SEARCH

SEARCH BY CITATION

Keywords:

  • juvenile hormone binding protein;
  • takeout;
  • starvation

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. References

A Bombyx EST cDNA database was searched using the Drosophila takeout gene and nine cDNAs were obtained. The homology search suggested that these genes are widespread in insects and organize a large gene family, and that they have hydrophobic ligands. A phylogenetic tree indicated that the genes are first divided into two large groups, juvenile hormone binding protein and other protein genes, and the latter group diversified within a short time at an early stage. The expression study of five Bombyx genes indicated that they are expressed in various tissues and are regulated by development and feeding conditions. The Bombyx genes might have roles related to the regulation of metabolism, growth or development related to nutritional conditions.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. References

Nutritional conditions in insects regulate intermediate metabolism, behaviour, growth and development via various humoral factors. Mobilization of lipids and carbohydrate energy stores from the fat body to peripheral tissues is regulated by nutritional conditions (Orchard & Loughton, 1985; Steele, 1985). Starvation activates the release of adipokinetic hormones, octopamine (Orchard & Loughton, 1985), and insulin-like growth factors (bombyxin) (Masumura et al., 2000) to mobilize energy stores (Siegert & Ziegler, 1983; Shapiro et al., 1988; Satake et al., 1997). The amino acid deprivation signal is detected at the fat body and is transduced to other tissues by some humoral factors (Colombani et al., 2003) to regulate growth and body size via insulin-like growth factors (Oldham & Hafen, 2003). Nutritional conditions also affect developmental programmes and determine the number of larval instars, possibly by regulating hormone secretion or the sensitivity to hormones (Nijhout & Williams, 1974; Nijhout, 1975; Kadono-Okuda et al., 1986). Thus, nutritional conditions control hormone-regulated insect metabolism, growth and development. The mechanisms underlying these functions, however, are not yet completely understood.

The Drosophila takeout gene is considered to have roles in sensing nutritional status and regulating metabolism and behaviour (Sarov-Blat et al., 2000). The takeout gene was discovered as a circadian-regulated gene and has similarity with juvenile hormone binding proteins (JHBPs) (So et al., 2000). takeout mRNA is expressed in head, cardia, crop and antennae, which are related to feeding (Sarov-Blat et al., 2000). takeout transcription is enhanced at night and by starvation, and the null mutants have aberrant locomotor activity and die rapidly in response to starvation, suggesting that takeout is involved in a circadian output pathway and regulation of energy metabolism and behaviour (Sarov-Blat et al., 2000). There is male-specific expression of takeout in the fat body of the head and it might be involved in courtship behaviour-related function (Dauwalder et al., 2002).

There are approximately 20 Drosophila takeout gene homologues (Sarov-Blat et al., 2000; So et al., 2000) and some of them have circadian-regulated expression (Lorenz et al., 1989; So et al., 2000), although their functions are unknown. Several proteins that have similarity with Takeout were studied in species other than Drosophila. mRNA expression of JP29 and Moling of Manduca sexta is development-dependent and specific to the feeding period of the epidermis (Palli et al., 1994; Du et al., 2003). Male-specific proteins, which have similarity with JHBP, were purified from Galleria and Schistocerca haemolymph (Wybrandt & Andersen, 2001; Han et al., 2003). The Schistocerca yellow protein binds carotenes and is suggested to have a role in transporting carotenes to the epidermis. Thus, the genes belonging to this family are found in several insect species and each insect species might have many genes of this family. These genes have been analysed individually from different points of view; the common function of the gene family, however, has not yet been defined and how the functions of each gene within a species are interrelated is not known.

