SEARCH

SEARCH BY CITATION

Keywords:

  • Acyrthosiphon pisum;
  • Buchnera aphidicola;
  • insect;
  • nucleotide synthesis;
  • purine salvage;
  • pea aphid;
  • symbiosis

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. Conflicts of interest
  9. References
  10. Supporting Information

The purine salvage pathway recycles purines to nucleotides, promoting efficient utilization of purine nucleotides. Exceptionally among animals with completely sequenced genomes, the pea aphid lacks key purine recycling genes that code for purine nucleoside phosphorylase and adenosine deaminase, indicating that the aphid can neither metabolize nucleosides to the corresponding purines, nor adenosine to inosine. Purine metabolism genes in the symbiotic bacterium Buchnera complement aphid genes, and Buchnera can meet its nucleotide requirement from aphid-derived guanosine. Buchnera demand for nucleosides may have relaxed the selection for purine recycling in the aphid, leading to the loss of key aphid purine salvage genes. Further, the coupled purine metabolism of aphid and Buchnera could contribute to the dependence of the pea aphid on this symbiosis.


Abbreviations used in text and figures:
AMP

Adenosine monophosphate

IMP

Inosine monophosphate

XMP

Xanthosine monophosphate

GMP

Guanosine monophosphate

AICAR

Aminoimidazole carboxamide ribonucleotide

PRPP

Phosphoribosyl pyrophosphate

APRT

adenine phosphoribosyltransferase

deoD

Purine nucleoside phosphorylase

deoB

Phosphopentomutase

gpt

Xanthine-guanine phosphoribosyltransferase

hpt

Hypoxanthine phosphoribosyltransferase

guaC

GMP reductase

purH

Phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase

purA

Adenylosuccinate synthase

purB

Adenylosuccinate lyase

SAM

S-adenosylmethionine

dcSAM

decarboxylated S-adenosylmethionine (S-adenosylmethioninamine)

speD

SAM decarboxylase

speE

Spermidine synthase

pfs

5′-Methylthioadenosine nucleosidase

Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. Conflicts of interest
  9. References
  10. Supporting Information

Purines are crucially important as precursors of nucleotides that make up DNA and RNA, signalling molecules (e.g. cAMP, GMP) and the central energy currency, ATP. In many insects, purine metabolism is modified to accommodate the high flux from inosine monophosphate (IMP) to uric acid. This modification reflects the role of uric acid as the principal vehicle for the excretion of excess nitrogen in many terrestrial insects, although some terrestrial insects utilize ammonia as a nitrogen excretory compound (Prusch, 1971; Mullins & Cochran, 1972; Harrison & Phillips, 1992). Furthermore, uric acid is synthesized by insects for various functions other than nitrogen excretion, including epidermal pigment, reflectors in the compound eye, dynamic nitrogen store and as an anti-oxidant (Mullins & Cochran, 1972; Hilliker et al., 1992; Souza et al., 1997; Ninomiya et al., 2006).

The purine metabolism of aphids is of particular interest for two reasons. First, uric acid is undetectable in both the tissues and honeydew (excreta) of aphids, and ammonia is the principal aphid excretory compound (Whitehead et al., 1992; Sasaki & Ishikawa, 1993) which raises the possibility that purine metabolism in this group may differ from that of many insects. Second, most aphids of the family Aphididae live in an obligate symbiosis with a vertically transmitted γ-proteobacterium, Buchnera aphidicola, from which they derive essential amino acids. Because the Buchnera cells are intracellular (restricted to specific insect cells known as bacteriocytes), they derive their total nutritional requirement from the cytoplasm of aphid cells. This requirement is predicted to include certain purines because the genetic capacity of Buchnera for purine metabolism is reduced, including proximal truncation of purine biosynthesis and an inability to synthesize GMP (inferred from annotated gene content of Buchnera: Shigenobu et al., 2000 and http://www.buchnera.org). Furthermore, an in silico analysis of the metabolite flux through the reconstructed metabolic network of Buchnera consistently found a net production of adenine (Thomas et al., 2009) that, if displayed by Buchnera in vivo, would be made available to the aphid. Inspection of the metabolic reconstruction of Buchnera revealed that the adenine is derived principally from polyamine metabolism, thereby linking purine and polyamine metabolism of the two organisms. To summarize, these data suggest that the purine metabolism of aphids might have distinctive features linked to their relationship with Buchnera and to the central role of ammonia, and not uric acid, in aphid nitrogen excretion.

