SEARCH

SEARCH BY CITATION

Keywords:

  • breast milk;
  • colonization;
  • lactic acid bacteria;
  • microbiota;
  • molecular ecology

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Aims:  To evaluate the diversity of the Lactobacillus group in breast milk and the vagina of healthy women and understand their potential role in the infant gut colonization using the 16S rRNA gene approaches.

Methods and Results:  Samples of breast milk, vaginal swabs and infant faeces were aseptically collected from five mothers whose neonates were born by vaginal delivery and another five that had their babies by caesarean section. After polymerase chain reaction (PCR) amplification using Lactobacillus group-specific primers, amplicons were analysed by denaturing gradient gel electrophoresis (DGGE). Clone libraries were constructed to describe the Lactobacillus group diversity. DGGE fingerprints were not related to the delivery method. None of the species detected in vaginal samples were found in breast milk-derived libraries and only few were detected in infant faeces.

Conclusions:  The bacterial composition of breast milk and infant faeces is not related to the delivery method.

Significance and Impact of the Study:  It has been suggested that neonates acquire lactobacilli by oral contamination with vaginal strains during delivery; subsequently, newborns would transmit such bacteria to the breast during breastfeeding. However, our findings confirm, at the molecular level that in contrast to the maternal vagina, breast milk seems to constitute a good source of lactobacilli to the infant gut.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Breast milk provides all the nutritional requirements for the rapidly growing infant and contains a variety of protective factors, such as immunoglobulin (Ig) A, immunocompetent cells, fatty acids, oligosaccharides, lysozyme or lactoferrin (Newburg 2005), that protect breast-fed infants against infectious diseases (Wright et al. 1998; Hanson and Korotkova 2002; Morrow and Rangel 2004). Commensal bacteria usually present in breast milk of healthy mothers, such as lactobacilli, lactococci, enterococci and Leuconostoc spp., can also be considered as key elements of the defence system that this biological fluid offers to the infant (Matsumiya et al. 2002; Heikkilä and Saris 2003; Martín et al. 2003). The lactic acid bacteria isolated from human milk include Lactobacillus gasseri, Lactobacillus rhamnosus, Lactobacillus plantarum, Lactobacillus fermentum or Enterococcus faecium, which all are considered to be among the potential probiotic bacteria. In fact, some of the lactic acid bacteria strains with such origin have already been shown to possess probiotic properties, including the inhibition of a wide spectrum of infant pathogenic bacteria by competitive exclusion and/or through the production of antimicrobial compounds, such as bacteriocins, organic acids or hydrogen peroxide (Heikkilä and Saris 2003; Beasley and Saris 2004; Martín et al. 2005).

Till now, knowledge of the bacterial diversity in breast milk is very limited, and is almost exclusively based on the use of culture media. This implies that the presence of additional bacterial species that are not cultivable may have been overlooked. However, the application of culture-independent molecular techniques, particularly those based on 16S rRNA genes, has allowed a more complete assessment of the biodiversity of the human microbiota, especially that of the gut both in adults (Zoetendal et al. 1998; Suau et al. 1999) and infants (Favier et al. 2002). Typically, this approach involves extraction of the DNA from the biological samples, polymerase chain reaction (PCR) amplification of 16S rRNA gene fragments with universal or group-specific bacterial primers, analysis of PCR products by fingerprinting methods such as denaturing gradient gel electrophoresis (DGGE) and, the construction of clone libraries to assess the variety of 16S rRNA gene sequences present.

As lactobacilli and other lactic acid bacteria seem to be important components of the breast milk microbiota, the primary objective of this work was to investigate their diversity in breast milk of healthy women by using 16S rRNA gene primers targeting the Lactobacillus group, which additionally comprises the genera Leuconostoc, Pediococcus and Weissella. Furthermore, the potential role of vagina and breast milk as a source of lactobacilli for the initial colonization of the infant gut was also investigated.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Sample preparation