In this study, to understand the functions of the gene family, we cloned Bombyx takeout/JHBP family genes and analysed: (1) the phylogenetic relationships among the family genes of insect species; (2) sex-, tissue- and development-specific expressions; and (3) the effects of starvation on gene expression.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. References

Search of a Bombyx EST database (Silkbase; http://papilio.ab.a.u-tokyo.ac.jp/silkbase/index.html) (Mita et al., 2003) with the Drosophila takeout gene revealed 26 clones, including the Bombyx JHBP gene (Hirai et al., 2002) (Table 1). A search of the DDBJ/EMBL/GenBank database revealed three Bombyx genes. The 29 clones found in the database are listed in Table 1. After eliminating identical clones, 10 independent clones remained; an-0147, an-0921, brp-1649, brp-2095 and BmJHBP have three, four, two, 10 and two clones in Silkbase, while an-0128, an-0895, ce-0330, e96h-0303 and wdS3-0639 had only one clone (Table 1). These clones were derived from various tissues and stages (Table 1).

Table 1.  The takeout/JHBP family genes found in the Bombyx EST database, Silkbase, are listed. The identical clones were grouped yielding 10 independent groups including JHBP. The clones in boldface were representatives used in this study. Numbers of identical clones and the source of cDNA libraries are also listed. The clones in brackets are found in GenBank database
ClonesAccession nosNo. of identical clones in SilkbaseSources
an-0128AB196702 1Antennae
an-0147, wdV1-0671X, wdV4-0106AB196704 3Antennae, Wing disk of day 1 or 4 fifth instar larvae
an-0895AB196701 1Antennae
an-0921, NRPG-1937, P5PG-0016, AB196707 4Antennae, pheromone gland
P5PG-1019
brP-1649, N-0442 (AU002769)AB196705 2Day 0 pupal brain, ovary derived cultured cell
brP-1169, brP-1776, brP-2095, brP-2298, ceN-1507, ceN-4065, ceN-6135, wdS2-0794, wdV1-0675, wdV3-0609, (AU004740)AB19670610Day 0 pupal brain, compound eye, wing disk of day 1 or 3 fifth instar larvae, wing disk of day 2 after spinning
ce-0330AB196703 1Compound eye
e96h-0303AB196708 1Egg 96 h after HCl treatment
wdS3-0639AB196700 1Wing disk of day 3 after spinning
e96h-0597, fbVf-0876AF098304 2Egg 96 h after HCl treatment, fat body of day 3 fifth instar larvae
(BmJHBP)

The nucleotide sequences of the full-length cDNAs were obtained using rapid amplification of cDNA ends-polymerase chain reaction (PCR) with the primer sets listed in Table 2. Nine cDNAs were 0.8–1.7 kb long and their translated proteins had 229–258 amino acid residues. The signal cleavage sites of the predicted amino acid sequences were deduced and all proteins except ce-0330 were proposed to have signal cleavage sites (Fig. 1). The amino acid sequences of Bombyx cDNAs were aligned with those of lepidopteran JHBPs and Drosophila Takeout, and there was significant homology among these proteins (Fig. 1). The amino acid sequences of the nine genes had 18.9–29.7% identity with Drosophila Takeout. The cysteine residues, which are necessary for juvenile hormone (JH) binding of Heliothis JHBP (Wojtasek & Prestwich, 1995), were conserved among all genes, and the regions corresponding with the hormone-binding fragments identified in Manduca JHBP (Touhara & Prestwich, 1992) also had significant similarity (Fig. 1).

