SEARCH

SEARCH BY CITATION

Keywords:

  • Lutjanus guttatus;
  • Photobacterium;
  • rep-PCR;
  • Vibrio

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and Discussion
  6. Acknowledgements
  7. References

Aim:  To characterize and identify vibrios present in wild and cultured juvenile snappers (Lutjanus guttatus) in northwestern Mexico.

Methods and Results:  Spotted rose snapper juveniles were collected at four localities in northwestern Mexico. Bacteria were isolated from external lesions, kidney, liver, and spleen from cultured and wild caught organisms. In total, 280 isolates were obtained and fingerprinted with rep-PCR (GTG5). Nearly 93·2% of the strains belonged to the Vibrionaceae family. Species and genera identified were Photobacterium damselae subsp. damselae (76 strains), Photobacterium leiognathi (13), Vibrio sp. (24), Vibrio alginolyticus (12), Vibrio campbellii (19), Vibrio fortis (9), Vibrio harveyi (49), Vibrio ichthyoenteri (4), Vibrio mediterranei (4), Vibrio parahaemolyticus (1), Vibrio ponticus (2), Vibrio rotiferianus (22), and four potential new species.

Conclusions:  A wide diversity of vibrios was found in the external lesions and internal organs of both wild and cultured spotted rose snapper juveniles. In total, 12 species of vibrios and four potential new species were identified.

Significance and Impact of the Study:  This is the first study on the vibrios present in the spotted rose snapper and therefore might serve as a basis for future studies and diagnosis.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and Discussion
  6. Acknowledgements
  7. References

The snapper family represents an important fisheries resource in tropical and subtropical areas and as with many of our world fish stocks, most snapper fisheries are being harvested at or beyond their maximum sustainable yield. Because of their wide acceptance as an excellent food fish, high market price, and limited harvests from wild stocks, there is considerable interest in culturing a variety of snapper species (Stickney 2000).

The spotted rose snapper, Lutjanus guttatus, Steindachner, 1869 is found along the Pacific coast from Gulf of California to Peru including Galapagos Islands (Allen 1985; Froese and Pauly 2005). It is an economically important artisanal fishery along the northwest coast of Mexico. Nowadays, wild juveniles of red snappers are being cultured in floating cages in different areas of the Pacific coast and the recent advances about their biotechnology have shown that this species could be a promising aquaculture candidate (Garcia-Ortega et al. 2005).

The family Vibrionaceae contains several species of importance to the culture of aquatic organisms. Several strains of many species have been reported as pathogens for fish, molluscs, and crustaceans under culture (Austin 1988; Hjeltnes and Roberts 1993; Lightner 1993). But most species are also natural inhabitants of marine, estuarine, and aquaculture systems, and some even have been reported as probiotics (Gomez-Gil et al. 2000). Almost no information exists on the occurrence of vibrios, or any other bacteria, in wild and cultured snappers. Therefore, is important to analyse the vibrios present in this potential new species for culture, to know the ‘normal’ bacterioflora and be able to identify potential pathogens when they arise. The aim of this study is to characterize and identify vibrios present in wild and cultured juvenile snappers (L. guttatus) in northwestern Mexico.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and Discussion
  6. Acknowledgements
  7. References

Lutjanus guttatus were captured alive from several locations in the Pacific Northwest of Mexico. In the state of Nayarit (Matanchen Bay, San Blas, N21°25′09′′, W105°12′08′′), fishes were caught from culture cages during October 2004. Organisms were bought alive from fishermen in Sinaloa (Mazatlan, N23°14′42′′, W107°31′29′′), during November 2003 and March, April, May, June, September, and October 2004, and in Colima (Manzanillo, N19°03′10′′, W104°19′16′′) during February and April 2003. Cultured snappers in circular tanks were also sampled at CIAD, A.C. (Mazatlan, N23°18′13′′, W107°31′08′′). Only the fishes collected in Manzanillo showed external lesions consisting of loosened scales with necrotic skin leaving round open sores of 10 mm in diameter in the region of the pectoral fin and caudal peduncle. All other organisms had no signs of disease. Mean total length was 20·47 cm (SD 1·34, Max. 22·5, Min. 18·0, n = 23), mean total weight was 110·43 g (SD 19·75, Max. 148·00, Min. 72·00, n = 23).

The fish were transported alive to CIAD's facilities in Mazatlan, Sinaloa, and were dissected. Transportation times were around 6–7 h for fishes from Nayarit and Colima, and half an hour for the ones from Mazatlan. They were transported in an insulated container with constant air supply but no temperature control. Samples of the liver, spleen, kidney, and external lesions were collected aseptically with a bacteriological loop and streaked onto thiosulfate citrate bile-salt sucrose (TCBS; Merck, Whitehouse Station, NJ, USA) and glutamate starch phenol-red (GSP; Merck) agars. The plates were incubated for 20 h at 30°C and the colonies were purified in TCBS (Merck) and trypticase soy agar (TSA; Bioxon, Mexico City, Mexico) plus 2·0% NaCl.

