514HCQ, PDN+++++
SLE17F254PDN, AZT, HCQ-++++
SLE18F2110HCQ, PDN+++++
SLE19F424HCQ, PDN++++
SLE20F378HCQ, PDN++++
SLE21F335HCQ, PDN++++
SLE22F410PDN++++++
SLE23F412PDN, AZT, HCQ++++
SLE24F582PDN, AZT, HCQ+++++
SLE25M2312PDN, HCQ, CYT+++++
SLE26F278AZT, PDN, HCQ+++++
SLE27F194AZT, PDN, HCQ++++
SLE28F3012MMF, PDN+++++
SLE29F404PDN++++
SLE30F254AZT, PDN, HCQ+++
SLE31F2919PDN, HCQ+++
SLE32F3218PDN, HCQ++++
SLE33F452PDN, HCQ, MMF+++++
SLE34F274PDN, HCQ++++
SLE35F504PDN, HCQ++++
SLE36F450HCQ+++
SLE37M198PDN, HCQ++++
SLE38F362PDN, CQ+++++
SLE39F324PDN, HCQ++++
SLE40F344PDN, CYT++++
SLE41F394PDN, HCQ+++++
SLE42F482PDN, AZT++++
SLE43F6212PDN, HCQ++++
Table 2.   Clinical data from patients with rheumatoid arthritis included in the study
PatientGenderAgeMedications
  1. Sixteen non-selected patients with rheumatoid arthritis that fulfilled the American College of Rheumatology criteria for rheumatoid arthritis were included in this study.

  2. PDN, prednisone; MTX, methotrexate; LFN, leflunomide; HCQ, hydroxychloroquine.

  3. Prednisone mean dose: 8·2 mg/day (range 5–30 mg/day).

AR1F65PDN; MTX; LFN; AZF
AR2F57PDN; MTX
AR3F45PDN; MTX
AR4F73PDN; MTX
AR5F56PDN; MTX; HCQ
AR6F60PDN; MTX
AR7F54PDN
AR8F77PDN
AR9F50PDN; LFN
AR10F48PDN; LFN
AR11F63PDN; MTX
AR12F54PDN; MTX
AR13M46PDN; MTX
AR14F60PDN; MTX; LFN
AR15F34PDN; HCQ
AR16F68PDN; MTX; LFN
Table 3.   Clinical data from kidney-transplanted patients included in the study
Transplanted patientSexAgeMedications
  1. Five kidney-transplanted patients undergoing similar immunosuppressive treatment to the patients with systemic lupus erythematosus, were included.

  2. PDN, Prednisone; CCP, Cyclosporine; MMF, Mycophenolate Mofetil; TC, Tacrolimus; EV, Everolimus.

  3. Prednisone mean dose: 8·75 mg/day (range 5–15 mg/day).

TP1F41PDN; CCP
TP2M63PDN; CCP; MMF
TP3F35PDN; CCP
TP4M44PDN; CCP; EV
TP5F44PDN; MMF; TC

Generation of monocyte-derived DCs

Peripheral blood mononuclear cells (PBMCs) were separated from whole blood using the standard Ficoll centrifugation method. Monocytes were obtained using the adherence method.34 Briefly, PBMCs (3 × 106 cells/ml) were incubated in serum-free X-VIVO-15 medium (Bio-Whittaker, Walkersville, MD) supplemented with 1% autologous serum and 50 μg/ml gentamycin (Calbiochem, San Diego, CA) (DC-medium) for 2 hr at 37°. Adherent cells were washed four times with pre-warmed serum-free X-VIVO-15 medium (Bio-Whittaker) and were then cultured in DC-medium at 37°. Monocytes were differentiated to DCs over 5 days by the addition of 1000 U/ml IL-4 and 1000 U/ml GM-CSF on days 0, 2 and 4. Maturation of the DCs was triggered by the addition of lipopolysaccharide (LPS; 5 μg/ml) for an additional 48 hr. The DC immune-phenotypes were confirmed by flow cytometry using specific monoclonal antibodies against surface markers.