Table 2.  The cDNA clones were amplified using oligonucleotides that have the same number with the clone name
OligonucleotidesSequences
For 5′ RACE
 0128R1CCATTGATCACGGATATGTGTAACGGG
 0128R2CCAACTTTACACGGTGTTATGAAGGGT
 0147R1TCCCAGTTAGATTGTGCGTATGGGAG
 0147R2GCGTATGGGAGAAGCTCGCGGTA
 0895R1TTGACGAGGGCTTGGGCAGCTATAA
 0895R2CAGAGGGTCCAGGGGTGGTAAACCT
 0921R1CTTGTTCACCCAGGAAGAGATTGTCAG
 0921R2CAAGCAATGTTATGTCCACCAGTCC
 30639R1CACCTGTGATGGGCAAAATGAGGAG
 30639R2CCAACTTCAATCCGGCAAGGTCAAC
 0330R1CCTCTGCTTTTTCCACATCATA
 0330R2AACTCAATCAATACACTTTGGTCA
 0303R1GCAAGCCAGCCTGGACGGTGTTCA
 0303R2GTACCGCCTTCTGCGCTGAGGACTT
For 3′ RACE
 0921F1TGCACGAAGAGTCTGATCAATAATGCC
 0921F2TCCGTAAGATAATGCTTAGCGGGTAC
 0330F1GACGATGTCAAATGGGACACAGAGAAG
 0330F2GAAGACCAATTATGGACGCTACAGCAA
For cloning of entire cDNA
 0128aACGATTATGTTGACGTTTCTCTGC
 0128bTTTACTGCAAGTAAAGTTCTTCGG
 0147aTGTGGTACAATGCTCTAAGGTAGCAAG
 0147bACTAGGTAGTTTCAGCTGAAAACCTGA
 0895aCGTATTTCACGAGATCAAACAGA
 0895bTTATTCGGGCATTAATTCGTCAAACGATAC
 0921aATAGCTACAAAGATGGCTCTTATG
 0921bCTGTTTGTTAAGGTTTGGCAATC
 1649aGAATGCATAAATTCGTGGCGTTGT
 1649bTGACGTACCTAAATGGAAAGGTTGA
 2095aGACGTCAATAACTTGATTTTCCAATCC
 2095bGACATCGTTTATCACAGATACGAACTC
 30639aCTTTCATTTGGTGTGACCAGTTC
 30639bGTTGTTGTTTTCCGAAAAGGAGTAG
 0330aCAAAGTGTTCGTCGAATTGATAACTC
 0330bAAGTAACCAGCTTACTTAGGTGAAATG
 0303aTGTGAATAGCTTACGATGTTGGTTC
 0303bTACACTATTGTATATCGGCGACGTT
image

Figure 1. Comparison of deduced amino acid sequences of takeout/JHBP family genes. The sequence alignments were prepared using the ClustalW program. The identical and similar residues with more than seven of 13 genes were reversed and boxed, respectively. BmJHBP, MsJHBP and HevJHBP denote JHBP of B. mori (accession no. AF098304), Manduca sexta (A40668), and Heliothis virescens (AAA68242), respectively. DmTO denotes Drosophila melanogaster takeout protein. Asterisks denote conserved disulphide bonds, as suggested in HvJHBP (Wojtasek & Prestwich, 1995). Underlines denote the ligand binding fragment identified in MsJHBP (Touhara & Prestwich, 1992). Arrowheads denote predicted signal peptides cleavage sites.

Download figure to PowerPoint

The DDBJ/EMBL/GenBank database was searched with Bombyx takeout/JHBP family genes and many genes were found in insect species belonging to Lepidoptera, Diptera, Hymenoptera and Orthoptera; and many genes were found in species in which a genomic project is in progress. A phylogenetic tree was constructed from the amino acid sequences of the takeout/JHBP family genes, including 20 Drosophila melanogaster, 10 Anopheles gambiae, four Apis mellifera, 10 Bombyx mori, three Manduca sexta, one Heliothis virescens and one Galleria mellonella (Fig. 2). This tree indicates that the family genes are divided into two large groups, JHBPs and others. Within the latter group, there were several clusters that were supported with high bootstrap values (70%) (Fig. 2). Genes of the same species were not always clustered within one branch but were scattered in the tree, although there were some genes clustered within the same species. The Bombyx gene an-0147 was grouped into the cluster including Drosophila, Anopheles and Apis genes, and brp-1649 was closely related to Anopheles EAA01266 and Drosophila NP_649508 with some other genes from Drosophila, Anopheles and Apis as their sister groups (Fig. 2). The tree also demonstrated that the Bombyx gene an-0921 was derived from the common ancestral gene with Manduca JP29 (Fig. 2). There were close relationships between e96h-0303 and an-0128 and between wds-30639 and ce-0330. In contrast, brp-2095 and an-0895 were not clearly grouped into one cluster or with genes from other species. At the root of the tree, on the other hand, there were many branching points that were supported by low bootstrap values. Schistocerca yellow protein has similarity with the family genes, although it was omitted from the tree because it produced unreliable branching.