All the strains were deposited at the Collection of Aquatic Important Microorganisms (CAIM, http://www.ciad.mx/caim) and were cryopreserved at −70°C in trypticase soy broth (TSB; Bioxon) plus 15·0% glycerol in glass beads (Gherna 1994) until further analysis. A complete list of the strains isolated is available as supplementary data. DNA was extracted with the Promega Wizard DNA extraction kit (Promega, Madison, WI, USA) according to the manufacturer's instructions, but grown in Luria-Bertani (LB) + 2·5% NaCl. The DNA obtained was adjusted to 50 ng ml−1 spectrophotometrically.

DNA fingerprinting of all the strains was done with rep-PCR using the (GTG)5 primer (Gomez-Gil et al. 2004) and the PCR amplification was performed as described earlier (Wong and Lin 2001) with the AmpliTaq® DNA polymerase enzyme (Applied Biosystems, Foster City, CA, USA). PCR products were electrophoresed in 2·25% of 20 × 20 cm agarose gels for 18 h at 55 V and at 4–8°C. The gels were stained with ethidium bromide and visualized after integration in a gel documentation system (UVP). TIFF files obtained were analysed with the GelCompar II software (Ver. 4·5, Applied Maths), the similarity matrix was calculated with the Jaccard coefficient as recommended by Kosman and Leonard (2005), and the dendrogram was constructed with Ward (optimization 0·35, position tolerance of 0·59%). Type and reference strains of practically all species of the Vibrionaceae were incorporated into the analysis, as well as many strains from other origins (>1100 strains in total). This comprehensive analysis permitted to leave for the final snapper strains analysis (presented here) only those type and reference strains relevant to the snapper strains. Otherwise, the clusters could be biased because of the relative small number of snapper strains analysed.

Clusters that did not include type or reference strains were further analysed by sequencing the 16S rRNA gene of representative strains. Primers were designed to amplify approximately the first 560 bp of the Vibrionaceae gene but an M13 tail (underlined) was added to be able to make a direct amplification (without cloning); primers employed were: V16Seq-1_M13f 5′CACGACGTTGTAGTAAAACGACGAGAGTTTGATCATGGCTCAG 3′ V16Seq-1_M13r 5′GGATAACAATTTCACACAGGCTCGCACCCTCCGTATTACC 3′. Additionally, the almost complete 16S rRNA sequence (around 1500 bp) was obtained with the following primers for the second and third segments of the gene, respectively. V16S-502f-M13 5′CACGACGTTGTAAAACGACGCAGAAGAAGCACCGGCTAAC 3′, V16S-1100r-M13 5′GGATAACAATTTCACACAGGCCCAACATTTCACAACACGA 3′, and V16S-977f-M13 5′CACGACGTTGTAAAACGACGCAACGCGAAGAACCTTACCT 3′, V16S-1520r-M13 5′GGATAACAATTTCACACAGGGCTACCTTGTTACGACTTCACC 3′. All segments of the 16S rRNA were amplified by PCR with 1·25 μl of 10X buffer (Promega), 0·75 μl of MgCl2 (25 mmol l−1; Promega), 0·66 μl of dNTPs (2·5 mmol l−1 each), 0·13 μl of each primer (0·25 μμl−1), 8·48 μl of water, 1·0 μl of target DNA (50 ng ml−1), and 0·1 μl of Taq polymerase (Promega 5U) for a final volume of 12·5 μl. Amplification parameters were initial melting at 94°C for 2 min followed by 35 cycles of 94°C for 1 min, 70°C for 1 min, and 72°C for 1 min, and a final extension at 72°C for 5 min. Products were run in a 2·0 % agarose gel (90 V for 30 min), the c. 560 bp band obtained was purified with the QIAquick Gel Extraction Kit (Qiagen, Germany) according to the manufacturer's instructions. This step was done as sometimes an extra faint band could be detected in the gel and without purification, the sequence was not as clear as the purified band.

Exactly 1·0 μl of the purified product was used for sequencing with the SequiTherm Excell DNA sequencing kit (Epicenter Biotechnologies, Madison, WI, USA) with M13 primers as recommended by the manufacturer. Final products were sequenced in a 6·5 % polyacrilamide gel with the Li-cor IR2 sequencer (Li-Cor, Lincoln, NE, USA). Sequences were analysed with the BioEdit software version 7·0·5 (Hall 1999) and deposited at Genbank.

Phenotypic characteristics were obtained from some strains to distinguish between the two subspecies of Photobacterium damselae (Thyssen et al. 1998). Strains that did not cluster were also phenotypically characterized to identify whether they belong to the Vibrio genus. These strains were analysed for Gram stain, motility, glucose metabolism (OF test), oxidase production, sensitivity to the vibriostatic compound 0/129 (150 μg), and utilization of d-mannitol (Holt et al. 1994).

Results and Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and Discussion
  6. Acknowledgements
  7. References

A total of 280 pure strains were obtained from wild and cultured snappers (Table 1); 92 strains were isolated from GSP agar and 147 from TCBS agar. From 41 isolates the medium employed was not registered. Two hundred and twenty-six strains were isolated from 44 fishes caught off Mazatlan, 17 strains from Matanchen Bay from six fishes, 15 strains from Manzanillo (only from external lesions) from two fishes, and 22 strains from 21 cultured fishes in Mazatlan, for a total of 73 fishes sampled. Twenty strains were obtained from external lesions, 85 from the spleen, 93 from the liver, and 82 from the kidney. Thirty-four strains were isolated during 2003 and 246 during 2004.