Samples of fresh breast milk (B) and vaginal swabs (V) were aseptically collected from five mothers (M1 to M5) that had their babies by programmed elective caesarean section, and from other five mothers (M6 to M10) whose neonates were born by vaginal delivery assisted by personnel of the Servicio de Obstetricia, Hospital Universitario Doce de Octubre, Madrid (Spain). Vaginal swabs were obtained immediately before delivery while samples of breast milk were collected at day 7 after delivery. Samples of faeces of the respective infants were also collected at day 7. All the mothers were healthy, had a full term pregnancy and breast-fed their infants. All the samples were collected in sterile tubes and kept in ice until their transport to the laboratory, which happened within the first 2 h after collection; finally, all the samples were stored at −80°C until further processing. The biological material contained in the vaginal swabs was resuspended in 1 ml of saline buffer (phosphate-buffered saline, PBS).

DNA extraction

The liquid samples (1 ml) were centrifuged at 3300 g for 20 min and the pellets were resuspended in 1·4 ml of ASL buffer (Stool lysis buffer; QIAgen, Hilden, Germany) with the aid of 0·1 mm zirconium beads (Biospec, Bartlesville, OK, USA). Faeces (0·2 g) were resuspended in the same buffer. These samples were treated at a setting of 5,5 for 30 s using the FastPrep instrument (QBioGene, Irvine, CA, USA). Subsequently, total DNA was isolated using theQIAamp DNA Stool Mini Kit (QIAgen) according to the manufacturer’s instructions. Purified DNA extracts were stored at −20°C.

PCR amplification

Lactobacillus group-specific PCR was performed using primers targeted at the V2–V3 region of the bacterial 16S rRNA gene. To prevent a low amplicon yield, we opted for the use of a nested PCR approach as described earlier (Heilig et al. 2002). This involved a first PCR reaction in which primers Bact27f (5′-GTTTGATCCTGGCTCAG-3′) (Lane 1991) and Lab-677r (5′-CACCGCTACACATGGAG-3′) (Heilig et al. 2002) were used, followed by a second PCR with primers Lab159f (5′-GGAAACAG(A/G)TGCTAATACCG) (Heilig et al. 2002) and Univ515-GCr (5′-GC-clamp-ATCGTATTACCGCGGCTGCTGGCAC-3′) (Lane 1991). A 40-bp GC-clamp (CGCCGGGGGCGCGCCCCGGGCGGGGCGGGGGCACGGGGGG) was attached to the 5′ end of the Uni515r primer in order to facilitate the analysis of the PCR products by DGGE. PCR was performed using the Taq polymerase kit (Invitrogen, Carlsbad, CA, USA). Each 50-μl mixture contained 20 mmol l−1 Tris-HCl (pH 8·4), 50 mmol l−1 KCl, 3 mmol l−1 MgCl2, 200 μmol l−1 of each deoxynucleoside triphosphate, 1·25 U Taq polymerase, 10 pmol of each primer and c. 50 ng of template DNA. Samples were amplified in a PE Applied Biosystems GenAmp PCR system 9700 (Foster City, CA, USA) by using the following programme: initial denaturation at 95°C for 2 min; 35 cycles of denaturation at 95°C for 30 s, annealing at primer-specific temperature for 40 s, elongation at 72°C for 1 min and extension at 72°C for 5 min, followed by a final cooling to 4°C. The annealing temperature was set at 66°C with primers Bact27f and Lab-677r and at 56°C with primers Lab159f and Univ515-GCr. PCR products that were used as templates in nested PCR were purified with the Nucleo Spin Extract II (Machery Nagel, Düren, Germany). PCR products were stored at −20°C until further use.