image

Figure 2. Phylogenetic tree of Takeout/JHBP family proteins. The tree was constructed using the neighbour-joining method. The arabic numerals at the branching points are bootstrap values (%), and values of more than 70 are in bold. Asterisks denote Drosophila genes that are recognized as circadian genes (Lorenz et al., 1989; So et al., 2000). The names of the 10 Bombyx genes are shown in bold. Sources of sequences not mentioned in Fig. 1 are listed below, GmMSP (Galleria mellonella male-specific protein; not found in database) (Han et al., 2003), Ag TOL1 and TOL2 (Anopheles gambiae takeout-like proteins; accession no. AY187041 and AY187042) (Justice et al., 2003), Dm 0.9 kb (Drosophila melanogaster 0.9 kb gene; A60091) (Lorenz et al., 1989), Ms moling (Manduca sexta moling; AY231292) (Du et al., 2003) and JP29 (Manduca Sexta JP29; U05270) (Palli et al., 1994) genes. Other proteins of Drosophila melanogaster (Dm), Anopheles gambiae (Ag), and Apis mellifera (Am) are represented as accession numbers. Schistocerca gregaria yellow protein (Wybrandt & Andersen, 2001) was omitted because it produced unreliable branching near the root of the tree.

Download figure to PowerPoint

To understand the functions of takeout/JHBP family genes, expression of these genes was analysed (Figs 3–5). Sex and tissue specificity of day 4 fifth instar larvae were analysed by Northern hybridization using the cDNA of an-0128, an-0147, an-0921, brp-1649 and brp-2095 as probes (Fig. 3). The 0.9–1.3 kb transcripts of all genes were detected in fat body RNA. an-0128 and brp-2095 transcripts were also detected in midgut and silk gland. brp-1649 transcripts were detected in midgut, silk gland and carcass. The smaller brp-1649 transcript (1.1 kb) was detected in the carcass (Fig. 3). There was no significant difference in expression between sexes.

image

Figure 3. Tissue and sex-specificity of transcripts of Bombyx takeout/JHBP family genes. RNA extracted from day 4 fifth instar larvae was analysed by Northern hybridization with 32P-labelled cDNA probes. M and F denote male and female, respectively. Ribosomal RNA stained by ethidium bromide is shown to demonstrate equal loading of samples.

Download figure to PowerPoint

image

Figure 4. Developmental changes of expression of Bombyx takeout/JHBP family genes. RNA extracted from various developmental stages of female (A) fat body and (B) midgut were analysed by Northern hybridization with 32P-labelled cDNA probes. Roman numerals represent the larval instar and Arabic numerals indicate age in days. Ribosomal RNA stained by ethidium bromide is shown to demonstrate equal loading of samples.

Download figure to PowerPoint

image

Figure 5. Effect of starvation on expression of Bombyx takeout/JHBP family genes. Midgut and fat body RNA extracted from day 1 fifth instar female larvae fed or starved in 24 h were analysed by Northern hybridization with 32P-labelled cDNA probes. Ribosomal RNA stained by ethidium bromide is shown to demonstrate equal loading of samples.

Download figure to PowerPoint

Developmental specificity was analysed using RNA extracted from the female fat body and midgut (Fig. 4). The an-0128, an-0147, brp-1649 and brp2095 transcripts were expressed in the intermoult period (IV3, V1 and V4) and there was no or little expression in the moulting (IV4) or spinning (V7) periods (Fig. 4A). brp-1649 was also expressed in the intermoult period of the fourth instar (IV3), although no expression was detected in the fifth instar period. In contrast, an-0921 was expressed in the moulting period of the fourth instar period (IV4), and less or no expression in the day 1 fifth instar period and other periods, respectively. Expression of an-0147 and brp-1649 was also observed in the pupal fat body. In midgut RNA, almost the same expression patterns were observed, except that brp-1649 was expressed in day 4 fourth instar larvae and there was relatively abundant expression of an-0128, brp-1649 and brp-2095 in day 7 fifth instar larvae (Fig. 4B).