Immunostaining

Cells were washed with PBS, re-suspended at 2 × 106 cells/ml (50 μl/tube) and incubated with FITC-conjugated, PE-conjugated and APC-conjugated antibodies for 30 min at 4°. The isotype-matched antibodies conjugated with FITC, PE and APC were used as controls. For HO-1 intracellular staining, cells were stained with FITC-conjugated anti-HO-1 in permeabilization buffer (PBS/BSA 3%/saponin 0·5%) overnight. Cells were washed with PBS, fixed with 1% formaldehyde in PBS and analysed using a FACSCalibur flow cytometer (BD Biosciences, San Jose, CA). A mouse IgG2b FITC-conjugated antibody was used as an isotype control for unspecific intracellular staining (BD Biosciences). Splenic CD11c+ DCs, CD11b+ macrophages/monocytes and CD4+ T cells from C57BL/6J FcγRIIb−/− and C57BL/6 mice at 1 year old were stained either with anti-mouse CD11c-APC, anti-CD11b-PE or anti-mouse CD4-APC antibodies. After surface staining, cells were fixed (PBS/formaldehyde 1%) and incubated with FITC-conjugated anti-HO-1 antibody in permeabilization buffer overnight. Cells were then washed and fixed in PBS/formaldehyde 1%. The expression of surface markers and HO-1 was determined by FACS.

Isolation of CD4+ T cells and CD14+ monocytes

The PBMCs obtained after Ficoll separation were stained with PE-conjugated and APC-conjugated monoclonal antibodies against CD14 and CD4, respectively, for 30 min at 4°. Staining for both CD14 and CD4 allowed clear separation of populations and minimized cross-contamination. After incubation with antibody conjugates for 20 min on ice, cells were washed twice in PBS/1% BSA and sorted using a FACSAria II (Becton Dickinson). Purity of CD4+ and CD14+ cells was always higher than 95% after sorting.

Real-time RT-PCR

RNA from CD4+ and CD14+ sorted population and PBMCs stimulated for 24 hr with 1 μg/ml LPS, 3 μg/ml methyl prednisolone and Cobalt-Protoporphyrin 1 μm, were extracted using Trizol (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. Reverse transcription PCR and cDNA synthesis were performed using random primers (ImProm-II; Promega, Madison, WI). Real-time PCR reactions were carried out using a Strategene Mx300P thermal cycler. Briefly, cDNAs amplified out of total RNA from CD4+ and CD14+ cells, were tested for amplification of HO-1 using the following primers (5′–3′): forward AGGCAGAGGGTGATAGAAGAGG, and reverse TGGGAGCGGGTGTTGAGT. The PCR amplification of glyceraldehyde 3-phosphate dehydrogenase (GADPH) or hypoxanthine phosphoribosyltransferase (HPRT) was used as an internal control. To corroborate amplification specificity, PCR products were subjected to a melting curve program. Abundance of HO-1 mRNA was determined from standard curves (correlation coefficient ≥ 0·98). Results were expressed as the ratio of the HO-1 amount relative to the amount of GADPH or HPRT for each sample, determined in duplicate experiments.

Superantigen stimulation assays

The PBMCs were seeded at 106 cells per well and incubated with SEA for 36 hr. In some experiments, PBMCs were incubated with SEA (50 nm) and stained with APC-conjugated anti-CD4, PerCP-conjugated anti-CD69, PE-conjugated anti-IL-2 (permeabilized) and FITC-conjugated anti-CD25. The PBMCs were also incubated with different SEA concentrations (0·16 pm to 1 μm) for 36 hr and stained with APC-conjugated anti-CD4 and PerCP-conjugated anti-CD69.

Data analysis

Data and statistical analyses were performed using prism 4 software (Graph Pad Software, Inc., San Diego, CA). For statistical analyses, Student’s t-test was used. P-values below 0·05 were considered statistically significant. Correlation analyses were performed using the Pearson correlation test with a confidence interval of 95%. Flow cytometry data were analysed using WinMDI 2.9 (http://facs.scripps.edu/software.html).