Table 1.   Species of bacteria isolated from the spotted rose snapper (Lutjanus guttatus) in northwestern Mexico
LocalitySourceSpeciesNo. of strains
Matanchen Bay, Nayarit.LiverUnidentified3
Wild caughtShewanella sp.4
Vibrio harveyi1
Vibrio sp.1
SpleenUnidentified1
Aeromonas sp.1
Photobacterium damselae damselae2
V. harveyi3
Vibrio sp. nov. 11
Total 17
Manzanillo, Colima.External lesionVibrio campbellii4
Diseased, wild caughtV. harveyi9
Vibrio mediterranei1
Vibrio sp.1
Total 15
Mazatlán, Sinaloa.External lesionVibrio fortis1
CulturedVibrio sp. nov. 32
Vibrio sp.2
KidneyV. campbellii1
V. fortis2
Vibrio sp. nov. 31
LiverP. damselae damselae1
V. fortis4
V. harveyi1
Vibrio sp. nov. 32
SpleenAeromonas sp.1
P. damselae damselae1
Vibrio sp. nov. 33
Total 22
Mazatlán, Sinaloa.KidneyUnidentified1
Wild caughtP. damselae damselae20
Photobacterium leiognathi3
Vibrio alginolyticus5
V. campbellii5
V. fortis1
V. harveyi12
Vibrio ichthyoenteri4
V. mediterranei1
Vibrio ponticus1
Vibrio rotiferianus9
Vibrio sp. nov. 13
Vibrio sp. nov. 23
Vibrio sp. nov. 41
Vibrio sp.8
LiverUnidentified5
Aeromonas sp.2
P. damselae damselae28
P. leiognathi7
V. alginolyticus2
V. campbellii4
V. harveyi7
Vibrio parahaemolyticus1
V. ponticus1
V. rotiferianus5
Vibrio sp. nov. 11
Vibrio sp. nov. 23
Vibrio sp. nov. 43
Vibrio sp.6
SpleenUnidentified1
P. damselae damselae24
P. leiognathi3
V. alginolyticus5
V. campbellii5
V. fortis1
V. harveyi16
V. mediterranei1
V. rotiferianus8
Vibrio sp. nov. 12
Vibrio sp.6
Total226

The rep-PCR analysis with the (GTG)5 primer was only performed on the strains belonging to the Vibrionaceae family (261 strains, 93·2%). Type strains (four) and reference strains (nine) were also included in the analysis. Nineteen strains were not identified as members of the Vibrionaceae family [by (GTG)5 and phenotypic methods]. A total of 16 clusters (229 strains including all type and reference strains) and 32 unclustered strains were obtained (Fig. 1). Clusters were delineated roughly by 40–42% similarity (Jaccard) between strains with a 0·59% band position tolerance. Isolates were considered clones if their (GTG)5 similarity was above 90% when calculated with the Jaccard coefficient.

image

Figure 1.  Dendrogram of Vibrionaceae isolates of the spotted rose snapper (Lutjanus guttatus) from northwestern Mexico. Dendrogram generated with the Jaccard coefficient (similarity matrix) and constructed with Ward (optimization 0·35, position tolerance of 0·59%) from electrophoretic band patterns obtained with rep-PCR, (GTG)5 primer. Numbers in parentheses, isolates in that cluster; T, the type strain of the species; R, reference strain or strains of the species; 16S, strain or strains sequenced for the 16S rRNA gene; a and b, set of unclustered strains (see text for explanation). Scale, per cent similarity of dendrogram.

Download figure to PowerPoint

Species identified were P. damselae subsp. damselae (76 strains), Photobacterium leiognathi (13), Vibrio alginolyticus (12), Vibrio campbellii (19), Vibrio chagasii (1), Vibrio fortis (9), Vibrio harveyi (49), Vibrio ichthyoenteri (4), Vibrio mediterranei (4), Vibrio parahaemolyticus (1), Vibrio ponticus (2), and Vibrio rotiferianus (22). Four potential new species were detected, because of their low 16S rRNA similarity (around 97%) with known species and because they formed distinct clusters in the rep-PCR analysis, they were named Vibrio sp. nov. 1 (7), Vibrio sp. nov. 2 (6), Vibrio sp. nov. 3 (8), and Vibrio sp. nov. 4 (4). These four potential new species are pending further analysis to satisfy current requirements for new species descriptions (Stackebrandt et al. 2002). Twenty-five strains were identified only to the genus Vibrio but could not be placed in any snapper cluster or in the ones formed with the whole database. Also Aeromonas sp. (four strains), Shewanella sp. (four), and 11 unidentified strains were found.