Day 1 fifth instar larvae were starved for 24 h and the effects on gene expression were analysed in the female fat body and midgut RNA (Fig. 5). In fat body RNA, starvation suppressed an-0128, an-0147 and brp-2095 expression (Fig. 5A). The same results were observed for an-0147 and brp-2095 in midgut RNA (Fig. 5B). No brp-1649 expression was detected in the fat body. There was no significant difference in midgut an-0128 RNA expression between starvation and fed controls. On the other hand, midgut brp-1649 expression was enhanced by starvation (Fig. 5B). Similar results were obtained in male RNA (data not shown). The expression of an-0921 was not detected in control or starvation experiments.

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. References

We cloned nine cDNAs in B. mori, analysed the sequences, and constructed a phylogenetic tree with other insect proteins. These genes comprise a large gene family specific to insect species (Fig. 2). The gene family is found in holometabolous insects as well as in hemimetabolous insects (Wybrandt & Andersen, 2001), suggesting that takeout/JHBP family genes are widespread in insect species and have important functions. All clones, except ce-0330, have presumed signal peptides (Fig. 1), suggesting that they are secreted proteins. Most of the previously reported members of this gene family are secreted proteins (Goodman & Chang, 1985; Sarov-Blat et al., 2000; Wybrandt & Andersen, 2001; Han et al., 2003); Manduca JP29 is found in both the nucleus (Palli et al., 1994) and the insecticyanin granules (which are membrane-bound) within epidermal cell (Shinoda et al., 1997), however, and some proteins of this gene family might function in cells. The conserved cysteine residues and hormone binding fragments (Fig. 1) suggest that the proteins of these nine Bombyx genes have hydrophobic ligands.

The ligands of the gene family are not known except for JH for JHBPs and carotenoids for Schistocerca yellow protein, in which there are no conserved cysteine residues (Wybrandt & Andersen, 2001). JH and its metabolites are candidate ligands, and Manduca moling might bind and stabilize JH (Du et al., 2003). The fact that takeout null mutant flies develop normally (Sarov-Blat et al., 2000; So et al., 2000) suggests that takeout is not essential for the function of JH. Justice et al. (2003) and Bohbot & Vogt (2005) cloned Takeout-like protein genes from Anopheles and Aedes antennal libraries, respectively, and suggested that they function in odourant molecule binding (Justice et al., 2003), or they might regulate the antennal response to food, host or pheromonal odours in a JH-sensitive manner (Bohbot & Vogt, 2005). The fact that four of nine Bombyx takeout/JHBP genes were cloned from an antennal library (Table 1) indicates the abundance of their messages in the antennae and supports these possibilities. Both Anopheles and Bombyx genes, however, are also expressed in other tissues (Justice et al., 2003) (Fig. 3), and detailed expression studies are required to further discuss this issue.

JHBPs of this gene family are found only in lepidopteran species and form a separate group from other genes (Fig. 2), suggesting that the JHBP ancestor diverged from that of the other genes of this family at an early period in the diversification of this gene family, and then evolved to JHBPs probably before the divergence of the lepidopteran species. The branching order of the gene lineages at the root of the phylogenetic tree cannot be determined with certainty, because the lineages are supported with low bootstrap values. This finding might be interpreted as that these gene lineages diverged within a short time during the early period of the gene diversification. Some genes of the same species are not grouped and are scattered in the tree, and some of them are clearly clustered with the genes of other species (Fig. 2). This finding indicates that the duplications and divergences of this gene family occurred many times before the divergence of Diptera, Hymenoptera and Lepidoptera. On the other hand, some genes are closely related with genes of the same species (i.e. an-0128 and e96h-0303 or Dm NP_570016 and Dm 0.9 kb), suggesting that, at least within orders, these genes probably diverged by gene duplication.