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Disclosures
  9. References
  10. Supporting Information

Monocytes from patients with SLE display altered HO-1 expression

Because HO-1 contributes to enhancing the tolerogenic properties of immune cells,35 expression of this enzyme was evaluated by flow cytometry in CD14+ monocytes, CD11c+ cells and CD4+ T cells in PBMCs from 14 patients with SLE (patients 1–14, Table 1), and 12 healthy donors. As shown in Fig. 1, HO-1 expression was significantly down-regulated in CD14+ monocytes but not in CD11c+ or CD4+ T cells from patients with SLE when compared with healthy donors (Fig. 1a–c; P < 0·03, unpaired t-test). Interestingly, when HO-1 levels were analysed in DCs differentiated from circulating monocytes using human recombinant GM-CSF and IL-4, no significant differences in HO-1 expression between SLE patients and healthy controls were observed (see Supplementary material, Fig. S1). Moreover, LPS treatment of monocyte-derived DCs from patients with SLE had no significant effect on HO-1 expression (data not shown). To further evaluate HO-1 expression in patients with SLE, we assessed HO-1 surface levels in CD14+, CD11c+ and CD4+ cells from patients with SLE. HO-1 surface expression was very low in all these cell types, which is consistent with the notion that HO-1 is mainly located in the intracellular space (see Supplementary material, Fig. S2).

image

Figure 1.  Reduced haem oxygenase 1 (HO-1) expression in monocytes from patients with systemic lupus erythematosus (SLE). Peripheral blood mononuclear cells (PBMCs) from patients with SLE and from healthy controls were labelled with anti-CD4, anti-CD11c and anti-CD14 monoclonal antibodies, permeabilized and stained with an anti-HO-1 monoclonal antibody or isotype control. Cells were analysed by flow cytometry and representative histograms for the expression of HO-1 on monocytes (CD14+) (a), dendritic cells (CD11c+) (b) and lymphocytes (CD4+) (c) are shown. Solid histograms indicate healthy controls; black-line histograms indicate patients with SLE. Graphs show the relative geometric mean intensity (Geo mean) for HO-1 expression measured by FACS on cells derived from 14 patients with SLE and 12 healthy controls for monocytes (CD14+) (d), dendritic cells (CD11c+) (e) and lymphocytes (CD4+) (f). Data shown are means ± standard error of the mean (SEM). *P < 0·05, **P < 0·01 by Student’s t-test.

Download figure to PowerPoint

To better characterize the phenotype of CD14+ monocytes and CD11c+ cells from patients with SLE, the surface expression of MHC class II and CD86 in these cells was evaluated. No significant differences for the expression of these molecules were observed for CD14+ when compared with healthy controls. On the contrary, CD11c+ cells from patients with SLE showed lower expression of MHC class II than healthy individuals (see Supplementary material, Fig. S3).

In addition, to evaluate the immunogenic capacity of monocytes, T-cell activation assays were performed on PBMC cultures in response to stimulation with SEA (50 nm). No significant differences in T-cell activation parameters, such as IL-2 production, expression of CD25 or CD69, were observed between patients with SLE and healthy controls (Fig. 2a–d). Similar data were obtained when dose–response curves were performed (Fig. 2e).

image

Figure 2.  Stimulation of T cells from peripheral blood mononuclear cells (PBMCs) after staphylococcal enterotoxin A (SEA) stimulation. The PBMCs from six patients with systemic lupus erythematosus (SLE) and five healthy controls were stimulated with SEA 50 nm. After 36 h, cells were stained with anti-CD4, permeabilized and stained with anti-interleukin-2 (IL-2) monoclonal antibody. Cells were also stained with anti-CD25 and anti-CD69 and analysed using flow cytometry. Graphs show the percentage of IL-2+ (a), CD25+ (b) and CD69+ (c) cells from CD4+ cells measured by FACS. Representative density plots for the expression of IL-2, CD25 and CD69 (d) are shown. Dose response curve of SEA (0·16 pm to 1 μm) measured by CD69+ CD4+ cells (e) from patients with SLE and healthy controls showing non-significant differences. *P < 0·05, **< 0·01, ***< 0·001 by unpaired Student’s t-test.

Download figure to PowerPoint

Further, HO-1 expression was also analysed on immune cells from 16 patients with rheumatoid arthritis (see Supplementary material, Fig. S4). Patient information, including medications and demographics, is shown in Table 2. Interestingly, HO-1 levels in monocytes and CD11c+ cells from patients with rheumatoid arthritis were decreased compared with healthy controls, indicating that our findings could be extrapolated to other chronic autoimmune conditions.