DGGE of PCR amplicons

DGGE analysis of PCR amplicons was based on the protocol described earlier (Muyzer et al. 1993) by using the DCode System (Bio-Rad Laboratories, Hercules, CA, USA). Polyacrylamide gels (dimensions, 200 × 200 × 1 mm) consisted of 8% (v/v) polyacrylamide (37·5 : 1 acrylamide–bisacrylamide) in 0·5× TAE (Tris-acetate-EDTA buffer). Denaturing acrylamide of 100% was defined as 7 mol l−1 urea and 40% formamide. The gels were poured from the top by using a gradient maker and a pump (Econopump; Bio-Rad) set at a speed of 4·5 ml min−1, and gradients 30–50% were used for the separation of the generated amplicons. Before polymerization of the denaturing gel (28 ml gradient volume), a 7·5 ml stacking gel without denaturing chemicals was added and the appropriate comb was subsequently inserted. Electrophoresis was performed for 16 h at 85 V in a 0·5× TAE buffer at a constant temperature of 60°C. Gels were stained with silver nitrate according to the method of Sanguinetti et al. (1994). Gel images were digitally normalized by comparison with an external standard pattern using the BioNumerics software, version 4.0 (Applied Maths, St-Martens-Latem, Belgium). This normalization enabled comparison between DGGE profiles from different gels that were run under identical denaturing and electrophoresis conditions. Cluster analysis of DGGE patterns was performed using the UPGMA method (unweighted pair group method with arithmetic mean) based on the Dice similarity coefficient (band-based).

Cloning of the PCR-amplified products

PCR amplicons generated with primers Lab159f and Univ515-GCr and originating from the biological samples provided by the mother–infant pairs 3 and 4 (caesarean group) and 9 and 10 (vaginal delivery group), were used for constructing clone libraries. The PCR products were purified with a Nucleo Spin Extract II kit (Macherey-Nagel, Düren, Germany) according to the manufacturer’s instructions and were cloned in Escherichia coli XL-1 blue competent cells (Stratagene, La Jolla, CA, USA) by using the pGEM-T easy cloning kit (Promega Corp., Madison, WI, USA). Plasmids containing an insert of the appropriate size were screened by DGGE analysis. Representative clones corresponding to a specific banding position were selected for sequence analysis at the genomic facilities of PRI Greenomics (Wageningen, The Netherlands), BaseClear (Leiden, The Netherlands) and Parque Científico de Madrid (UCM, Madrid, Spain). Sequences were deposited in the GenBank database with accession numbers AM117129 to AM117183.

Ethical considerations

Written informed consent was obtained from the women that provided the biological samples used in this study. The protocol was approved by the Ethical Committee of University Complutense of Madrid (Hospital Clínico, Madrid, Spain).

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

DNA isolation and subsequent PCR–DGGE analysis of 16S rRNA genes were successful for all samples. Visual comparison of DGGE profiles obtained from breast milk samples revealed interindividual variation, and no distinctive differences could be established between samples from the two different delivery groups. Similar results were observed for the samples obtained from vaginal swabs and infant faeces (Fig. 1). Cluster analysis of DGGE profiles by the UPGMA method based on the Dice similarity coefficient confirmed that no delivery-specific grouping could be retrieved (Fig. 2).

image

Figure 1.  Denaturing gradient gel electrophoresis (DGGE) analysis of the dominant bacterial communities in breast milk and vaginal samples from mothers 3, 4, 9 and 10 and in infant faeces from their respective infants. M represents a marker constructed in this study with the identified bands to facilitate the interpretation of the figure. Bands: 1, Weissella confusa; 2, Leuconostoc citreum; 3, Lactobacillus gasseri; 4, Lactobacillus jensenii; 5, Lactobacillus iners; 6, Leuconostoc fallax; 7, Lactobacillus crispatus; 8, Lactobacillus fermentum; 9, Lactobacillus rhamnosus; 10, Lactobacillus casei and Lactobacillus paracasei; 11, Lactobacillus plantarum (fuzzy band).

Download figure to PowerPoint

image

Figure 2.  UPGMA dendrogram illustrating the correlation between the different denaturing gradient gel electrophoresis (DGGE) profiles obtained from the samples (B, breast milk; V, vaginal swab; F, infant faeces) provided by the participating mother–infant pairs. The black bars represent the error bands.

Download figure to PowerPoint

Analysis of clone libraries prepared from PCR products obtained from the samples provided by mother–infant pairs 3 and 4 (caesarean section group) and 9 and 10 (vaginal delivery group), was used for further evaluation of the Lactobacillus group diversity. Sequence analysis of unique clones of these origins resulted in sequences with similarities >98% to 16S rRNA genes of cultured bacterial isolates deposited in the NCBI database. A total of 3, 4, 3 and 3 types of operational taxonomic units (OTU) were retrieved from breast milk of mothers 3, 4, 9 and 10, respectively (Table 1). On the other hand, 3, 2, 2 and 4 types of sequences could be retrieved from vaginal swabs of the respective mothers and 5, 4, 2 and 4 types of sequences from faeces of their respective infants (Table 1, Fig. 1). The Lactobacillus group patterns seemed to be host-specific and, globally, sequences belonging to 14 Lactobacillus group species could be identified (Table 1).

