SEARCH

SEARCH BY CITATION

Keywords:

  • insect immunity;
  • melanization;
  • mosquito

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results and discussion
  5. Experimental procedures
  6. Acknowledgements
  7. References

Phenoloxidases, including tyrosinases and laccases, are enzymes involved in the synthesis of melanin, a process that can be elicited during insect immune responses, cuticle maturation, wound healing and egg chorion development. We cloned a putative inhibitor of melanization (POI) from Anopheles gambiae on the basis of homology with a functionally characterized peptide from Musca domestica (Daquinag et al., Proc Natl Acad Sci USA 1995; 92: 2964–2968). The 335 amino acid protein predicted from the A. gambiae cDNA consists of five tandemly arranged inhibitor motifs. The A. gambiae POI gene was expressed in all mosquito stages from egg to adult. POI transcript levels were high in the fat body and were measurable but comparatively reduced in the midgut. The POI transcript level increased after wounding or Sephadex bead injection. Gene knockdown did not result in faster or more extensive bead melanization but did result in more extensive melanization of wound sites following a thoracic bead injection.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results and discussion
  5. Experimental procedures
  6. Acknowledgements
  7. References

Mosquitoes, like other insects, have antipathogen defence strategies based on cellular and humoral immune reactions. These defences include synthesis of antimicrobial peptides by the fat body, phagocytosis by macrophage-like haemocytes, and activation of proteolytic cascades leading to localized melanization and coagulation (reviewed in Barillas Mury et al., 2004). The biology of melanization in mosquitoes is an active area of research because this type of immune response can be elicited by malaria parasites (Collins et al., 1986; Paskewitz et al., 1988, 1989). Melanin can be produced by the action of phenoloxidase (PO) on a catecholamine substrate. In most insects, PO exists in haemolymph as an inactive zymogen, called prophenoloxidase (proPO), which is activated by a specific protease. There are nine prophenoloxidase genes in Anopheles gambiae (Jiang et al., 1997; Mueller et al., 1999; Christophides et al., 2002). Active PO catalyses the hydroxylation of monophenols to o-diphenols and oxidation of o-diphenols, such as dopa or dopamine, to quinones that can polymerize to form melanin. Cytotoxic molecules produced in this process, including quinones and reactive oxygen intermediates, may kill the invading microorganisms that are trapped by melanin (Nappi & Ottaviani, 2000). Because quinones may be cytotoxic, the pathway is tightly regulated. For example, certain serpins clearly serve as inhibitors of the serine proteases that are involved in the proPO activation process (Zhu et al., 2003).

Studies on the direct inhibition of insect POs are limited. A protein described as a competitive inhibitor of PO was purified from pupae of the house-fly, Musca domestica (Daquinag et al., 1995). This protein (designated POI) is a basic lysine-rich peptide of 38 amino acids with a unique modified residue, dopa, at position 32. The Musca POI belongs to a family of proteins in which six Cys residues form three intramolecular disulphide bridges defining a ‘cystine-knot’ motif commonly found in snail and spider toxins (Pallaghy et al., 1994; Daquinag et al., 1999). Using the POI peptide sequence, we found and characterized a relative from Anopheles gambiae. Knockdown of the A. gambiae POI gene resulted in a greater occurrence of melanin around wound sites but did not affect bead melanization, providing support for the hypothesis that the protein plays a role in controlling certain melanization reactions.