HO-1 mRNA transcripts are diminished in monocytes derived from SLE patients

To specifically evaluate the levels of HO-1 mRNA transcripts in purified monocytes and T cells, CD4+ and CD14+ cells were separated by cell sorting from PBMCs obtained from 29 additional patients with SLE and 22 more healthy controls. HO-1 mRNA levels were determined by semi-quantitative real-time RT-PCR. We focused on CD4+ T cells rather than total CD3+ T cells because CD4+ T cells are the main T-cell subset expressing HO-1.36 A significant decrease in HO-1 mRNA levels was observed in monocytes from patients with SLE (P = 0·0075, unpaired t-test) compared with healthy donors matched by sex and age (Fig. 3). In contrast, no significant differences between patients with SLE and healthy donors were seen when mRNA from CD4+ T cells was analysed (P = 0·95) (Fig. 3). To evaluate whether the immunosuppressive treatment of patients with SLE was altering the HO-1 levels in immune cells, we performed an additional experiment including five kidney-transplanted patients treated with immunosuppressive drugs. Our results showed similar levels of HO-1 transcripts in monocytes and CD4+ T cells from patients who had received kidney transplants and healthy controls (see Supplementary material, Fig. S5). These data are consistent with the notion that the decrease in HO-1 levels observed in patients with SLE was not the result of the immunosuppressive treatment, and was rather a specific phenomenon associated to SLE. In conclusion, HO-1 mRNA levels were diminished in monocytes but not T helper cells from patients with SLE.

image

Figure 3.  Haem oxygenase 1 (HO-1) mRNA levels are diminished in monocytes from patients with systemic lupus erythematosus (SLE). Peripheral blood mononuclear cells (PBMCs) obtained from blood samples of patients with SLE and healthy controls were labelled with anti-CD4 and anti-CD14 monoclonal antibodies and sorted as described in Materials and methods. The mRNA was purified from the isolated cell populations and HO-1 levels were evaluated by real-time PCR. HO-1 transcripts on CD14+ (a) or CD4+ (b) cells from 29 patients with SLE and 22 healthy controls were analysed. Glyceraldehyde 3-phosphate dehydrogenase (GADPH) was used as a housekeeper normalizing control. PBMCs obtained from blood samples of patients with SLE and healthy controls were stimulated with 1 μg/ml lipopolysaccharide (LPS), 3 μg/ml metal prednisolone, 1 μm de Cobalt Protoporphyrin (CoPP). RNA was extracted with Trizol. (c) HO-1 mRNA levels were analysed by real-time PCR. Hypoxanthine phosphoribosyltransferase (HPRT) was used as a housekeeper normalizing control. *P < 0·05, **< 0·01, ***< 0·001 by unpaired Student’s t-test.

Download figure to PowerPoint

To better address the contribution of HO-1 expression to SLE onset and pathogenesis, we measured HO-1 levels in DCs, macrophages/monocytes and CD4+ T cells from C57BL/6 FcγRIIb knockout mice, which spontaneously develop a lupus-like autoimmune syndrome by 4–6 months of age.37 We observed that DCs, macrophages/monocytes and T cells from 1-year-old FcγRIIb knockout mice displayed significantly lower HO-1 expression levels than did age-matched C57BL/6 control mice (P < 0·05 unpaired t-test, see Supplementary material, Fig. S6). These data suggest that HO-1 down-regulation could be involved in the onset of SLE in FcγRIIb knockout mice.

Furthermore, as mentioned in the Materials and methods section, patients with SLE and those who had received transplants were taking equivalent doses of prednisone throughout the study. A possible direct effect of medication in HO-1 expression was evaluated in vitro by treating PBMCs with methyl prednisolone for 24 hr. As shown in Fig. 3, no significant differences in HO-1 mRNA levels were caused by steroid treatment. As seen in monocyte-derived DCs, LPS stimulation of PBMCs derived from healthy controls and from patients with SLE had no significant effect on HO-1 expression. Cobalt Protoporphyrin was included as an HO-1 mRNA inducer.

Altered HO-1 expression in monocytes does not correlate with SLE activity

To better understand the role of the HO-1 in SLE pathogenesis, we evaluated whether the reduced levels of HO-1 expression were associated with disease activity. To address this question, we determined the correlation between the levels of mRNA HO-1 transcripts and the SLE disease activity index (SLEDAI-2K), in our lupus cohort. As shown in Fig. 4, HO-1 transcript levels do not correlate with the SLEDAI-2K score, (r = −0·24, P = 0·12, Pearson’s correlation test). We also evaluated whether there was a correlation between HO-1 levels and key parameters of the disease, such as anti-DNA antibody levels, anti-Ro antibody levels and complement levels. However, no significant correlation was observed between HO-1 transcript levels and any of the parameters measured (data not shown). In addition, when HO-1 protein levels and SLEDAI-2K were plotted, no significant correlation was observed (data not shown). In addition, the dose of prednisone was also included among the parameters evaluated and no significant correlation was found (data not shown).