The complete sequence of the pea aphid genome has recently become available (International Aphid Genomics Consortium, 2010), providing the opportunity to annotate the complement of genes in purine metabolism. An initial automated analysis based on the Kyoto Encyclopedia of Genes and Genomes (KEGG) indicated that the pea aphid has fewer genes of purine metabolism than Drosophila melanogaster, but that the two insects have comparable complements of pyrimidine metabolism genes (P.D. Ashton, pers. observ.). The purpose of this study was two-fold: first, to provide a manual annotation of purine metabolism in the pea aphid, linking the aphid gene complement to the genetic capacity of Buchnera for purine metabolism; and, second, to investigate the implications of the predicted export of adenine from Buchnera (see above) for the purine metabolism of the aphid, including a quantitative analysis by flux balance analysis. Linked to the evidence that the Buchnera-derived adenine is generated by polyamine metabolism, this second purpose led to an analysis of the genetic capacity of the aphid for the metabolism of polyamines and its precursor, ornithine, which is a component of the urea cycle in many animals.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. Conflicts of interest
  9. References
  10. Supporting Information

Aphid purine metabolism

Manual annotation revealed that the pea aphid has orthologues of the D. melanogaster genes mediating the synthesis and degradation of pyrimidines and also purine synthesis, but apparently lacks the genes for three enzymes in the purine salvage pathway by which nucleosides and free bases are recycled to nucleotides (Table S1). These enzymes are: hypoxanthine-guanine phosphoribosyltransferase (HGPRT), also absent from all other insects with completely sequenced genomes; adenosine deaminase (ADA); and purine nucleoside phosphorylase (PNP), which are present in all other animals with sequenced genomes (Fig. 1). Consistent with this conclusion from the genome sequence, the sequences homologous to the genes for HGPRT, ADA and PNP in other animals are absent from publicly available pea aphid expressed sequence tags (ESTs).

image

Figure 1. The purine salvage pathway and uric acid synthesis. The pea aphid genome apparently lacks genes for (1) hypoxanthine-guanine phosphoribosyltransferase (HGPRT), (2) purine nucleoside phosphorylase (PNP) and (3) adenosine deaminase (ADA). Reactions predicted not to occur in the pea aphid are indicated by dashed lines. ACYPI numbers of other genes coding enzymes in the purine salvage pathway are indicated. The six predicted 5′ nucleotidases have the gene IDs ACYPI002452, ACYPI007730, ACYPI003837, ACYPI010172, ACYPI001383, and ACYPI000648. Abbreviations of metabolite names are provided as a footnote on the first page of this paper.

Download figure to PowerPoint

In the absence of ADA and PNP, the pea aphid cannot salvage adenosine via inosine or guanosine via guanine, respectively. The pea aphid also lacks any ADA-like growth factors, unlike any other insect with a completely sequenced genome. Nevertheless, the pea aphid does have two genes for adenosine kinase (ACYPI008316 and ACYPI003989), by which adenosine can be recycled to AMP. It also has orthologues for two D. melanogaster nucleoside hydrolase genes (ACYPI006571 orthologue of CGCG11158, and ACYPI009203 orthologue of CGCG5418) but these genes are most unlikely to compensate for the absence of PNP because the preferred substrates of these enzymes are inosine and the pyrimidine nucleoside uridine. Futhermore, the 170 000 publicly available pea aphid ESTs include just two ESTs (EX616623 and EX649536) for the nucleoside hydrolase ACYPI006571 and none for ACYPI009203, suggesting that these nucleoside hydrolases are minimally expressed. The broad implication of these findings is that the pea aphid has an incomplete genetic capacity for purine salvage.

The pea aphid has the genetic capacity to synthesize uric acid from IMP, by means of 5′-nucleotidase (ACYPI002452, ACYPI007730, ACYPI003837, ACYPI010172, ACYPI001383, and ACYPI000648), inosine hydrolase (ACYPI006571 and ACYPI009203), and xanthine dehydrogenase (ACYPI009885), but the genes for urate oxidase and subsequent reactions in uric acid degradation are absent (Fig. 1).