Results and discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results and discussion
  5. Experimental procedures
  6. Acknowledgements
  7. References

A. gambiae POI cDNA and genomic structure

We found several A. gambiae EST sequences (e.g. accession numbers CR529631, CR529337, CR528986 and CD747521) when we searched GenBank with the house-fly POI protein sequence. The EST sequences represented one gene. Oligonucleotide primers based on these ESTs were combined with vector-specific primers to amplify sequences from an A. gambiaeλZAPII cDNA library. The 1184 bp POI cDNA (GenBank accession no. AY928182) was constructed by assembly of two overlapping sequences (Fig. 1A,B). We verified the contiguity of this sequence by amplifying and sequencing a fragment that begins at the probable start codon and ends at the stop codon from a mosquito cDNA sample.

image

Figure 1. Gene structure and nucleotide sequence of an A. gambiae phenoloxidase inhibitor. (A) A schematic representation of the A. gambiae POI genomic region. Exons (boxes) are labelled 1–6. Each POI motif is encoded by parts of two exons as shown. Lines under the transcript illustrate the order and extent of the three cDNA clones that were sequenced and assembled into the full-length POI sequence. (B) cDNA and deduced amino acid sequence. Putative N-linked glycosylation site is indicated (*), O-linked glycosylation sites are indicated (◆). The predicted signal peptide cleavage site is indicated (▾). The exon–exon junctions are indicated (grey and black shaded). Conserved cysteines are shaded in black.

Download figure to PowerPoint

We compared our cDNA sequence with the A. gambiae genome assembly. The POI gene comprises six exons and five introns (Fig. 1A). All intron–exon junctions obey the GT/AG rule. The largest intron is found between exons 3 and 4 and is 1169 bp. Each of the five cystine knot motifs is encoded by two exons with the first cystine residue always in the first exon, and the second cystine residue at the start of the second exon (Fig. 1A).

Protein features and sequence comparisons

The ORF in the POI cDNA encodes a predicted protein of 335 amino acids (Fig. 1B) with a molecular weight of 33.84 kDa and a pI of 6.82. The presence of a predicted signal peptide and the lack of predicted transmembrane domains indicate the protein is secreted. The predicted signal peptidase cleavage site is before amino acid position 22 (SignalP 3.0 Server, Jannick et al., 2004). POI contains a single consensus motif for N-linked glycosylation at aa 143 (NetNGlyc 1.0, Julenius et al., 2005), and two consensus sites for O-linked glycosylation at aa 213 and 220 (NetOGlyc 3.1, Julenius et al., 2005).

The Musca POI peptide was isolated by protein biochemistry and contains a single ‘inhibitor cystine knot motif’ (Daquinag et al., 1995). The predicted A. gambiae POI-like protein contains five of these cystine knot motifs, each with the characteristic six cystine residues (Figs 1B and 2A). We do not know whether the Musca POI is translated as a multidomain protein and then processed so we searched for orthologues among other insects. We found two ESTs for a Manduca sexta POI (accession numbers BE015616, BE015598) that contains a single inhibitor motif. We also found a 5 kb genomic region of Drosophila melanogaster (accession number AE003736) that contains at least five inhibitor motifs. However, computational evidence suggests that there are two genes (accession numbers BK002734 and BK002735) associated with this genomic region (Hild et al., 2003) and the predicted proteins each encode only one inhibitor domain. Hild et al. (2003) provide evidence that these genes are transcribed.

image

Figure 2. Sequence comparison and phylogenetic tree of POI-like proteins. (A) Clustal W 1.8 alignments of amino acids sequence of the five motifs of A. gambiae POI (GenBankTM accession no. AY928182), A. funestus POI-like protein (GenBankTM accession no. CD578321), A. aegypti POI-like protein (GenBankTM accession no. CF530416), Musca POI (GenBankTM accession no. AAB33998), Manduca sexta POI-like protein (GenBankTM accession no. BE015598, BE015616); Drosophila melanogaster POI-like proteins (GenBankTM accession no. BK002734, BK002735) and ù-GVIA (GenBankTM accession no. M84612). Lines indicate the mode of disulphide bridges between the six cysteine residues in the Musca POI. (B) Phylogenetic tree of ‘cystine-knot’ motif proteins. The tree was built based on the alignment of the sequences using Clustal X. A bootstrapped neighbour-joining analysis was applied to create the tree.