Most of the species were found in all localities sampled (Table 1). The most diverse locality was Mazatlan (14 species identified), maybe because more strains (88·6%) were isolated from that locality. Even in Matanchen bay, with only 6·1% of the strains analysed, three species were found, 20% of the total number of species or genera identified. In Mazatlan, strains isolated from cultured organisms, yielded one species (Vibrio sp. nov. 3) that was not found anywhere else.

External lesions from diseased organisms caught in Manzanillo showed two dominant species, V. harveyi and V. campbellii, different from those found in lesions from otherwise healthy fishes from cultured organisms in Mazatlan (V. fortis and Vibrio sp. nov. 3); these same species were also found in the kidney, spleen, and liver of the cultured organisms.

Description of species

Photobacterium

Photobacterium damselae subsp. damselae (cluster 16). Seventy-six isolates (67 strains with nine clones) were identified by 16S rRNA similarities of five sequenced isolates (>99%; CAIM 1166, DQ437745; CAIM 1256, DQ437746; CAIM 1268, DQ437749; CAIM 1496, DQ437750; and CAIM 999, DQ437757). The subspecies was determined by phenotypic traits (positive for urease, motility, nitrate reduction, and growth at 37° and 42°C (Thyssen et al. 1998). The rep-PCR analysis permitted to identify nine isolates that were clones (Table 2) because they had more than 90% (GTG)5 similarity. They were all isolated from liver, kidney, and spleen of wild caught and cultured organisms in Mazatlan and wild caught in Matanchen Bay during 2004.

Table 2.   Bacterial clonal diversity in the spotted rose snapper (Lutjanus guttatus) in northwestern Mexico
SpeciesClonal groupLocalizationNumber
Dif. organDif. fish
  1. *Wild-caught and cultured fishes were collected no more than 15 km apart and all others were from the same environment. Clones from the same fish and organ are not included. Isolates with more than 90% (GTG)5 similarities by rep-PCR fingerprinting are considered clones.

Photobacterium damselae subsp. damselaeA XCAIM 947, CAIM 948
BX CAIM 1261, CAIM 1262
C X*CAIM 1517, CAIM 1547
DX CAIM 1514, CAIM 1562
Photobacterium leiognathiAX CAIM 977, CAIM 988
BXXCAIM 938, CAIM 967
Vibrio alginolyticusAX CAIM 1280, CAIM 1281
Vibrio campbelliiAX CAIM 1351, CAIM 1352
BXX*CAIM 1546, CAIM 1561
Vibrio fortisAXXCAIM 747, CAIM 748
B XCAIM 778, CAIM 791
cXXCAIM 749, CAIM 751
Vibrio harveyiAX CAIM 1266, CAIM 1267
BX CAIM 1148, CAIM 1159, CAIM 1560
CXXCAIM 1008, CAIM 1172
Vibrio ponticusAXXCAIM 403, CAIM 404
Vibrio sp.AXXCAIM 1515, CAIM 1564
Vibrio sp. nov. 2AX CAIM 930, CAIM 932
Vibrio sp. nov. 3AXXCAIM 648, CAIM 752

Photobacterium damselae subsp. damselae was the most isolated species found almost in every fish, locality, and organ, but on the lesions. The 16S rRNA sequences obtained are more related to Photobacterium damselae subsp. piscicida than to subsp. damselae, when blasted to sequences deposited in Genbank. It has been proven that both subspecies might have a 100% similarity in their 16S rRNA sequences (Osorio et al. 1999) and therefore, phenotypic characteristics are needed to differentiate both subspecies. Strains of P. damselae subsp. damselae have been reported as fish pathogens (Austin 2006), but severe infections have been attributed to P. damselae subsp. piscicida that causes fish pasteurellosis (Thyssen et al. 1998). None of the fish analysed here that harbour any Photobacterium sp. showed signs of disease.

Some P. damselae subsp. damselae isolates were obtained from two distinct fishes that resulted to be clones (>90% GTG5 similarity) namely, CAIM 947 and CAIM 948 (Table 2, P. damselae clonal type A) that were obtained from the spleen of two fishes caught 2 days apart. The same can be said about CAIM 1517 and CAIM 1547 (Table 2, P. damselae clonal type C), isolated from the liver of two fishes, but caught the same day. The first pair of fishes was from the same locality (Mazatlan), but for the second pair, one came from a wild caught fish in Mazatlan and the other from a cultured fish in the same geographic area (maybe a maximum of 14 km apart). Other clones were obtained from the same fish but from different organs (Table 2, P. damselae clonal types B and D). In general, clones were isolated from the same fish and organ (44·92% of 69 isolates), although care was taken to select different colonial types present in the medium. In many cases, these clones came from the two different media (TCBS and GSP) employed for their isolation. Clones isolated from different fishes but from the same organ were 8·69% (Table 2); from the same fish but different organ, 28·98%; and from different fishes and different organs, 17·39%. Considering only the clones isolated from different fish and/or organ, only a maximum of three clones, but normally only two, were obtained. It has been reported that host-associated micro-organisms exhibit genetic differentiation related to the distribution of their hosts (Martiny et al. 2006). With the low number of clones isolated here, it is difficult to establish the presence of a clonal type among fishes of this species or their geographic distribution. No clones were found between fishes of the two main (in terms of number of fishes samples) geographic locations, Matanchen Bay and Mazatlan. Regarding the number of species identified in this two locations, a higher number (12) was found in wild-caught fishes in Mazatlan than those found in Matanchen Bay (3), but also, many more strains were found (226) in the former than that in the latter (17). Comparing two sources with similar number of strains, cultured fishes from Mazatlan with wild caught from Matanchen Bay (22 to 17, respectively), almost the same number of species were identified, three and five respectively. Of these species, only two were shared among the three sites, P. damselae subsp. damselae and V. harveyi. These data suggest that, for this geographic scale (14–250 km) the microbial composition could be affected by the environment (cultured vs wild caught) and by the distance (Yannarell and Triplett 2005; Martiny et al. 2006).