image

Figure 4.  Haem oxygenase-1 (HO-1) expression in monocytes from patients with systemic lupus erythematosus (SLE) does not correlate with SLE Disease Activity Index (SLEDAI). For each of the 29 patients evaluated by real-time PCR, the SLEDAI was plotted relative to the HO-1 transcript amount measured for CD14+ cells. Statistical analyses shown are Pearson’s tests (r = −0·24).

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Disclosures
  9. References
  10. Supporting Information

The anti-inflammatory role of HO-1 has been widely reported in several disease processes.38–40 The relevance of HO-1 as an immunomodulator has been suggested by studies showing that HO-1 knockout mice display an exacerbated immune response and high levels of pro-inflammatory T helper type 1 cytokines.41,42 In addition, HO-1 has been involved in the modulation of the function of several cell types of the immune system, such as DCs, T cells and monocytes.30,32,43 However, to our knowledge, the role of HO-1 during SLE pathogenesis has not been previously evaluated. Therefore, here we have measured the levels of HO-1 in different subsets of immune cells obtained from peripheral blood of patients with SLE, to define HO-1 as a relevant molecule in the aetiology of the disease, as well as a potential therapeutic target for treating this autoimmune disease.

Our results show that HO-1 transcripts and protein levels are significantly reduced in monocytes from patients with SLE, compared with healthy controls. These differences are specific for this particular cell population, because no significant differences were found in DCs or T cells. Our results suggest an unbalanced monocyte function linked to reduced HO-1 activity in SLE. These findings could not only impair the tolerogenic capacity of monocytes, but also enhance their immunogenicity. As a result of these alterations, monocytes with low HO-1 expression could contribute to the autoimmune deregulation associated with SLE. Although monocytes from SLE patients did not show an increase in antigen-presenting activity in SEA assays, it is possible that the previously described defective T-cell function for these patients could account for this result. Moreover, the results obtained in DCs from FcγRIIb knockout mice strongly suggest that HO-1 down-regulation could be a key step in the promotion of autoimmunity.

Several studies have shown that monocytes obtained from patients with SLE can display altered functionality.12,44 Low levels of surface HLA-DR11 and CD80 expression45 have been observed in monocytes from patients with SLE, which could affect differentiation flexibility, antigen processing or cytokine production, and so affect T-cell activation. Interestingly, HO-1 expression can modulate monocyte function by regulating the production of pro-inflammatory cytokines.32 Accordingly, during acute inflammatory states there is an increase in HO-1 expression on monocytes, leading to an anti-inflammatory response.32 It is likely that a reduction in HO-1 expression in monocytes from patients with SLE compared with healthy controls could trigger an aberrant function in this population, contributing to the inflammation occurring in this disease. Consistent with this notion is the observation that monocytes from patients with SLE are less responsive to the immunosuppressive effect of IL-10 in the presence of immune complexes.44 As the mechanisms involved in the IL-10 response by monocytes depend on HO-1 activity,46 our results could in part explain why monocytes from patients with SLE are resistant to IL-10. Further research is necessary to conclusively address this question.

In spite of the differences in HO-1 expression found in monocytes, we could not find differences in HO-1 levels from monocytes-derived DCs of patients with SLE compared with healthy controls. Because DCs were generated after 5 days of differentiation with GM-CSF and IL-4, it is possible that during this time, normal HO-1 levels could be re-established on these cells. One possible explanation for the reduced expression of HO-1 found in patients with SLE could be the presence of high circulating levels of type 1 interferon (IFN) and IFN-γ in the blood of patients with SLE.47,48 There is evidence suggesting that HO-1 expression could be repressed by IFN-γ.49 Although no evidence suggests a similar effect of IFN-α on HO-1 expression, we could speculate that after 5 days of culture in media without these cytokines, HO-1 expression could be restored in DCs from patients with SLE. Further experiments would be needed to test this possibility.