Download figure to PowerPoint

In addition to these insect sequences, we found related cDNAs in two other mosquito species, Aedes aegypti (accession number CF530416) and Anopheles funestus (Fig. 2). The EST from A. funestus (accession number CD578321) encodes a protein with three inhibitor motifs that are nearly identical to the first three motifs in the A. gambiae protein (Fig. 2A,B); the third motif is truncated and the EST probably contains only a partial sequence. A multiple domain structure for POI may be a common feature among anopheline mosquitoes.

In Musca POI, a tyrosine residue occurs between the fifth and sixth cysteine residues at position 32. This tyrosine is oxidized to dopa in the purified Musca peptide (Daquinag et al., 1999), a modification that may be essential for function. A tyrosine residue occurs in the same position in one of the Drosophila proteins, in the Manduca protein and in motif 5 of the A. gambiae POI protein (Fig. 2A). A neighbour-joining phylogenetic analysis also placed motif 5 in a clade with these proteins (Fig. 2B) but more insect and mosquito sequences will be needed to verify this conclusion. In motifs 1–3, a phenylalanine residue occurs at position 32 and a tyrosine residue occurs at position 34. It is intriguing to note that phenylalanine hydroxylase has also been implicated in mosquito melanization responses (Infanger et al., 2004); perhaps the A. gambiae POI is a multifunctional inhibitor.

Other conserved features of the group include a serine/threonine at position 26 (Fig. 2A). A glycine at position 15, which is required for a type II β-turn in the ω-conotoxin GVIA (Davis et al., 1993; Lew et al., 1997) is found in 10 of the 15 sequences. There is also a bias towards an acidic amino acid at position 23, a basic amino acid at position 35 and a histidine at position 21 (Fig. 2A).

POI is expressed in all developmental stages and in several different adult tissues

POI transcripts were found throughout development (Fig. 3A). Transcript levels were assessed relative to transcripts for the ribosomal S7 protein using semiquantitative reverse transcriptase (RT)–PCR. The relative transcript level was low in the eggs and early larvae and higher in fourth instar larvae and pupae. In the adult mosquito, transcripts were lower in older female mosquitoes than in 4-day-old males. We have seen a similar pattern for other genes and believe this reflects a difference in the S7 transcript between sexes at this age.

image

Figure 3. Semiquantitative RT–PCR analysis of the expression of POI. (A) Expression during different developmental stages. RNA was extracted from whole insects. Lanes: E = eggs; L3 = third instar larvae; L4 = fourth instar larvae; P = pupae; F0 = 0-day-old female mosquito; M0 = 0-day-old male mosquito; F4 = 4-day-old female mosquito; M4 = 4-day-old male mosquito. (B) Expression in different tissues from 3-day-old G3 female mosquitoes. SG = salivary gland; FB = fat body; MG = midgut; OV = ovary; MT = Malpighian tubule. (C) Expression decreases at 24 h and 5 days following blood feeding.

Download figure to PowerPoint

Results from semiquantitative RT–PCR indicated that POI was expressed in many adult mosquito tissues, including the fat body, salivary glands, malpighian tubules, ovaries and midguts. The highest level of transcript was found in the fat body sample while the POI transcript levels were very low in midguts (Fig. 3B). The relative level of the POI transcript was reduced following blood feeding at both 24 h and 5-day time points (Fig. 3C). Preliminary results using RNA silencing of the POI gene did not demonstrate an effect on eggshell tanning (data not shown).

The inhibitor cystine-knot structural family contains toxins from snails and spiders as well as protease inhibitors and defence peptides from plants and insects (Narasimhan et al., 1994; Pallaghy et al., 1994; Daquinag et al., 1999). Within this group, POI is closest to the conotoxins. Predatory reduviid bugs contain conotoxin homologues within their saliva that block N-type Ca2+ channels (Bernard et al., 2001; Corzo et al., 2001). Thus, we looked for expression of POI in A. gambiae salivary glands. We found a low level of expression in this tissue so a role in blood feeding cannot be ruled out.