Photobacterium leiognathi (cluster 14). Fourteen isolates (11 strains with three clones) that clustered with the type strain (CAIM 327T). The 16S sequence of two strains was 99·2% (CAIM 1264, DQ437748) and 99·4% (CAIM 938, DQ437756) similar to P. leiognathi. All were isolated from liver, spleen, and kidney from wild fishes caught during 2004 in Mazatlan.

Vibrio

Vibrio alginolyticus (cluster 3). Twelve isolates (11 strains with one clone) identified by (GTG)5 similarities and by having in the cluster the type strain (CAIM 516T, =LMG 4409T) of the species. All isolates were from Mazatlan obtained from liver, kidney, and spleen during 2004.

Vibrio campbellii (cluster 4). Nineteen isolates (16 strains with 3 clones), 14 strains and the three isolated clustered with one V. campbellii reference strain (CAIM 415, =LMG 21361) and they have a high (GTG)5 similarity. Two other strains (CAIM 706 and CAIM 1022) did not group in cluster 4, the first did not cluster (group ‘b’) and the latter appeared in cluster 16. They were all isolated from Mazatlan and Manzanillo, from wild-caught and cultured fishes, and from liver, kidney, spleen, and external lesions from diseased organisms, during 2003 and 2004.

Vibrio chagasii. One strain (CAIM 934) was found in the kidney of a wild-caught fish in Mazatlan. In was identified when analysed in the whole database.

Vibrio fortis (clusters 11 and 12). Nine isolates (six strains with three clones) that formed two clusters, each with a pair of reference strains; CAIM 631 (=LMG 21560) and CAIM 632 (=LMG 21561) for cluster 11, and CAIM 633 (=LMG 21562) and CAIM 637 (=LMG 21564) for cluster 12. All were isolated from cultured snappers at Mazatlan during 2003. (GTG)5 similarities between both clusters of this species ranged between 43·8% and 22·9%. The inclusion of the type strain (CAIM 629T, =LMG 21557T) did not enhance the resolution of these two clusters; on the contrary, it did not cluster with any strain and therefore, it was not included in the analysis. Vibrio fortis has been already reported to be genotypically variable forming two clusters by FAFLP analysis (Thompson et al. 2001, 2003). DNA–DNA hybridization between the type and reference strains is also variable, ranging from 95% to barely 70% (Thompson et al. 2003) as is the case of the strain CAIM 632 (=LMG 21561) of cluster 11. The 70% value is in the threshold proposed to delineate a species (Wayne et al. 1987). Further analysis by genomic fingerprinting methods with more strains and DNA–DNA hybridization might result in the formation of a new species or subspecies.

Vibrio harveyi (clusters 5 and 15). Forty-nine isolates (39 strains with 10 clones). Four isolates, all clones (cluster 5), were collected from external lesions of the same diseased fish from Manzanillo. One of the isolates (CAIM 700, DQ437754), was identified by 16S rRNA as V. harveyi. Forty-three isolates formed cluster 15 with the type strain (CAIM 513T, =LMG 4044T) and three reference strains (CAIM 1, CAIM 330 =LMG 7890, and CAIM 606 =LMG 19643). CAIM 1146 did not cluster and CAIM 1497 appeared in cluster 10. They were all isolated from liver, kidney, spleen, and external lesions from diseased organisms; caught in Mazatlan, Matanchen Bay, and Manzanillo during 2003 and 2004. Cluster 5 had four isolates from external lesions of a diseased organism (fish 26, see Supplementary Table), these four isolates can be considered clones because of their high (GTG)5 similarity, between 91·3% and 100%. The (GTG)5 similarity of these four isolates with the rest of the V. harveyi strains in cluster 13 is between 22·9% and 64·0%. Other V. harveyi isolates were obtained from another diseased fish (27), CAIM 708, CAIM 709, CAIM 710, and CAIM 714. These four isolates also have a (GTG)5 similarity between 91·7% and 100% and thus, clones. The (GTG)5 similarity between these two set of clones is less than 50·0%. CAIM 704 was also isolated from fish number 26 but is has a low similarity (<71·4%) with the other two groups of isolates. Therefore, at least three V. harveyi strains were obtained from external lesions of two fishes. From the lesions of fish 27, three strains of V. campbellii were also isolated: CAIM 706, CAIM 713, and the strain formed by the clones CAIM 707 and CAIM 711 (100% similar). Both these species have been reported to have pathogenic strains for cultured organisms (Grimes et al. 1985; Gomez-Gil et al. 2004; Owens and Busico-Salcedo 2006), but pathogenicity studies should be conducted with these strains to elucidate their implication in the lesions observed.