Table 1.   Specific cloned sequences of the Lactobacillus group from breast milk, vaginal swab and infant faeces and the percentage of similarity to sequences deposited in the Genbank
SampleIndividual*Species†Clone (% similarity)
  1. *M, mother; F, infant.

  2. †Species were named according to their closest relative

Breast milkM3Lactobacillus fermentum strain BFE 66181BM3 (98)
Weissella confusa strain BJ21-22BM3 (98)
Leuconostoc citreum IH223BM3 (99)
M4Lactobacillus rhamnosus strain MCRF-4121BM4 (99)
Lactobacillus plantarum strain BJ G26-42BM4 (99)
W. confusa strain BJ21-23BM4 (99)
Leuc. citreum IH224BM4 (99)
M9Lact. fermentum strain BFE1BM9 (99)
W. confusa strain BJ21-22BM9 (99)
Leuc. citreum IH223BM9 (99)
M10W. confusa strain BJ21-21BM10 (100)
Leuconostoc fallax strain BFE2BM10 (99)
Leuc. citreum IH223BM10 (99)
Vaginal swab M3Lactobacillus jensenii strain BJ H41-2b1EV3 (99)
W. confusa strain BJ21-23EV3 (100)
Lactobacillus iners clone FX43-44EV3 (99); 5EV3 (97)
M4Lactobacillus jensenii strain BJ H41-2b1EV4 (99)
Lactobacillus crispatus strain BJ Y202EV4 (99)
M9Lactobacillus iners clone FX43-41EV9 (99); 4EV4 (97)
Lact. crispatus strain BJ Y202EV9 (99)
M10Lact. jensenii strain BJ H41-2b1EV10 (99)
Lact. iners clone FX43-42EV10 (99); 6EV10 (97)
Lact. crispatus strain BJ Y203EV10 (99)
Aerococcus sp.9EV10 (99)
Infant faecesF3Lactobacillus casei strain BJ13-11 F3 (99)
Lactobacillus paracasei isolate 10C2 F3 (99)
Lact. paracasei strain VUP 120063 F3 (98)
Leuc. citreum IH224 F3 (99)
Lactobacillus gasseri strain YDB215 F3 (98)
W. confusa strain BJ21-26 F3 (99)
F4Lact. plantarum strain BJ16-281 F4 (99)
Leuc. citreum IH222 F4 (99)
Lact. crispatus strain BJ Y203 F4 (99)
Lact. fermentum strain BFE4 F4 (99)
F9W. confusa strain BJ21-21 F9 (99)
Lact. fermentum strain BFE 66183 F9 (99)
F10W. confusa strain BJ21-21 F10 (100)
Lact. crispatus strain BJ Y203 F10 (100)
Lact. gasseri strain KC5a4 F10 (99)
Leuc. citreum IH225 F10 (99)

Among the vaginal samples, most of the retrieved sequences were most closely related to 16S rRNA genes of Lactobacillus jensenii, Lactobacillus iners and Lactobacillus crispatus, but none of these species could be detected in breast milk-derived libraries, and only between 0 and 1 in clone libraries from the faeces of each infant (0, 1, 0 and 1 species in infants 3, 4, 9 and 10, respectively) (Table 2). For example, only one of the three Lactobacillus group species detected in the library corresponding to the vaginal swab of mother 3 was also detected in the infant faeces of her son. The ratio was lower (1 : 4) in the case of the mother–infant pair number 10 (vaginal delivery group). In contrast, two of the three species detected in the breast milk samples of each mother were also present in the faeces of their own infant (Table 2). Therefore, it is not strange that vaginal profiles of mothers 3, 4, 9 and 10 clustered together in the UPGMA dendrogram separately from the breast milk and the faeces profiles (Fig. 1).