Immune challenge affects transcript levels of POI

To investigate whether transcript levels of POI change during melanization of foreign objects, we used quantitative PCR to compare transcripts following sham inoculation or Sephadex G-25 bead injection. Sephadex G-25 beads were chosen because they elicit a strong melanization response in all strains of A. gambiae that we have examined (Paskewitz & Riehle, 1994). Injection of beads resulted in a small (twofold), transient increase in the POI transcript level at 3 h (Fig. 4). G-25 beads are responded to within 5–15 min of injection and most beads are 80–100% covered by melanin within 3 h. Sham inoculation (wounding) also resulted in an increase of POI transcripts, but this was delayed in comparison with the bead injections, occurring at about 12 h. Wound healing sometimes involves the formation of a blackened ‘scab’ and this process may involve phenoloxidase.

image

Figure 4. Real-time PCR analysis of the expression of POI following wounding or injection of G-25 Sephadex beads. The levels of POI transcript at various time points after challenge were normalized to the internal control transcript for ribosomal protein S7.

Download figure to PowerPoint

Knockdown of POI affects the melanization of wound sites

RNA interference was used to test whether the loss of POI would affect the degree of melanization of a foreign target. RNAi was successful in reducing the amount of POI transcript detectable by RT–PCR (Fig. 5A, inset); however, there was no difference in the degree of melanization of G-25 beads when compared with the green fluorescent protein (dsGFP)-injected controls (Fig. 5). Interestingly, the POI-silenced mosquitoes differed from the controls in the degree of melanization at the site of bead injection on the thorax (Fig. 6). In most (66%) of the POI-silenced mosquitoes the injection sites were visibly melanized, while only 22% of the GFP controls displayed obvious blackening at the injection site. It is possible that the POI transcript/protein is restricted spatially or temporally, with consequent effects on how it interacts with other mosquito proteins. For example, if the POI protein is found mainly in the epidermis rather than in the haemolymph, it would be available for restriction of wound healing but not bead melanization. We also note that other proteins that can oxidize diphenols are found in the epidermis of some insects. These enzymes are called laccases and they are related to phenoloxidases as both are copper oxidases that can oxidize dopa (Dittmer et al., 2004). The patterns we detected suggest that laccases could be targets for the activity of POI.

image

Figure 5. Effect of knockdown through gene silencing of the POI gene. Silencing of POI does not affect G-25 Sephadex bead melanization. Inset: RT–PCR demonstrating knockdown of POI transcript.

Download figure to PowerPoint

image

Figure 6. Silencing of POI results in more frequent melanization of the wound site. (A) Wound site of control (dsGFP). Arrow indicates melanin. (B) Wound site of POI knockdown. Arrow indicates melanin. (C) Comparison of percentage of wounds sites that were either melanized or not melanized for dsGFP vs. dsPOI treatments.

Download figure to PowerPoint

In summary, our results suggest A. gambiae POI may be involved in regulating the melanization response. This conclusion is supported by conservation of structural features found in the Musca peptide (Daquinag et al., 1999) and by experimental results showing that challenges that elicit melanization responses affect transcript levels of POI and that gene silencing of POI results in enhanced melanization at wound sites. Conversely, we found no evidence that bead melanization in the haemolymph was altered in silenced mosquitoes. This suggests that the target of POI is specific to the cuticular epithelium or that there may be spatial limits to the activity of the POI protein. Purification of POI or expression of a recombinant POI will be necessary for further evaluation of the role of POI in mosquito development and immunity.