Buchnera purine metabolism and shared genetic capacity for purine salvage between the aphid and Buchnera

We then compared the reconstructed pathways of purine metabolism in the pea aphid and Buchnera. The Buchnera genome codes for fragments of the purine salvage pathway that, when considered in isolation, do not suggest any important physiological function (Thomas et al., 2009). However, Buchnera has a remarkable complementarity to the genes of the salvage pathway of the aphid. In particular, Buchnera, but not the aphid, has the genetic capability to recycle the nucleoside guanosine to a nucleotide and, thereby, to provision fully the purine nucleotide requirement of Buchnera. Figure 2 shows the reconstruction of this capability, based on Buchnera gene content.

image

Figure 2. Metabolic capabilities of the symbiotic bacterium Buchnera, as deduced from its gene content (shown in italics). The proposed uptake of guanosine and inosine by the bacterium is indicated by a dashed line.

Download figure to PowerPoint

The key Buchnera genes involved in recycling aphid-derived purines are deoDB, gpt/hpt, guaC and purHAB. The deoDB genes code for the terminal two reactions of the purine salvage pathway: the DeoD protein splits purine ribonucleosides to purines and ribose-1-phosphate, and DeoB converts the ribose-1-phosphate to ribose-5-phosphate (Fig. 2). Production of this central metabolite allows the Buchnera to fully recycle the sugar component of the purine ribonucleoside. The purines released from the DeoD reaction are metabolized to the corresponding nucleotides by phosphoribosyltransferases encoded by gpt and hpt. The substrate specificities of Escherichia coli Hpt and Gpt overlap: Hpt utilises hypoxanthine primarily, but can also use guanine (Guddat et al., 2002), while Gpt strongly prefers guanine but can use xanthine and hypoxanthine as substrates (Deo et al., 1985). Our reconstruction of nucleotide synthesis from aphid-derived guanosine (Fig. 2) makes IMP a key intermediate metabolite for Buchnera, generated from both GMP and from the by-product of histidine biosynthetic pathway, AICAR. As DeoD can function with inosine, it is also possible that the IMP pool can be fed by aphid-derived inosine, but this alone is not sufficient for purine provisioning as GMP cannot be made from IMP.

A key prediction of the reconstruction in Fig. 2 is that Buchnera has high demand for aphid-derived nucleosides, especially guanosine. We identified six pea aphid genes encoding 5′-nucleotidases (legend to Fig. 1), two of which (ACYPI002452 and ACYPI007730) were originally detected in the transcriptome analysis of the bacteriocyte, the aphid cell that houses Buchnera (Nakabachi et al., 2005). The expression levels of four 5′-nucleotidases in the bacteriocyte were analysed by real-time quantitative reverse transcription (RT)-PCR (Fig. 3). Expression of three of the four genes (ACYPI010172, ACYPI002452, and ACYPI007730) was significantly elevated in bacteriocytes relative to the whole body (Mann-Whitney u-test; PL001). The transcript of ACYPI003837 was less abundant in the bacteriocyte than in the whole body (Mann-Whitney U-test; p < 0.01), and the overall expression level of this gene was low (Fig. 3).

image

Figure 3. Expression of pea aphid 5′-nucleotidase genes in the whole insect and the bacteriocyte; bars, standard errors (n= 6). The expression levels are shown in terms of mRNA copies of target genes per copy of mRNA for RpL7. Asterisks indicate statistically significant differences (Mann–Whitney U-test; **p < 0.01).

Download figure to PowerPoint

The metabolic complementarity of the pea aphid and Buchnera extends to their capacity to utilize the purine adenine, and generates the potential for the aphid and Buchnera to have a shared pathway for the recycling of aphid-derived nucleosides to nucleotides. As described in the Introduction and above, Buchnera cells are predicted to produce adenine, and have no genetic capacity to utilize this purine, while the aphid can recycle it to the nucleotide AMP via APRT (Fig. 4).

image

Figure 4. Polyamine metabolism in Buchnera. The proposed uptake of putrescine and export of adenine by the bacterium is indicated by dashed line. Aphid genes potentially involved in providing putrescine for Buchnera spermidine synthesis, and in recycling the byproduct adenine, are indicated by ACYPI number. The metabolic fate of 5′-methylthioribose produced by Buchnera is unknown.