Table 2.   Comparison of the Lactobacillus group clones retrieved from breast milk (B), vaginal swab (V) and infant faeces (F) of the different individuals (3 and 4, caesarean group; 9 and 10, vaginal delivery group) included in this study
Species*V3V4V9V10B3B4B9B10F3F4F9F10
  1. *Species were named according to their closest relative.

Lactobacillus jensenii+++
Lactobacillus iners+++
Lactobacillus crispatus+++++
Lactobacillus casei +
Lactobacillus paracasei+
Lactobacillus rhamnosus+
Lactobacillus gasseri++
Lactobacillus fermentum++++
Lactobacillus plantarum+
Weissella confusa++++++++
Leuconostoc fallax+
Leuconostoc citreum+++++++
Aerococcus sp.+
Total322434335424

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Traditionally, the description of the bacterial microbiota of human mucosal ecosystems has been based on culturing techniques which tend to underestimate the bacterial diversity of such ecosystems (Vaughan et al. 2002). The use of molecular methods that rely on culture-independent approaches allows a more complete and reliable assessment of bacterial diversity (Vaughan et al. 2005). The 16S rRNA gene approach used in this study, DGGE analysis of PCR products obtained with Lactobacillus group-specific primers, results in a fingerprint that represents the diversity of the rRNA gene nucleotide sequences related to the species in this group (Favier et al. 2002; Heilig et al. 2002). The construction of clone libraries further allows the phylogenetic affiliation of populations corresponding to the bands which are visible within the DGGE patterns.

The PCR–DGGE profiles of all samples did not reveal a delivery-specific clustering. In fact, UPGMA analysis based on the Dice similarity coefficient revealed that the sample profiles from the different mothers clustered independently from the delivery mode. The origin of the lactic acid bacteria present in breast milk and in the infant gut is far from clear. It has been suggested that neonates would acquire them by oral contamination with vaginal strains during the transit through the labour channel; subsequently, newborns would transmit such bacteria to the breast during breastfeeding (Mackie et al. 1999; Isolauri et al. 2001; Heikkilä and Saris 2003). The Lactobacillus phylotypes detected in the vaginal samples are in agreement with recent 16S rRNA gene-targeted culture-independent studies, in which Lact. crispatus, Lact. jensenii and Lact. iners were identified among the dominant species in the vagina of healthy women (Burton et al. 2003; Zhou et al. 2004). Interestingly, none of the Lactobacillus species detected in vaginal samples were present in breast milk provided by the women whose neonates were born by vaginal delivery, a fact that suggests that transit through the vagina does not play a role in the establishment of lactobacilli found in breast milk. Additionally, the profiles of Lactobacillus sequences retrieved from infant faeces were more similar to those retrieved from breast milk of the respective mothers than to those obtained from the respective vaginal swabs (Table 2, Figs 1, 2). Such results are also in agreement with recent molecular studies which have shown that bacterial colonization is not significantly related to the delivery method and that vaginal delivery has, if any, a minor role in the development of the infant gut microbiota (Tannock et al. 1990; Matsumiya et al. 2002; Martín et al. 2003; Ahrnéet al. 2005). A molecular epidemiological study on the transmission of vaginal Lactobacillus species from mother to the newborn infant showed, that only less than one-fourth of the infants acquired maternal vaginal lactobacilli at birth, and that 1 month later, they had been replaced by lactobacilli associated with human milk (Matsumiya et al. 2002). It is illustrative that although the infant faeces used in this study were obtained at day 7 after birth, the spectrum of Lactobacillus group species found in such samples closely resembled that of the respective breast milk samples and not the respective vaginal swabs (Figs 1, 2).

Several studies have indicated a vertical mother-to-child transmission of the first bacterial colonizer(s) from the maternal gut to that of the breast-fed infant even for those neonates born by caesarian section (Favier et al. 2002; Matsumiya et al. 2002; Martín et al. 2003; Schultz et al. 2004; Ahrnéet al. 2005). In contrast to the maternal vagina, breast milk seems to constitute a good source of lactobacilli to the infant gut (Matsumiya et al. 2002; Heikkilä and Saris 2003; Martín et al. 2003). A recent molecular survey on the Lactobacillus species present in the gut microbiota of Swedish infants showed that they were significantly more often isolated from the faeces of infants receiving breast milk, than from weaned infants (Ahrnéet al. 2005). Similarly, it has been observed that at 6 months, Lactobacillus counts are significantly higher in breast-fed than formula-fed infants (Rinne et al. 2005).