Questions remain concerning the target of the POI peptides. The consideration for the house-fly peptide as a phenoloxidase inhibitor was based on the observation that the rate of dopachrome accumulation decreased when POI was present in a phenoloxidase and dopa mixture. However, in the original paper (Tsukamoto et al., 1992), the authors indicated that the house-fly POI showed no inhibition of monophenol monooxygenase activity. As both diphenol and monophenol substrates are thought to bind to the same active site, this observation is difficult to reconcile with the idea that POI directly interacts with phenoloxidase. An alternative explanation is that the disulphide bonds of the house-fly POI are reduced upon interaction with reactive intermediates in the melanization pathway. This would lead to formation of cysteinyl residues that could react with dopaquinone, leading to a decrease in the rate of dopachrome accumulation. For example, if cysteine is present in a phenoloxidase and dopa mixture, oxidation of dopa goes on, but apparent dopachrome accumulation (which is measured in these assays) will be observed only after all cysteine molecules have been consumed. In light of this, we suggest that the original statement concerning the lack of inhibition of monophenol oxygenase activity by house-fly POI may need to be re-examined.

Experimental procedures

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results and discussion
  5. Experimental procedures
  6. Acknowledgements
  7. References

Mosquitoes and bacteria

The G3, L35 and 4a rr strains of A. gambiae were used for all experiments, and mosquitoes were reared as described previously (Paskewitz et al., 1999). Results were the same for all strains unless otherwise stated.

Immune challenges and controls

For all experiments, mosquitoes were placed into small humidified plastic cages supplied with 10% sucrose and allowed to recover in an incubator at 70–80% relative humidity and 25–26 °C. We used 2-day-old mosquitoes for challenge.

Control  Adult female mosquitoes were anaesthetized by brief chilling on ice.

Wounding  Each mosquito was anaesthetized on ice and injured by piercing the thorax with a sterile needle. RNA samples were collected at the following time points after wounding: 3 h, 6 h, 12 h and 24 h.

Inoculation with Sephadex G-25  Mosquitoes were injected with G-25 beads as previously described (Gorman et al., 1998). Briefly, G-25 beads were hydrated in mosquito saline prior to inoculation. Beads were aspirated with less than 0.05 µl of saline into a pulled glass needle and then injected into the thoracic haemocoels of 2-day-old females that had been anaesthetized on ice. One bead was injected per mosquito. RNA samples were collected at the following time points after wounding: 3 h, 6 h, 12 h and 24 h.

PCR cDNA library screening and sequence analysis

We found four POI EST sequences in the A. gambiae EST databases at GenBank. Alignments and comparison with the genomic sequence showed that these are transcribed from one gene. Based on this result, we designed two primers for PCR amplification. Primer-1 (5′-CCACTCTATTCAACACCCCAGATCTC-3′) and primer-2 (5′- AGGTAGATTTGGATCTGCCAC-3′). For amplification from a λZAPII cDNA library (G3 strain of An. gambiae; Besansky et al., 1995), we used primer 1 or primer 2 coupled with one of two vector-specific primers (T3, T7 primers). PCR products were gel-purified and cloned into the Topo-TA vector pCR-2.1 (Invitrogen, San Jose, CA, USA). Clones were sequenced and analysed using Blast and DNASTAR (DNASTAR, Inc., Madison, WI, USA). The GenBank Accession number for the sequence is AY928182.

Semiquantitative RT–PCR and tissue expression of POI

Total RNA was prepared from tissues dissected from at least 10 2-day-old female mosquitoes. Tissues included fat body (prepared by rinsing dissected and opened abdominal walls with PBS buffer, pH 7.4), midgut, ovary, Malpighian tubule and salivary gland. Samples were extracted with the AquaPure RNA isolation kit (Bio-Rad, Hercules, California, USA) and then treated with amplification grade DNaseI (Invitrogen). To examine changes during development, RNA was extracted from eggs, third instar larvae, fourth instar larvae, pupae, adult males and females within 24 h following emergence, and 4-day-old adult males and females. To examine changes following bead injection, total RNA from at least 10 female mosquitoes was extracted at selected time points. First strand cDNA was synthesized using oligo dT and RT Superscript III (Invitrogen). To amplify specific products, POI-specific primers (10 pmol) were used in 20 µl reactions with Amplitaq (1 unit, Promega, Madison, Wisconsin, USA), 200 µm dNTP, 2.0 mm MgCl2, through several thermal cycles (30 s at 92 °C, 56 °C and 1.0 min at 72 °C for 28 cycles).