Download figure to PowerPoint

We investigated the quantitative importance of adenine recycling by flux balance analysis. Initial analysis revealed that adenine is generated principally as a byproduct of polyamine synthesis. Previous experimental work has shown that the dominant polyamine of Buchnera is spermidine (Nakabachi & Ishikawa, 2000) at an estimated concentration of 64 nmol/mg dry weight of Buchnera (Supplementary text). When flux through the metabolic network of Buchnera was quantified in silico by flux balance analysis, 90% of the nucleoside acquired by Buchnera was metabolized to nucleotides and 10% was metabolized to adenine and made available for recycling back to the aphid.

This putative recycling of adenine via Buchnera-mediated synthesis of spermidine is dependent on aphid-derived putrescine as a substrate because Buchnera lacks the genetic capacity for de novo polyamine biosynthesis (Nakabachi & Ishikawa, 2000). The pea aphid has the capacity to synthesize putrescine from ornithine, possessing two genes for ornithine decarboxylase, (ACYPI002369, ACYPI008106; see Table S1). A second metabolic source of ornithine in various insects is the urea cycle, specifically arginase-mediated breakdown of arginine to ornithine and urea. Other insects with completely sequenced genomes have all the genes in the urea cycle, apart from ornithine transcarbamylase (OTC), which produces citrulline from ornithine and carbamyl phosphate. The pea aphid also lacks this gene and, exceptionally among the insects, the urea cycle genes coding for arginosuccinate synthase, arginosuccinate lyase and arginase, with the implication that it cannot synthesize either ornithine or urea by this route (Table S1). The pea aphid does, however, retain the gene for nitric oxide synthase (ACYPI001689).

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. Conflicts of interest
  9. References
  10. Supporting Information

The purine salvage pathway functions to recycle nucleosides and free bases to nucleotides. The incomplete genetic capacity for this pathway in the pea aphid is exceptional among animals. The absence of PNP and ADA precludes, first, the flux of purine nitrogen from guanosine and adenosine to uric acid and, second, the salvage of all nucleosides and purines apart from adenosine and adenine (Fig. 1). A possible explanation for the evolutionary loss of these genes arises from the remarkable complementarity between the purine metabolic capabilities of the pea aphid and its symbiotic bacterium Buchnera, as illustrated in Fig. 2. We specifically propose that aphid-derived guanosine is the principal source of purines for Buchnera, on the basis of two considerations. First, Buchnera, unlike many other bacteria including its free-living relative E. coli, cannot synthesize the carbon skeleton of purines de novo from PRPP, but has the genetic capacity to synthesize the total nucleotide complement from guanosine via the genes deoD, gpt, hpt, guaC and purAB (Fig. 2). Published microarray analyses (Viñuelas et al., 2007) confirm that these Buchnera genes are expressed. Second, nucleosides, but not nucleotides, are readily transported across biological membranes (de Koning et al., 2005). Although the identity of the putative nucleoside transporters in the bacteriocyte remain to be identified, an indication of the significance of Buchnera demand for nucleosides comes from the elevated expression of 5′-nucleotidase genes, especially ACYPI1002452, in the bacteriocyte relative to the insect body (Fig. 3).

We hypothesize that the insect in the ancestral symbiosis with Buchnera had an intact purine salvage pathway, as occurs in other insects with sequenced genomes. The transfer of guanosine to bacterial cells would compete with uric acid synthesis (Fig. 1), raising the possibility that reduced activity of the enzymes PNP and ADA, followed by the loss of the cognate genes, were adaptations of the aphid to ensure supply of nucleosides to the bacteria. The evidence from flux balance analysis of the reconstructed metabolic network of Buchnera suggests, further, that approximately 10% of the purine skeleton delivered to the bacteria is recycled via adenine (Fig. 4). This would account for the retention of the aphid gene for APRT, and can potentially contribute to the purine economy of the aphid.

There are two important implications of the proposed coupling of purine metabolism between the pea aphid and Buchnera. First, the aphid is dependent on its bacterial symbionts for the metabolism of nucleosides. We propose that pea aphids experimentally deprived of their bacteria by antibiotic treatment accumulate nucleosides with deleterious consequences. Buchnera is widely recognized to contribute to aphid metabolism and nutrition by their synthesis of essential amino acids, nutrients in short supply in the aphid diet of plant phloem sap (Gündüz & Douglas, 2009), but it has previously been unclear why pea aphids lacking Buchnera fail to grow or reproduce when reared on diets with ample essential amino acids (e.g. Prosser & Douglas, 1992). The genomic data obtained in this study suggest that an incomplete capacity for purine metabolism may contribute to dependence of pea aphids on their complement of Buchnera.