It is not strange that the spectrum of Lactobacillus group sequences retrieved from breast milk and infant faeces was narrow, as within a mother–infant pair, the Lactobacillus composition of infant faeces and breast milk seems to be host-specific and usually only includes a low number of lactobacilli strains (Heikkilä and Saris 2003; Martín et al. 2004). As an example, the examination of Lactobacillus colonization in 112 infants during the first 6 months of life showed that 26% of them lack lactobacilli, 37% carried a single strain, 26% two strains and only 11% three strains or more (Ahrnéet al. 2005). Sequences matching with Lact. gasseri were not found in this study, whereas culturing-based studies have described it as a frequently found breast milk species (Matsumiya et al. 2002; Martín et al. 2003). This may be explained by the low number of mothers (n = 4) whose samples were used to construct clone libraries and/or possibly to its presence as a subdominant species within the Lactobacillus species spectrum existing in the participating mothers. At present, work is in progress to elucidate, at the strain level, if there is a mother-to-child vertical transmission of lactobacilli.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

The authors are grateful to J.M. Odriozola (Servicio de Obstetricia, Hospital Doce de Octubre, Madrid, Spain) for providing the biological samples analysed in this work. This study was partly supported by grant AGL2003-01242 from the Ministerio de Educación y Ciencia (Spain), and contract QLK1-1999-51298 from the European Commission (Marie Curie training site for ‘Microbiology of the Gastrointestinal Tract’ at Wageningen University).