The primers used to detect POI for these experiments were 5′-CAAACAGATAAAAAACAATGTGCAA-3′ and 5′-GTATGAATGACAGTTTGAAGAACAG-3′. Samples were subjected to semiquantitative RT–PCR using the ribosomal S7 gene (5′-TGCTGCAAACTTCGGCTAT-3′ and 5′-CGCTATGGTGTTCGGTTCC-3′) to normalize the samples (30 s at 92 °C, 56 °C, and 1.0 min at 72 °C for 21 cycles).

Transcription profiling by real-time PCR

Two-day-old G3 mosquitoes were treated by wounding or G-25 bead injection, with untreated 2- and 3-day-old G3 mosquitoes serving as negative controls. At selected time points after treatment, total RNA from at least 10 female mosquitoes was extracted using the methods described above. Specific primers were designed using the Beacon Designer 2.1 software (Premier Biosoft International, Palo Alto, California, USA). POI-Fwd: 5′-CGTTTCGGAGCAGATGATGG-3′, POI-Rev: 5′-AGATGGACTGAGAGGCACAC-3′. Samples also were subjected to real-time PCR using the ribosomal S7 gene (5′-GCTATGGTGTTCGGTTCC-3′ and 5′-GATCGCCTTCTTGTTGTTG-3′) to normalize the samples. The PCR reactions were assembled using IQTM SYBR Green Supermix (Bio-Rad) and run in the iCycler iQ Real-Time Detection System (Bio-Rad) following the manufacturer's instructions.

Double-stranded RNA knockdown

An in vitro transcription template was produced using a two-step PCR protocol (Dudley et al., 2002). First, a pair of primers, each designed to include 15 bp of T7 promoter sequence plus the POI (5′-CGACTCACTATAGGGTTGTCTTACTCATCGAGATTG-3′ and 5′-CGACTCACTATAGGGTCTATATGAGTAACGCTTTGC-3′) or The unrelated GFP sequence (5′-CGACTCACTATAGGGCGTGATCAAGCCCGACA-3′ and 5′-CGACTCACTATAGGGTGGGCTTCGGCGTGCTC-3′), were used to amplify a product from mosquito cDNA or phMGFP vector (Promega). The PCR product was purified using a Qiagen gel extraction kit (Qiagen, Valencia, CA, USA). Purified products then were used in a second PCR reaction with a primer containing a full T7 site: 5′TAATACGACTCACTATAGGG3′. The resulting product was again purified using the Qiagen Gel Extraction kit and 1–2 µg of the product were used as a template for transcription. The MEGAscriptTM RNAi kit (Ambion, Austin, TX, USA) was used for transcription and the production of dsRNA by following the instruction manual. All dsRNA preparations were quantified by measuring absorbance at 260 nm, checked for integrity on an agarose gel, and stored at −20 °C until used. Newly eclosed females (less than 24 h after eclosion) were injected with dsRNA (200 ng) and allowed to recover for 4 days before injection (Blandin et al., 2002). The specificity of the knockdown was examined using RT–PCR.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results and discussion
  5. Experimental procedures
  6. Acknowledgements
  7. References