Expression analysis of five of the Bombyx takeout/JHBP family genes used in this study indicated that they are dominantly expressed in fat body (Fig. 3); they were, however, detected in other tissues (Fig. 3) and original EST clones were derived from various tissues (Table 1), suggesting that expression is ubiquitous rather than tissue-specific. The expression analysis demonstrated that the genes are development-specific (Fig. 4). Some genes were dominantly expressed in the intermoult period and some were expressed in moulting periods (Fig. 4). The genes expressed in the intermoult periods (an-0128, an-0147, brp-2095) were suppressed by starvation (Figs 4 and 5). In contrast, brp-1649, for which expression in midgut was enhanced in the moulting period (Fig. 4), was enhanced by starvation (Fig. 5), similar to the Drosophila takeout gene (Sarov-Blat et al., 2000). This suggests that the enhanced brp-1649 expression in the moulting period is caused by starvation rather than by ecdysteroids. The an-0921 expression was also increased in the moulting period, but was not enhanced by starvation, suggesting that ecdysteroids rather than starvation are responsible for the enhanced expression.

Takeout/JHBP family proteins are suggested to be carrier proteins of hydrophobic ligands and have a role in transporting the signalling molecules or nutrients between tissues. It is possible that Takeout/JHBP protein modifies the activity of hydrophobic ligands by regulating their titres. Regulation of the expression by nutritional condition suggests that these proteins have roles in transmitting information or supplying nutrients to regulate metabolism or behaviour related to nutritional conditions. Detailed analysis of the expression of this gene family and the molecular mechanisms of starvation-regulated gene expression will provide clues to takeout/JHBP family gene function.

Experimental procedures

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. References

Animals

A hybrid race (Kinshu × Shouwa or Shunrei × Shougetsu) of the silkworm B. mori was used. The larvae were reared on an artificial diet (Silkmate 2M, Nosan Co., Yokohama, Japan) at 25 °C under a 16 h light and 8 h dark photoperiod.

Isolation of RNA and cDNA cloning

The tissue was dissected from larvae, pupae and adults at various stages in sterile phosphate-buffered saline (50 mm sodium phosphate, 150 mm NaCl), frozen quickly by liquid nitrogen and stored at −70 °C until use. RNA was isolated using Sepasol (Nakalai Tesque, Kyoto, Japan). Poly(A)+ RNA was isolated from total RNA using a GenElute mRNA miniprep kit (Sigma, St Louis, MO, USA). cDNA was synthesized using powerscript reverse transcriptase (BD Biosciences, Palo Alto, CA, USA). 5′- and 3′-rapid amplification of cDNA ends-PCR was performed using a SMART RACE cDNA amplification kit (BD Biosciences) according to the manufacturer's instructions. Finally, entire cDNA clones were obtained using the PCR method. The PCR primers are listed in Table 1. cDNA was cloned to pBluescript (Stratagene, La Jolla, CA, USA) and sequenced using an ABI PRISM 310 or 3100 Genetic Analyser (Applied Biosystems, Foster City, CA, USA). The sequence data were analysed using Genetyx and ATGC (GENETYX CO., Tokyo, Japan). Sequence alignment was performed using ClustalW available at the DNA data bank Japan (DDBJ) web site (http://www.ddbj.nig.ac.jp/). The signal cleavage site was predicted using the SIGFIND – Signal Peptide Prediction Server (http://www.stepc.gr/~synaptic/sigfind.html).

Phylogenetic analysis

Multiple alignments of amino acid sequences of the takeout/JHBP family genes were performed by mafft, a multiple sequence alignment program developed by Katoh et al. (2002), and manually inspected on the XCED sequence alignment editor (Katoh et al., 2002). For construction of the phylogenetic tree, the sequence columns, which consisted of gaps were removed from the multiple alignment data set. A phylogenetic tree was constructed using the neighbour-joining method (Saitou & Nei, 1987) on the XCED sequence alignment editor. The tree was evaluated by the bootstrap test based on 1000 replications.