Vibrio ichthyoenteri (cluster 9). Four isolates (two strains and two clones) were identified by 16S rRNA (CAIM 914, 99·4%, DQ437755); three isolates clustered together because they were clones and the other strain (CAIM 918) did not cluster with them, although the (GTG)5 similarity was high (45·5–52·4%). All were isolated from the kidney of two fishes caught in Mazatlan during 2004.

Vibrio mediterranei (cluster 7). Four strains (no clones) were grouped here with the type strain of the species (CAIM 316T). The 16S rRNA of strain CAIM 1246 also identified them positively (99·4%, DQ861907). One strain was isolated from the lesions of a diseased fish from Manzanillo and the others from the liver, kidney, and spleen from different wild-caught fishes in Mazatlan.

Vibrio parahaemolyticus. One strain (CAIM 1273) isolated from the liver of a wild-caught fish in Mazatlan. It was identified when compared with the whole database.

Vibrio ponticus (cluster 6). CAIM 403 and CAIM 404 are identical by (GTG)5 (100%) and thus clones, but isolated from two different fishes wild caught in Mazatlan. CAIM 404 was identified by 16S rRNA (98·7%, DQ437753).

Vibrio rotiferianus (cluster 10). Twenty-two isolates (all strains), 18 strains clustered together and the cluster was identified by (GTG)5 and 16S rRNA (99·2% CAIM 1167, DQ437746) similarities. Three other strains did not cluster (CAIM 895, CAIM 919, and CAIM 1568), but were identified as such by high (GTG)5 similarities when analysed with the whole database and by 16S rRNA of one of the strains (CAIM 1568, DQ437751). They were all isolated from liver, kidney, and spleen from wild fishes caught during 2004 in Mazatlan.

Potential new Vibrio species

Vibrio sp. nov. 1 (cluster 1). Seven isolates (all strains) that might represent a new species because of their low 16S rRNA similarity (for species of the core group of Vibrio, 98·1%) with V. alginolyticus/V. parahaemolyticus. This cluster also has a sequenced strain isolated from oysters that serves a reference strain (CAIM 1683) and for which the 16S sequence was obtained (DQ421207). They were isolated from spleen, kidney, and liver of wild-caught fishes during and 2004 in Mazatlan and Nayarit. CAIM 1001 did not cluster with the rest of the strains but was included in group ‘b’ of the dendrogram (Fig. 1b). Strains that are genotypically not so close to the other strains of the same species in this analysis did not cluster together, as is the case with CAIM 1001. But when these ‘stray’ strains are included in a more comprehensive analysis (many more strains from diverse origins) they do cluster with similar strains, all forming the big species cluster(s).

Vibrio sp. nov. 2 (cluster 13). Six isolates (two strains and four clones) that have a low 16S rRNA similarity (CAIM 930, 96·5%, DQ421208; and CAIM 932, 96·6%, DQ421209 complete sequence) with V. campbellii. All were isolated from the liver and kidney from a wild fish caught during 2004 in Mazatlan.

Vibrio sp. nov. 3 (cluster 2). Eight isolates (seven strains and one clone) assigned to this potential new species of Vibrio because of the low 16S rRNA similarity with Vibrio nereis (CAIM 695, 95·1%, DQ421210; CAIM 797, 94·2%, DQ421211). Strains CAIM 648 and its clone CAIM 752, related to this potential new species, were included in group ‘b’ of the dendrogram (Fig. 1b).

Vibrio sp. nov. 4 (cluster 8). Four isolates (all strains) that represent a potential new species because of their low 16S rRNA similarity (CAIM 1643, 94·4%, DQ421212; and CAIM 1349, 94·6%, DQ421213) with V. ichthyoenteri/Vibrio scophthalmi. They were isolated from liver and kidney from three wild fishes caught during 2004 in Mazatlan.

Unidentified species

Vibrio sp. Twenty-four isolates (23 strains and one clone) could only be identified as Vibrio and most of them were grouped in the dendrogram as group ‘b’ (Fig. 1b), and another two were grouped separately (Fig. 1a). Another five isolates clustered in several clusters but because of their low (GTG)5 similarity with the members of that cluster or with any in the whole database, they could only be identified to Vibrio sp.: CAIM 923 in cluster 1, CAIM 746 and CAIM 1012 in cluster 4, and CAIM 1292 and CAIM 1339 in cluster 16.

Strains not belonging to the Vibrionaceae (not included in the dendrogram). Eight isolates (six strains and two clones). CAIM 1023, CAIM 1253, CAIM 1554, and CAIM 1555 were identified as Aeromonas sp. because they were gram-negative, motile, OF test-positive, oxidase-positive, but resistant to the vibriostatic compound 0/129 (150 μg) (Holt et al. 1994). CAIM 1640 and its clone CAIM 1641, and CAIM 1645 and its clone CAIM 1646 are related by (GTG)5 similarity, the 16S rRNA of CAIM 1640 was sequenced with a 98·4% similarity with Shewanella alga.