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  • Ahrné, S., Lönnermark, E., Wold, A.E., Åberg, N., Hesselmar, B., Saalman, R., Strannegård, I.L., Molin, G., et al. (2005) Lactobacilli in the intestinal microbiota of Swedish infants. Microb Infect 7, 12561262.
  • Beasley, S.S. and Saris, P.E.J. (2004) Nisin-producing Lactococcus lactis strains isolated from human milk. Appl Environ Microbiol 70, 50515053.
  • Burton, J.P., Cadieux, P.A. and Reid, G. (2003) Improved understanding of the bacterial vaginal microbiota of women before and after probiotic instillation. Appl Environ Microbiol 69, 97101.
  • Favier, C.F., Vaughan, E.E., De Vos, W. and Akkermans, A. (2002) Molecular monitoring of succession of bacterial communities in human neonates. Appl Environ Microbiol 68, 219226.
  • Hanson, L.A. and Korotkova, M. (2002) The role of breastfeeding in prevention of neonatal infection. Semin Neonatol 7, 275281.
  • Heikkilä, M.P. and Saris, P.E.J. (2003) Inhibition of Staphylococcus aureus by the commensal bacteria of human milk. J Appl Microbiol 95, 471478.
  • Heilig, G.H.J., Zoetendal, E.G., Vaughan, E.E., Marteau, P., Akkermans, A.D.L. and De Vos, W.M. (2002) Molecular diversity of Lactobacillus spp. and other lactic acid bacteria in the human intestine as determined by specific amplification of 16S ribosomal DNA. Appl Environ Microbiol 68, 114123.
  • Isolauri, E., Sütas, Y., Kankaanpää, P., Arvilommi, H. and Salminen, S. (2001) Probiotics: effects on immunity. Am J Clin Nutr 73, 444S450S.
  • Lane, D.J. (1991) 16S/23S rRNA sequencing. In Nucleic acid Techniques in Bacterial Systematics ed. Stackebrandt, E. and Goodfelow, W. pp. 115175 Chichester, UK: J. Wiley and Sons.
  • Mackie, R.I., Sghir, A. and Gaskins, H.R. (1999) Developmental microbial ecology of the neonatal gastrointestinal tract. Am J Clin Nutr 69, 1035S1045S.
  • Martín, R., Olivares, M., Marín, M.L., Fernández, L., Xaus, J. and Rodríguez, J.M. (2005) Probiotic potential of 3 lactobacilli strains isolated from breast milk. J Hum Lact 21, 817.
  • Martín, R., Langa, S., Reviriego, C., Jiménez, E., Marín, M.L., Xaus, J., Fernández, L. and Rodríguez, J.M. (2003) Human milk is a source of lactic acid bacteria for the infant gut. J Pediatr 143, 754758.
  • Martín, R., Langa, S., Reviriego, C., Jiménez, E., Marín, M.L., Olivares, M., Boza, J., Jiménez, J., et al. (2004) The commensal microflora of human milk: new perspectives for food bacteriotherapy and probiotics. Trends Food Sci Technol 15, 121127.
  • Matsumiya, Y., Kato, N., Watanabe, K. and Kato, H. (2002) Molecular epidemiological study of vertical transmission of vaginal Lactobacillus species from mothers to newborn infants in Japanese, by arbitrarily primed polymerase chain reaction. J Infect Chemother 8, 4349.
  • Morrow, A.L. and Rangel, J.M. (2004) Human milk protection against infectious diarrhea: implications for prevention and clinical care. Semin Pediatr Infect Dis 15, 221228.
  • Muyzer, G., De Waal, E.C. and Uitterlinden, G.A. (1993) Profiling of complex populations by denaturating gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl Environ Microbiol 59, 695700.
  • Newburg, D.S. (2005) Innate immunity and human milk. J Nutr 135, 13031312.
  • Rinne, M.M., Gueimonde, M., Kalliomäki, M., Hoppu, U., Salminen, S.J. and Isolauri, E. (2005) Similar bifidogenic effects of prebiotic-supplemented partially hydrolyzed infant formula and breastfeeding on infant gut microbiota. FEMS Immunol Med Microbiol 43, 5965.
  • Sanguinetti, C.J., Dias Neto, E. and Simpson, A.J.G. (1994) Rapid silver staining and recovery of PCR products separated on polyacrylamide gels. Biotechniques 17, 915919.
  • Schultz, M., Göttl, C., Young, R.J., Iwen, P. and Vanderhoof, J.A. (2004) Administration of oral probiotic bacteria to pregnant women causes temporary infantile colonization. J Pediatr Gastroenterol Nutr 38, 293297.
  • Suau, A., Bonnet, R., Sutren, M., Godon, J.J., Gibson, G.R., Collins, M.D. and Doré, J. (1999) Direct analysis of genes encoding 16S rRNA from complex communities reveals many novel molecular species within the human gut. Appl Environ Microbiol 65, 47994807.
  • Tannock, G.W., Fuller, R., Smith, S.L. and Hall, M.A. (1990) Plasmid profiling of members of the Family Enteroacteriaceae, lactobacilli, and bifidobacteria to study the transmission of bacteria from mother to infant. J Clin Microbiol 28, 12251228.
  • Vaughan, E.E., Heilig, G.H.J., Ben-Amor, K. and De Vos, W.M. (2005) Diversity, vitability and activities of intestinal lactic acid bacteria and bifidobacteria assessed by molecular approaches. FEMS Microbiol Rev 29, 477490.
  • Vaughan, E.E., Schut, F., Heilig, G.H.J., Zoetendal, E.G, De Vos, W.M. and Akkermans, A.D.L. (2002) A molecular view of the intestinal ecosystem. Curr Issues Intest Microbiol 1, 112.
  • Wright, K.C., Bauer, M., Naylor, A., Sutcliffe, E. and Clark, L. (1998) Increasing breastfeeding rates to reduce infant illness at the community level. Pediatrics 101, 837844.
  • Zhou, X., Bent, S.J., Schneider, M.G., Davis, C.C., Islam, M.R. and Forney, L. (2004) Characterization of vaginal microbial communities in adult healthy women using cultivation-independent methods. Microbiology 150, 25652573.
  • Zoetendal, E.G., Akkermans, A.D.L. and De Vos, W.M. (1998) Temperature gradient gel electrophoresis analysis of 16S rRNA from human fecal samples reveals stable and host-specific communities of active bacteria. Appl Environ Microbiol 64, 38543859.