Northern hybridization

Total RNA (10 g) was electrophoresed on 1% agarose-formaldehyde gels and transferred to nylon membranes (Hybond N+, Amersham Bioscience, Little Chalfont Buckinghamshire, UK) using the capillary transfer method (Sambrook & Russel, 2001). The cDNA probes were labelled by 32P-dCTP (specific activity 110 TBq/mmol, Amersham Bioscience) using a Megaprime DNA labelling system (Amersham Bioscience). The probes were purified using a Sephadex G-50 spin column (Amersham Bioscience). Membranes were prehybridized at 65 °C for 1 h in Church & Gilbert solution (Sambrook & Russel, 2001). Hybridization was performed overnight in solution containing 106 cpm/ml 32P-labelled probe (5 × 108 cpm/mg). The membranes were washed twice for 10 min at room temperature in 2 × SSC (0.3 m NaCl, 30 mm sodium citrate dihydrate) containing 0.1% SDS, and washed twice for 10 min at 65 °C in 0.1 × SSC containing 0.1% SDS. The radioactivity was visualized using a Fuji BAS-1000 Image Analysis System (Fuji Photo Film Co., Tokyo, Japan).

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. References
  • Bohbot, J. and Vogt, R.G. (2005) Antennal expressed genes of the yellow fever mosquito (Aedes aegypti L.); characterization of odorant-binding protein 10 and takeout. Insect Biochem Mol Biol 35: 961979.
  • Colombani, J., Raisin, S., Pantalacci, S., Radimerski, T., Montagne, J. and Leopold, P. (2003) A nutrient sensor mechanism controls Drosophila growth. Cell 114: 739749.
  • Dauwalder, B., Tsujimoto, S., Moss, J. and Mattox, W. (2002) The Drosophila takeout gene is regulated by the somatic sex-determination pathway and affects male courtship behavior. Genes Dev 16: 28792892.
  • Du, J., Hiruma, K. and Riddiford, L.M. (2003) A novel gene in the takeout gene family is regulated by hormones and nutrients in Manduca larval epidermis. Insect Biochem Mol Biol 33: 803814.
  • Goodman, W.G. and Chang, E.S. (1985) Juvenile hormone cellular and hemolymph binding proteins. In: Comprehensive Insect Physiology, Biochemistry and Pharmacology (eds Kerkut, G.A. and Gilbert, L.I.), Vol. 7 Endocrinology I, pp. 491510. Pergamon Press, Oxford.
  • Han, J., Lee, C.S., Yun, C.Y., Lee, B.H., Ko, Y.G., Kang, C.S. et al. (2003) Cloning and expression of male-specific protein (MSP) from the hemolymph of greater wax moth, Galleria mellonella L. Arch Insect Biochem Physiol 54: 110120.
  • Hirai, M., Kamimura, M., Kikuchi, K., Yasukochi, Y., Kiuchi, M., Shinoda, T. and Shiotsuki, T. (2002) cDNA cloning and characterization of Bombyx mori juvenile hormone esterase: an inducible gene by the imidazole insect growth regulator KK-42. Insect Biochem Mol Biol 32: 627635.
  • Justice, R.W., Dimitratos, S., Walter, M.F., Woods, D.F. and Biessmann, H. (2003) Sexual dimorphic expression of putative antennal carrier protein genes in the malaria vector Anopheles gambiae. Insect Mol Biol 12: 581594.
  • Kadono-Okuda, K., Kaziura, Z. and Yamashita, O. (1986) Induction of perfect superlarvae by the application of juvenile hormone analogue to starved larvae of the silkworm, Bombyx mori. J Insect Physiol 32: 10651073.
  • Katoh, K., Misawa, K., Kuma, K. and Miyata, T. (2002) MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res 30: 30593066.
  • Lorenz, L.J., Hall, J.C. and Rosbash, M. (1989) Expression of a Drosophila mRNA is under circadian clock control during pupation. Development 107: 869880.
  • Masumura, M., Satake, S., Saegusa, H. and Mizoguchi, A. (2000) Glucose stimulates the release of bombyxin, an insulin-related peptide of the silkworm Bombyx mori. Gen Comp Endocrinol 118: 393399.