Unidentified. Eleven isolates with no clones were not identified. CAIM 1521, CAIM 1552, and CAIM 1553 were gram-positive. CAIM 916, CAIM 920, CAIM 941, CAIM 952, and CAIM 1335 were OF-negative, resistant to 0/129 (150 μg), and nonmotile (except CAIM 941). Strains CAIM 1271, CAIM 1519, and CAIM 1637 could not be typified.

In this study, the majority of fishes analysed were collected in Mazatlan (89·0%) either wild caught (60·3%) or cultured (28·8 %) but all collected no more than 14 km apart. With the data of this study, it appears that clones are as likely to be found within organs of the same fish (52·6%) as between fishes (47·4%) of the same locality.

Of the 147 isolates in TCBS agar, nine (6·1%) were not identified as Vibrio or Photobacterium; of these, three were even gram-positive yellow colonies. It has already been reported that different genera, and even gram-positive bacteria, might grow in TCBS agar (Nicholls et al. 1976), but their proportions have not been studied. It was also noted that many species have strains that grow as yellow or green colonies on TCBS; 81·8% of the V. harveyi, 85·7% of V. rotiferianus, and 30·0% of P. damselae subsp. damselae grew as yellow colonies. For P. damselae subsp. damselae, the percentage found here is much higher than the 5% value reported (Thyssen et al. 1998). Vibrio rotiferianus was described only with five strains, all yellow in TCBS (Gomez-Gil et al. 2003), whereas the majority of strains of V. harveyi are yellow (Holt et al. 1994). Clearly, colony colour in TCBS (utilization of sucrose) cannot be a determinative trait for these species. GSP medium was used because it was presumed that this fish might harbour members of the genera Pseudomonas and/or Aeromonas, but none of the 92 strains isolated in this medium were identified as such. Bacteria capable of degrading starch grow as yellow colonies in GSP, otherwise grow as red colonies. As in the case of TCBS agar, variability between the strains of the same species was observed; 28·6% of P. damselae subsp. damselae and 93·3% of V. harveyi grew as yellow colonies in GSP agar.

Diverse bacterial genera have been found in the internal organs of healthy fish (Horsley 1977; Nieto et al. 1984). Vibrio sp. have been isolated from the liver and kidney of apparently healthy turbot (Scophthalmus maximus) (Toranzo et al. 1993), and P. damselae have been found as part of the normal flora of sharks (Grimes et al. 1985). Almost no studies have been performed on the normal or pathogenic bacteria found in snappers; this is one of the first attempts to characterize the bacterial flora of this promising fish.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and Discussion
  6. Acknowledgements
  7. References