We acknowledge and thank Nora Besansky, University of Notre Dame, for the gift of the cDNA library. We thank undergraduates Ellie Walker and Andrea Radtke and research specialist Beth Schadd for rearing and care of the mosquito colonies. This work was supported by NIH grant AI37083.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results and discussion
  5. Experimental procedures
  6. Acknowledgements
  7. References
  • Barillas Mury, C., Paskewitz, S. and Kanost, M. (2004) The immune response of vectors. In: The Biology of Disease Vectors (MarquardtW.C., ed.), pp. 363376. Elsevier, New York.
  • Bernard, C., Corzo, G., Mosbah, A., Nakajima, T. and Darbon, H. (2001) Solution structure of Ptu1, a toxin from the assassin bug Peirates turpis that blocks the voltage-sensitive calcium channel N-type. Biochemistry 40: 1279512800.
  • Besansky, N.J., Bedell, J.A., Benedict, M.Q., Mukabayire, O., Hilfiker, D. and Collins, F.H. (1995) Cloning and characterization of the white gene from Anopheles gambiae. Insect Mol Biol 4: 217231.
  • Blandin, S., Moita, L.F., Kocher, T., Wilm, M., Kafatos, F.C. and Levashina, E.A. (2002) Reverse genetics in the mosquito Anopheles gambiae: targeted disruption of the Defensin gene. EMBO Rep 3: 852856.
  • Christophides, G.K., Zdobnov, E., Barillas-Mury, C., Birney, E., Blandin, S., Blass, C. et al. (2002) Immunity-related genes and gene families in Anopheles gambiae. Science 298: 159165.
  • Collins, F.H., Sakai, R.K., Vernick, K.D., Paskewitz, S., Seeley, D.C., Miller, L.H. et al. (1986) Genetic selection of a Plasmodium-refractory strain of the malaria vector Anopheles gambiae. Science 234: 607610.
  • Corzo, G., Adachi-Akahane, A., Nagao, T., Kusui, Y. and Nakajima, T. (2001) Novel peptides from assassin bugs (Hemiptera: Reduviidae): isolation, chemical and biological characterization. FEBS Lett 499: 256261.
  • Daquinag, A.C., Nakamura, S., Takao, T., Shimonishi, Y. and Tsukamoto, T. (1995) Primary structure of a potent endogenous dopa-containing inhibitor of phenol oxidase from Musca domestica. Proc Natl Acad Sci USA 92: 29642968.
  • Daquinag, A.C., Sato, T., Koda, H., Takao, T., Fukuda, M., Shimonishi, Y. and Tsukamoto, T. (1999) A novel endogenous inhibitor of phenoloxidase from Musca domestica has a cystine motif commonly found in snail and spider toxins. Biochemistry 38: 21792188.
  • Davis, J.H., Bradley, E.K., Miljanich, G.P., Nadasdi, L., Ramachandran, J. and Basus, V.J. (1993) Solution structure of omega-conotoxin GVIA using 2-D NMR spectroscopy and relaxation matrix analysis. Biochemistry 32: 73967405.
  • Dittmer, N.T., Suderman, R.J., Jiang, H., Zhu, H.C., Gorman, M.J., Kramer, K.J. and Kanost, M.R. (2004) Characterization of cDNAs encoding putative laccase-like multicopper oxidases and developmental expression in the tobacco hornworm, Manduca sexta, and the malaria mosquito, Anopheles gambiae. Insect Biochem Mol Biol 34: 2941.
  • Dudley, N.R., Labbe, J.C. and Goldstein, B. (2002) Using RNA interference to identify genes required for RNA interference. Proc Natl Acad Sci USA 99: 41914196.
  • Gorman, M.J., Schwartz, A.M. and Paskewitz, S.M. (1998) The role of surface characteristics in eliciting humoral encapsulation of foreign bodies in Plasmodium-refractory and – susceptible strains of Anopheles gambiae. J Insect Physiol 44: 947954.