  • Mita, K., Morimyo, M., Okano, K., Koike, Y., Nohata, J., Kawasaki, H. et al. (2003) The construction of an EST database for Bombyx mori and its application. Proc Natl Acad Sci USA 100: 1412114126.
  • Nijhout, H.F. (1975) A threshold size for metamorphosis in the tobacco hornworm, Manduca sexta (L.). Biol Bull 149: 214225.
  • Nijhout, H.F. and Williams, C.M. (1974) Control of moulting and metamorphosis in the tobacco hornworm, Manduca sexta (L.): growth of the last-instar larva and the decision to pupate. J Exp Biol 61: 481491.
  • Oldham, S. and Hafen, E. (2003) Insulin/IGF and target of rapamycin signaling: a TOR de force in growth control. Trends Cell Biol 13: 7985.
  • Orchard, I. and Loughton, B.G. (1985) Neurosecretion. In Comprehensive Insect Physiology, Biochemistry and Pharmacology (Kerkut, G.A. and Gilbert, L.I. eds), Vol. 10 Biochemistry pp. 61107. Pergamon Press, Oxford.
  • Palli, S.R., Touhara, K., Charles, J.P., Bonning, B.C., Atkinson, J.K., Trowell, S.C. et al. (1994) A nuclear juvenile hormone-binding protein from larvae of Manduca sexta: a putative receptor for the metamorphic action of juvenile hormone. Proc Natl Acad Sci USA 91: 61916195.
  • Saitou, N. and Nei, M. (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4: 406425.
  • Sambrook, J. and Russel, D.W. (2001) Molecular Cloning: A Laboratory Manual, 3rd edn. Cold Spring Harbor Laboratory, New York.
  • Sarov-Blat, L., So, W.V., Liu, L. and Rosbash, M. (2000) The Drosophila takeout gene is a novel molecular link between circadian rhythms and feeding behavior. Cell 101: 647656.
  • Satake, S., Masumura, M., Ishizaki, H., Nagata, K., Kataoka, H., Suzuki, A. and Mizoguchi, A. (1997) Bombyx in, an insulin-related peptide of insects, reduces the major storage carbohydrates in the silkworm Bombyx mori. Comp Biochem Physiol B 118: 349357.
  • Shapiro, J.P., Law, J.H. and Wells, M.A. (1988) Lipid transport in insects. Annu Rev Entomol 33: 297318.
  • Shinoda, T., Hiruma, K., Charles, J.-P. and Riddiford, L.M. (1997) Hormonal regulation of JP29 in the epidermis during larval development and metamorphosis in the tobacco hornworm, Manduca sexta. Arch Insect Biochem Physiol 34: 409428.
  • Siegert, K. and Ziegler, R. (1983) A hormone from the corpora cardiaca control fat body glycogen phosphorylase during starvation in tobacco hornworm larvae. Nature 301: 526527.
  • So, W.V., Sarov-Blat, L., Kotarski, C.K., McDonald, M.J., Allada, R. and Rosbash, M. (2000) takeout, a novel Drosophila gene under circadian clock transcriptional regulation. Mol Cell Biol 20: 69356944.
  • Steele, J.E. (1985) Control of metabolic processes. In Comprehensive Insect Physiology, Biochemistry and Pharmacology (Kerkut, G.A. and Gilbert, L.I. eds), Vol. 10 Biochemistry pp. 99145. Pergamon Press, Oxford.
  • Touhara, K. and Prestwich, G.D. (1992) Binding site mapping of a photoaffinity-labeled juvenile hormone binding protein. Biochem Biophys Res Commun 182: 466473.
  • Wojtasek, H. and Prestwich, G.D. (1995) Key disulfide bonds in an insect hormone binding protein: cDNA cloning of a juvenile hormone binding protein of Heliothis virescens and ligand binding by native and mutant forms. Biochemistry 34: 52345241.
  • Wybrandt, G.B. and Andersen, S.O. (2001) Purification and sequence determination of a yellow protein from sexually mature males of the desert locust, Schistocerca gregaria. Insect Biochem Mol Biol 31: 11831189.