The second implication of the coupled purine metabolism of the aphid and Buchnera is that the aphid is predicted to have very limited capacity to synthesize uric acid, which is a major excretory product of many insects. One great advantage of uric acid as a vehicle for nitrogen excretion is that it can be voided as a solid, so minimizing water loss. This is not relevant for aphids, which utilize the water-rich diet of plant phloem sap and eliminate all waste in liquid honeydew. Consistent with these considerations, uric acid is undetectable in the carcass and honeydew of pea aphids in laboratory culture (Sasaki & Ishikawa, 1993). Nevertheless, the aphid has the gene for xanthine dehydrogenase, which catalyses uric acid synthesis. Although expression of this gene is minimal in laboratory-reared aphids (as indicated by the few ESTs for this gene), uric acid production may be important under certain field conditions, for example linked to its function as an anti-oxidant or regulator of cation concentrations (see Introduction). The apparent absence of pea aphid genes for urate oxidase and subsequent reactions in uric acid degradation matches the condition reported in Tribolium castaneum and Apis mellifera, and differs from D. melanogaster and other dipterans with sequenced genomes, which have the capacity to degrade uric acid to allantoin, allantoic acid and in some species to urea (Scaraffia et al., 2008).

In conclusion, the pea aphid is unique among the many insects with symbiotic microorganisms in that the genomes of both insect and microbial partners are fully sequenced and annotated. This offers unique opportunities for the construction and testing of specific hypotheses. As an example, our annotation of purine metabolism genes has generated the hypotheses that purine metabolites are exchanged between the aphid and Buchnera bacteria, and that imbalance of purine metabolites contributes to the poor performance of aphids deprived of their symbiotic bacteria. We are currently testing these hypotheses experimentally by the metabolite analysis of the symbiotic partners.

Experimental procedures

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. Conflicts of interest
  9. References
  10. Supporting Information

Manual annotation of genes

Refseq protein IDs for Drosophila genes involved in nucleotide and urea cycle metabolism were retrieved from the KEGG pathway database and FlyBase. The corresponding Drosophila protein sequences were retrieved in fasta format from NCBI using Batch Entrez. These protein sequences were used as blast queries against: (1) the A. pisum merged Glean/Refseq protein database (blastp, evalue cutoff = 1E-3) and (2) the A. pisum whole genome sequence (tblastn, evalue cutoff = 1E-3). The A. pisum gene corresponding to the best Glean/Refseq protein hit was taken as the A. pisum orthologue of each Drosophila gene. If no hits to a Drosophila protein were found in the set of predicted A. pisum proteins or in the whole genome sequence, the A. pisum genome is predicted to lack an orthologue of the corresponding Drosophila gene.

Flux balance analysis

The published in silico metabolic reconstruction of Buchnera, iGT196 (Thomas et al., 2009), was modified to match the purine metabolism predicted from this study: first, the adenosine exchange reaction EX_adn was removed, thereby limiting the source of external nucleoside to guanosine (as in Fig. 4); and second, the phosphopentomutase reaction PPM mediating conversion of ribose-1-phosphate to ribose-5-phosphate and coded for by deoB was added, allowing the Buchnera to metabolize the sugar component of the nucleoside through central metabolism via the pentose phosphate pathway. In addition, the stoichiometric coefficient for spermidine in the biomass reaction, VGRO, was increased from 0.007 (the value derived from the data of Reed et al., 2003 based on their metabolic reconstruction of E. coli K-12) to 0.05, to match the empirically determined concentration of spermidine in Buchnera cells (see Nakabachi & Ishikawa, 2001 and Supplementary text). Flux balance analysis was carried out using the COBRA toolbox software (Becker et al., 2007) running in MATLAB, and the network was optimised for maximal biomass while releasing essential amino acids at empirically determined rates (as in Thomas et al., 2009). The biomass production of the modified model was 5.20, as compared to 5.21 for iGT196.