  • Hild, M., Beckmann, B., Haas, S., Koch, B., Solovyev, V., Busold, C. et al. (2003) An integrated gene annotation and transcriptional profiling approach towards the full gene content of the Drosophila genome. Genome Biol 5: R3.1R3.17.
  • Infanger, L.C., Rocheleau, T.A., Bartholomay, L.C., Johnson, J.K., Fuchs, J., Higgs, S. et al. (2004) The role of phenylalanine hydroxylase in melanotic encapsulation of filarial worms in two species of mosquitoes. Insect Biochem Mol Biol 34: 13291338.
  • Jannick, D.B., Dyrløv, B., Henrik, N., Gunnar, V.H. and Søren, B. (2004) Improved prediction of signal peptides: SignalP 3.0. J Mol Biol 340: 783795.
  • Jiang, H., Wang, Y., Korochkina, S.E., Benes, H. and Kanost, M.R. (1997b) Molecular cloning of cDNAs for two pro-phenol oxidase subunits from the malaria vector, Anopheles gambiae. Insect Biochem Mol Biol 27: 693699.
  • Julenius, K., Mølgaard, A., Gupta, R. and Brunak, S. (2005) Prediction, conservation analysis and structural characterization of mammalian mucin-type O-glycosylation sites. Glycobiology 15: 153164.
  • Lew, M.J., Flinn, J.P., Pallaghy, P.K., Murphy, R., Whorlow, S.L., Wright, C.E. et al. (1997) Structure-function relationships of omega-conotoxin GVIA. Synthesis, structure, calcium channel binding, and functional assay of alanine-substituted analogues. J Biol Chem 272: 1201412023.
  • Mueller, H.M., Dimopoulos, G., Blass, C. and Kafatos, F.C. (1999) A hemocyte-like cell line established from the malaria vector Anopheles gambiae expresses six prophenoloxidase genes. J Biol Chem 274: 1172711735.
  • Nappi, A.J. and Ottaviani, E. (2000) Cytotoxicity and cytotoxic molecules in invertebrates. Bioessays 22: 469480.
  • Narasimhan, L., Singh, J., Humblet, C., Guruprasad, K. and Blundell, T. (1994) Snail and spider toxins share a similar tertiary structure and ‘cystine motif’. Nat Struct Biol 1: 850852.
  • Pallaghy, P.K., Nielsen, K.J., Craik, D.J. and Norton, R.S. (1994) A common structural motif incorporating a cystine knot and a triple-stranded beta-sheet in toxic and inhibitory polypeptides. Protein Sci 3: 18331839.
  • Paskewitz, S.M. and Riehle, M.A. (1994) Response of Plasmodium refractory and susceptible strains of Anopheles gambiae to inoculated Sephadex beads. Dev Comp Immunol 18: 369375.
  • Paskewitz, S.M., Brown, M.R., Lea, A.O. and Collins, F.H. (1988) Ultrastructure of the encapsulation of Plasmodium cynomolgi (B strain) on the midgut of a refractory strain of Anopheles gambiae. J Parasitol 74: 432439.
  • Paskewitz, S.M., Brown, M.R., Collins, F.H. and Lea, A.O. (1989) Ultrastructural localization of phenoloxidase in the midgut of refractory Anopheles gambiae and association of the enzyme with encapsulated Plasmodium cynomolgi. J Parasitol 75: 594600.
  • Paskewitz, S.M., Reese-Stardy, S. and Gorman, M.J. (1999) An easter-like serine protease from Anopheles gambiae exhibits changes in transcript abundance following immune challenge. Insect Mol Biol 8: 329337.
  • Tsukamoto, T., Ichimaru, Y., Kanegae, N., Watanabe, K., Izumi, Y., Katsura, Y. and Funatsu, M. (1992) Identification and isolation of endogenous insect phenoloxidase inhibitors. Biochem Biophys Res Commun 184: 8692.
  • Zhu, Y., Wang, Y., Gorman, M.J., Jiang, H. and Kanost, M.R. (2003) Manduca sexta serpin-3 regulates prophenoloxidase activation in response to infection by inhibiting prophenoloxidase-activating proteinases. J Biol Chem 278: 4655646564.