Thanks are due to Carmen Bolan-Mejia, Roxana Atondo-Mexia, and Rosa María Medina Guerrero for technical help; Dr. Neil J. Duncan for providing some fish. This study was financed by projects FOSEMARNAT-2004-01-33 and SAGARPA-2002-CO1-378, Mexico.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results and Discussion
  6. Acknowledgements
  7. References
  • Allen, G.R. (1985) FAO species catalogue. Vol. 6. Snappers of the world. An annotated and illustrated catalogue of lutjanid species known to date. FAO Fish Synop 125, 208.
  • Austin, B. (1988) Marine Microbiology. Cambridge: Cambridge University Press.
  • Austin, B. (2006) Miscellaneous animal pathogens. In The Biology of Vibrios ed. Thompson, F.L., Austin, B. and Swings, J. pp. 297308. Washington DC: ASM Press.
  • Froese, R. and Pauly, D. (2005) FishBase. World Wide Web electronic publication. http://www.fishbase.org.
  • Garcia-Ortega, A., Abdo de la Parra, I., Duncan, N.J., Rodriguez-Ibarra, E., Velasco, G., Gonzalez-Rodriguez, B., Puello-Cruz, A. and Martinez, I. (2005) Larval rearing of spotted rose snapper Lutjanus guttatus under experimental conditions. In Larvi ‘05 – Fish and Shellfish Larviculture Symposium ed. Hendry, C.I., Van Stappen, G., Wille, M. and Sorgeloos, P. pp. 172175. Oostende, Belgium: European Aquaculture Society.
  • Gherna, L.R. (1994) Culture preservation. In Methods for General and Molecular Bacteriology ed. Gerhardt, P., Murray, R.G.E., Wood, W.A. and Krieg, N.R. pp. 278292. Washington, DC: ASM Press.
  • Gomez-Gil, B., Roque, A. and Turnbull, J.F. (2000) The use and selection of probiotic bacteria for use in the culture of larval aquatic organisms. Aquaculture 191, 259270.
  • Gomez-Gil, B., Thompson, F.L., Thompson, C.C. and Swings, J. (2003) Vibrio rotiferianus sp. nov., isolated from cultures of the rotifer Brachionus plicatilis. Int J Syst Evol Microbiol 53, 239243.
  • Gomez-Gil, B., Soto-Rodríguez, S., Garcia-Gasca, A., Roque, A., Vazquez-Juarez, R., Thompson, F.L. and Swings, J. (2004) Molecular characterization of V. harveyi related isolates associated with diseased aquatic organisms. Microbiology 150, 17691777.
  • Grimes, D.J., Brayton, P., Colwell, R.R. and Gruber, H. (1985) Vibrios as autochthonous flora of neritic sharks. Syst Appl Microbiol 6, 221226.
  • Hall, T.A. (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl Acids Symp Ser 41, 9598.
  • Hjeltnes, B. and Roberts, R.J. (1993) Vibriosis. In Bacterial Diseases of Fish ed. Roberts, R.J., Bromage, N.R. and Inglis, V. pp. 109121. Oxford: Blackwell Scientific.
  • Holt, J.G., Krieg, N.R., Sneath, P.H.A., Staley, T. and Williams, S.T. (1994) Bergey's Manual of Determinative Bacteriology. Baltimore: Williams & Wilkins.
  • Horsley, R.W. (1977) A review of the bacterial flora of teleosts and elasmobranchs, including methods for its analysis. J Fish Biol 10, 529553.
  • Kosman, E. and Leonard, K.J. (2005) Similarity coefficients for molecular markers in studies of genetic relationships between individuals for haploid, diploid, and polyploid species. Mol Ecol 14, 415424.
  • Lightner, D.V. (1993) Diseases of cultured penaeid shrimp. In CRC Handbook of Mariculture, Crustacean Aquaculture ed. Mcvey, J.P. pp. 393486. Boca Raton, FL: CRC Press.
  • Martiny, J.B., Bohannan, B.J., Brown, J.H., Colwell, R.K., Fuhrman, J.A., Green, J.L., Horner-Devine, M.C., Kane, M. et al. (2006) Microbial biogeography: putting microorganisms on the map. Nat Rev Microbiol 4, 102112.
  • Nicholls, K.M., Lee, J.V. and Donovan, T.J. (1976) An evaluation of commercial thiosulphate citrate bile salt sucrose agar (TCBS). J Appl Bacteriol 41, 265269.
  • Nieto, T.P., Toranzo, A.E. and Barja, J.L. (1984) Comparison between the bacterial flora associated with fingerling rainbow trout cultured in two different hatcheries in the North-West of Spain. Aquaculture 42, 193206.
  • Osorio, C.R., Collins, M.D., Toranzo, A.E., Barja, J.L. and Romalde, J.L. (1999) 16S rRNA gene sequence analysis of Photobacterium damselae and nested PCR method for rapid detection of the causative agent of fish pasteurellosis. Appl Environ Microbiol 65, 29422946.
  • Owens, L. and Busico-Salcedo, N. (2006) Vibrio harveyi: pretty problems in paradise. In The Biology of Vibrios ed. Thompson, F.L., Austin, B. and Swings, J. pp. 266280. Washington DC: ASM Press.
  • Stackebrandt, E., Frederiksen, W., Garrity, G.M., Grimont, P.A., Kampfer, P., Maiden, M.C.J., Nesme, X., Rossello-Mora, R.A. et al. (2002) Report of the ad hoc committee for the re-evaluation of the species definition in bacteriology. Int J Syst Evol Microbiol 52, 10431047.
  • Stickney, R.R. (2000) Encyclopedia of Aquaculture. New York, USA: John Wiley and Sons, Inc.
  • Thompson, F.L., Hoste, B., Vandemeulebroecke, K. and Swings, J. (2001) Genomic diversity amongst Vibrio isolates from different sources determined by fluorescent amplified fragment length polymorphism. Syst Appl Microbiol 24, 520538.
  • Thompson, F.L., Thompson, C.C., Hoste, B., Vandemeulebroecke, K., Gullian, M. and Swings, J. (2003) Vibrio fortis sp. nov. and Vibrio hepatarius sp. nov., isolated from aquatic animals and the marine environment. Int J Syst Evol Microbiol 53, 14951501.
  • Thyssen, A., Grisez, L., Van Houdt, R. and Ollevier, F. (1998) Phenotypic characterization of the marine pathogen Photobacterium damselae subsp. piscicida. Int J Syst Evol Microbiol 48, 11451151.
  • Toranzo, A.E., Novoa, B., Romalde, J.L., Nunez, S., Devesa, S., Marino, E., Silva, R., Martinez, E. et al. (1993) Microflora associated with healthy and diseased turbot (Scophthalmus maximus) from three farms in northwest Spain. Aquaculture 114, 189202.
  • Wayne, L.G., Brenner, D.J., Colwell, R.R., Grimont, P.A.D., Kandler, O., Krichevsky, L., Moore, L.H., Murray, R.G.E. et al. (1987) Report of the ad hoc committee on reconciliation of approaches to bacterial systematics. Int J Syst Bacteriol 37, 463464.
  • Wong, H.C. and Lin, C.H. (2001) Evaluation of typing of Vibrio parahaemolyticus by three PCR methods using specific primers. J Clin Microbiol 39, 42334240.
  • Yannarell, A.C. and Triplett, E.W. (2005) Geographic and environmental sources of variation in lake bacterial community composition. Appl Environ Microbiol 71, 227239.