Real-time quantitative reverse-transcription-PCR

Strain ISO, a parthenogenetic clone of the pea aphid that is free from secondary symbionts, was used for the analysis. The insects were reared on Vicia faba at 15 °C in a long-day regime of 16 h light and 8 h dark. RNA was isolated from whole bodies and bacteriocytes of 12–15-day-old parthenogenetic apterous adults using TRIzol reagent, followed by RNase-free DNase I treatment. Each whole body sample and bacteriocyte sample were derived from one individual and a batch of bacteriocytes that were collected from about ten individuals, respectively. First-strand cDNAs were synthesized using pd(N)6 primer and PrimeScript reverse transcriptase (Takara, Kyoto, Japan). Quantification was performed with the LightCycler instrument and FastStart DNA MasterPLUS SYBR Green I kit (Roche, Indianapolis, IN, USA), as described previously (Nakabachi et al., 2005). The running parameters were: 95 °C for 10 min, followed by 45 cycles of 95 °C for 10 s, 55 °C for 5 s, and 72 °C for 4 s. The primers used are shown in Table 1. Results were analysed using the LightCycler software version 3.5 (Roche), and relative expression levels were normalized to mRNA for the ribosomal protein RpL7. Statistical analyses were performed using the Mann–Whitney U-test.

Table 1.  Primers used for real-time quantitative reverse transcription-PCR
GeneForward primer (5′– 3′)Reverse primer (5′– 3′)
ACYPI0101721306F1396R
AAAACTACGAGACGATGGCGTTAGTCTTCCACTTCCCTGGCAAT
ACYPI003837475F555R
ATTGGGCGTACAGCCGTAGAATAGGAATCCGCTATCAGGTTTCC
ACYPI002452810F895R
TTGCCAGAAATCCCTTCGGTTGCCAGAATGTCCCAACGCTATG
ACYPI007730384F465R
CAACACGCTGTTCAATTTGCCAGCCTCGAGTAGTTTGGCGAAG

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. Conflicts of interest
  9. References
  10. Supporting Information

We thank Dr Jeff Scott, Cornell University, for his comments on the manuscript. This study was supported in part by ANR-BBSRC SysBio (grant number: BB/F005342/1) (GHT), Grant-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology of Japan (AN), USDA grant number 2005-35604-15446 (GJ and JSR) and the Sarkaria Institute of Insect Physiology and Toxicology (AED).

Conflicts of interest

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. Conflicts of interest
  9. References
  10. Supporting Information