Monocytes from patients with SLE have been shown to be impaired at clearing apoptotic cells.50 Reduced clearance of apoptotic cells might represent an important source of autoantigens with the potential of promoting the autoimmune process associated with SLE.51 In addition, a defective clearance of immune complexes could lead to their deposition in different organs triggering tissue damage.52 Remarkably, it has been demonstrated that increased HO-1 expression in circulating inflammatory cells enhances their phagocytic capacity.53 We can therefore speculate that the defect in the clearance of apoptotic cells by monocytes from patients with SLE could be in part explained by the reduced levels of HO-1, which could contribute to the initiation and maintenance of an immune response against autoantigens.

Several studies support the notion that HO-1 expression can be controlled at a transcriptional level.54 For example, the number of GT repeats, (GT)n, upstream from the transcription site was demonstrated to influence HO-1 expression, showing that longer (GT)n repeats are related with lower HO-1 transcriptional activity.55,56 Associations between the presence of shorter (GT)n repeats and less susceptibility to different autoimmune diseases have been reported.57,58 Consistent with this notion is the observation that patients with rheumatoid arthritis display higher ratios between longer (GT)n and shorter (GT)n repeats than do healthy patients and hence fewer HO-1 transcripts and less protein expression.59 Therefore, although we have only observed decreased HO-1 expression in monocytes from patients with SLE, it is possible that HO-1 microsatellite polymorphisms, such as (GT)n, could play a role in the expression of this enzyme. Further research is required to evaluate this hypothesis.

Although our results show a decrease in HO-1 levels on monocytes from patients with SLE, we could not detect a correlation between HO-1 levels and the SLEDAI in these patients. However, we observed that all of the six patients with the highest SLEDAI displayed low levels of HO-1 in their monocytes (Fig. 4). It is possible that the lack of correlation between disease activity and HO-1 levels could be the result of the small number of patients included and that most of them did not have a very active disease. Nevertheless, the fact that HO-1 expression remains low independent of the activity of the disease does not exclude this molecule as an interesting new therapeutic target for treating patients with SLE. Indeed, the chemical induction of HO-1 in MRL/MpJ-Faslpr (MRL/lpr) mice, an animal model of SLE, decreases the symptoms of disease in part by a reduction of nitric oxide synthase expression in the kidney and spleen and by a reduction in IFN-γ serum levels,60 supporting a potential use of HO-1 as a therapeutic target in patients with SLE.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Disclosures
  9. References
  10. Supporting Information

We would like to thank Dr Aquiles Jara and Sandra Vilches for providing blood samples from kidney-transplanted patients and to Ana Karina Jimenez for kindly coordinating the clinical visits and laboratory work of patients with SLE and healthy subjects. We also thank the generous collaboration of all the patients with SLE who participated in this study.

This work was supported by grants from FONDECYT 1085281, 1070352, 1110518, 3070018, ECOS-CONICYT C07S01, Biomedical Research Consortium and Millennium Institute on Immunology and Immunotherapy P04/030-F, IMBIO programme, l’Agence de la Biomédecine, Ministère de la Recherche, Fondation CENTAURE, Fondation Progreffe. AAH is a CONICYT fellow and AMK is a Chaire De La Région Pays De La Loire De Chercheur Étranger D’excellence.

Disclosures

  1. Top of page
  2. Summary
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Disclosures
  9. References
  10. Supporting Information

A patent application for the use of CO and HO-1 modulation to treat SLE has been submitted.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Disclosures
  9. References
  10. Supporting Information

Supporting Information

  1. Top of page
  2. Summary
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Disclosures
  9. References
  10. Supporting Information

Figure S1. Normal levels of HO-1 on monocyte-derived DCs from SLE patients.

Figure S2. Surface HO-1 expression in monocytes, lymphocytes and DCs from SLE patients.

Figure S3. Expression of MHCII and CD86 in monocytes from SLE patients.

Figure S4. Reduced HO-1 expression in monocytes and dendritic cells from RA patients.

Figure S5. HO-1 mRNA levels in Transplanted patients.

Figure S6. Altered HO-1 expression in monocytes, dendritic cells and T cells from FcγRIIb KO mice.

FilenameFormatSizeDescription
IMM_3598_sm_FigS1.tif218KSupporting info item
IMM_3598_sm_FigS2.tif642KSupporting info item
IMM_3598_sm_FigS3.tif953KSupporting info item
IMM_3598_sm_FigS4.tif414KSupporting info item
IMM_3598_sm_FigS5.tif218KSupporting info item
IMM_3598_sm_FigS6.tif753KSupporting info item

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.