Georg Jander has been a consultant at Mosanto within the last two years and received a fee.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. Conflicts of interest
  9. References
  10. Supporting Information
  • Becker, S.A., Feist, A.M., Mo, M.L., Hannum, G., Palsson, B.O. and Herrgard, M.J. (2007) Quantitative prediction of cellular metabolism with constraint-based models: the COBRA toolbox. Nat Protoc 2: 727738.
  • Deo, S.S., Tseng, W.C., Saini, R., Coles, R.S. and Athwal, R.S. (1985) Purification and characterization of Escherichia coli xanthine-guanine phosphoribosyltransferase produced by plasmid pSV2gpt. Biochim Biophys Acta 839 (3): 233239.
  • Guddat, L.W., Vos, S., Martin, J.L., Keough, D.T. and De Jersey, J. (2002) Crystal structures of free, IMP-, and GMP-bound Escherichia coli hypoxanthine phosphoribosyltransferase. Protein Sci 11 (7): 16261638.
  • Gündüz, E.A. and Douglas, A.E. (2009) Symbiotic bacteria enable insect to utilise a nutritionally-inadequate diet. Proc R Soc Lond B Biol Sci 276: 987991.
  • Harrison, J.F. and Phillips, J.E. (1992) Recovery from acute haemolymph acidosis in unfed locusts. II. Role of ammonium and titratable acid excretion. J Exp Biol 165: 97110.
  • Hilliker, A.J., Duyf, B., Evans, D. and Phillips, J.P. (1992) Urate null rosy mutants of Drosophila melanogaster are hypersensitive to oxygen stress. Proc Natl Acad Sci USA 89: 43434347.
  • International Aphid Genomics Consortium (2010) Genome sequence of the pea aphid Acyrthosiphon pisum. PLoS Biol, DOI 10.1371/journal.pbio.1000313.
  • De Koning, H.P., Bridges, D.J. and Burchmore, R.J.S. (2005) Purine and pyrimidine transport in pathogenic protozoa: from biology to therapy. FEMS Microbiol Rev 29: 9871020.
  • Mullins, D.E. and Cochran, D.G. (1972) Nitrogen excretion in cockroaches – uric acid is not a major product. Science 177: 699.
  • Nakabachi, A. and Ishikawa, H. (2000) Polyamine composition and expression of genes related to polyamine biosynthesis in an aphid endosymbiont, Buchnera. Appl Environ Microbiol 66 (8): 33053309.
  • Nakabachi, A. and Ishikawa, H. (2001) Expression of host S-adenosylmethionine decarboxylase gene and polyamine composition in aphid bacteriocytes. Insect Biochem Mol Biol 31: 491496.
  • Nakabachi, A., Shigenobu, S., Sakazume, N., Shiraki, T., Hayashizaki, Y., Carninci, P. et al. (2005) Transcriptome analysis of the aphid bacteriocyte, the symbiotic host cell that harbors an endocellular mutualistic bacterium, Buchnera. Proc Natl Acad Sci USA 102 (15): 54775482.
  • Ninomiya, Y., Tanaka, K. and Hayakawa, Y. (2006) Mechanisms of black and white stripe pattern formation in the cuticle of insect larvae. J Insect Physiol 52: 638645.
  • Prosser, W.A. and Douglas, A.E. (1992) A test of the hypotheses that nitrogen is upgraded and recycled in an aphid (Acyrthosiphon pisum) symbiosis. J Insect Physiol 38: 9399.
  • Prusch, R.D. (1971) The site of ammonia excretion in the blowfly larva, Sarcophaga bullata. Comp Biochem Physiol 39A: 761767.
  • Reed, J.L., Vo, T.D., Schilling, C.H. and Palsson, B.O. (2003) An expanded genome-scale model of Escherichia coli K-12 (iJR904 GSM/GPR). Genome Biol 4: R54.
  • Sasaki, T. and Ishikawa, H. (1993) Nitrogen recycling in the endosymbiotic system of the pea aphid Acyrthosiphon pisum. Zoolog Sci 10: 779785.
  • Scaraffia, P.Y., Tan, G., Isoe, J., Wysocki, V.H., Wells, M.A. and Miesfeld, R.L. (2008) Discovery of an alternate pathway for urea synthesis in adult Aedes aegypti mosquitoes. Proc Natl Acad Sci USA 105: 518523.
  • Shigenobu, S., Watanabe, H., Hattori, M., Sasaki, Y. and Ishikawa, H. (2000) Genome sequence of the endocellular bacterial symbiont of aphids Buchnera sp. APS. Nature 407: 8186.
  • Souza, A.V.G., Petretski, J.H., Demasi, M., Bechara, E.J.H. and Oliveira, P.L. (1997) Urate protects a blood-sucking insect against hemin-induced oxidative stress. Free Radic Biol Med 22: 209214.
  • Thomas, G.H., Zucker, J., Sorokin, A., Goryanin, I. and Douglas, A.E. (2009) A fragile metabolic network adapted for cooperation in the symbiotic bacterium Buchnera aphidicola. BMC Syst Biol 3: 24.
  • Viñuelas, J., Calevro, F., Remond, D., Bernillon, J., Rahbé, Y., Febvay, G. et al. (2007) Conservation of the links between gene transcription and chromosomal organization in the highly reduced genome of Buchnera aphidicola APS. BMC Genomics 8: 143.
  • Whitehead, L.F., Wilkinson, T.L. and Douglas, A.E. (1992) Nitrogen recycling in the pea aphid (Acyrthosiphon pisum) symbiosis. Proc R Soc Lond B Biol Sci 250: 115117.

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. Conflicts of interest
  9. References
  10. Supporting Information

Table S1.Acyrthosiphon pisum genes involved in purine metabolism and the urea cycle

Supplementary text. Calculation of the stoichiometric coefficient of spermidine for flux balance analysis of Buchnera.

Please note: Wiley-Blackwell are not responsible for the content or functionality of any supporting materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.

FilenameFormatSizeDescription
IMB_945_sm_suppl_text.pdf11KSupporting info item
IMB_945_sm_Table_S1.pdf150KSupporting info item

Please note: Neither the Editors nor Wiley Blackwell are responsible for the content or functionality of any supporting materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.