SEARCH

SEARCH BY CITATION

Keywords:

  • Cladosporium fulvum;
  • leaf mould of tomato;
  • microsatellite region;
  • real-time PCR

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Aims:  The aim of this study was to develop a sensitive real-time polymerase chain reaction (PCR) assay for the rapid detection of Cladosporium fulvum in tomato leaves.

Methods and Results:  Three PCR primer pairs were designed based on the nucleotide sequences of: (i) the internal transcribed spacer regions of ribosomal RNA; (ii) a microsatellite region amplified by the microsatellite primer M13; and (iii) the β-tubulin gene of C. fulvum. Each primer pair amplified the expected target DNA fragment from geographically diverse isolates of C. fulvum. No PCR products were amplified with these primer pairs from DNA of other fungal species. Among the three pairs of primers, the primer pair CfF1/CfR1 developed based on the microsatellite region was the most sensitive. Using this sensitive primer pair, a real-time PCR assay was developed to detect early infection of C. fulvum in tomato leaves.

Significance and Impact of the Study:  DNA regions amplified by the microsatellite primer M13 have a high potential for developing highly sensitive species-specific PCR primers for the detection of phytopathogenic fungi. The real-time PCR assay developed in this study is useful in monitoring early infection of C. fulvum, and can help growers make timely decisions on fungicide application.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Leaf mould of tomato (LMT), caused by the fungus Cladosporium fulvum, is a common and destructive disease of tomato worldwide grown in greenhouse or under humid conditions. Generally, the foliage of tomato is the only tissue affected by the fungus, although occasionally stems, blossoms, petioles and fruit are also attacked (Jones et al. 1997). When humidity is high, the fungus develops rapidly on the foliage, usually starting on the lower leaves and progressing upwards. If the disease is not controlled, large portions of the foliage can be killed, resulting in significant yield reductions.

Between seasons, the fungus survives as conidia or sclerotia on plant debris, in seed and soil. Conidia of C. fulvum may survive in the greenhouse for at least 1 year. Old conidia and new conidia produced from surviving sclerotia act as primary inoculum to infect tomato leaves when conditions become favourable. After settling on the abaxial side of a leaf, conidia of the fungus germinate and the resulting hyphae penetrate through open stomata and proliferate in the apoplast (Thomma et al. 2005). Under favourable conditions of high humidity (>85%) and warm temperatures (24–26°C), disease symptoms appear 7–10 days after the start of infection as pale green or yellowish diffuse spots on the upper leaf surface, which later enlarge, turning into distinctive yellow spots. The most distinct symptoms are seen on the abaxial side of the leaf as patches of white to olive-green mould that turn brown once sporulation occurs 2–3 weeks after infection. At this stage, conidiophores emerge from stomata, block stomata and produce numerous conidia. As a result of stomatal clogging, plant respiration is severely hampered, resulting in wilting of leaves, partial defoliation and, in severe infections, death of the host (Jones et al. 1997).

Control of the LMT is difficult as most cultivars of tomato planted are susceptible to the fungus. Resistant varieties are of limited use, because the fungus mutates readily and new virulent races can develop in only a few years (Stergiopoulos et al. 2007). A tomato variety which is resistant in a particular year may become susceptible in the next (Wang et al. 2003). One primary method of LMT management is through the use of fungicides, and the stage of early infection is the best time for fungicide application. Thus, early detection of the pathogen is important for growers to make a timely decision on fungicide application. The current method for the identification of C. fulvum infection based on morphological characteristics of fungus and symptoms of disease on tomato leaves is time consuming and requires an experienced observer. Therefore, it is necessary to develop a rapid and reliable method for the detection of C. fulvum in the early infection stage.

Advances in molecular biology, particularly the real-time polymerase chain reaction (PCR), have provided new opportunities for rapid detection and identification of plant pathogens and diagnosis of plant diseases. Currently, several approaches have been used successfully for designing species-specific PCR primers for the detection of various phytopathogenic fungi. The internal transcribed spacer (ITS) regions of ribosomal RNA and β-tubulin gene are perhaps the most common targets for the development of species-specific PCR primers (McCartney et al. 2003; Kong et al. 2004). Additionally, as microsatellite regions (or simple sequence repeats) evolve quickly, and are widely dispersed in eukaryotic genomes with high numbers of copies (Balloux and Lugon-Moulin 2002; Chistiakov et al. 2005), they could be utilized for designing species-specific primers for differentiation of genetically related species, although advantages of microsatellite DNA in PCR diagnostics of plant diseases have not been recognized fully. As the microsatellite DNA sequences are abundantly distributed across genomes, primers developed based on such sequences might be much more sensitive than those developed from single-copy genes (such as β-tubulin) in theory. To confirm this hypothesis, the objectives of this study were: (i) to compare sensitivity of the PCR primers developed based on DNA sequences of the β-tubulin gene, ITS regions and a microsatellite region in C. fulvum; and (ii) develop a real-time PCR assay for the rapid detection of C. fulvum in tomato leaves.

Materials and Methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Isolation of fungal DNA

Single-spore isolates of C. fulvum collected from Zhejiang, Jiangsu and Sichuan provinces of China were used in this study (Table 1). Single conidial isolates were obtained by taking conidia from infected plant tissues, streaking onto acidified (2·5 ml of 25% v/v lactic acid per litre) potato dextrose agar (PDA) (BD Biosciences, New Jersey, USA) plates, and 1 day later transferring individual germinating conidia to fresh PDA plates.

Table 1.   Isolates of Cladosporium fulvum and other fungal species used in this study
SpeciesIsolatesDate of isolationOriginAmplification with primer pair
CfF1/CfR1*CfF2/CfR2†CfF3/CfR3‡
  1. *Polymerase chain reaction (PCR) amplification with primer pair CfF1/CfR1 developed from the DNA sequence of a microsatellite region; +, the presence of an expected 328-bp fragment; −, the absence of the fragment.

  2. †PCR amplification with primer pair CfF2/CfR2 developed from the DNA sequence of ITS regions; +, the presence of an expected 312-bp fragment; −, the absence of the PCR product.

  3. ‡PCR amplification with primer pair CfF3/CfR3 designed from the DNA sequence of β-tubulin gene; +, the presence of an expected 283-bp fragment; −, the absence of the fragment.

C. fulvumCf1-107-05-2006Hangzhou, Zhejiang+++
C. fulvumCf1-207-05-2006Hangzhou, Zhejiang+++
C. fulvumCf1-707-05-2006Hangzhou, Zhejiang+++
C. fulvumCf1-907-05-2006Hangzhou, Zhejiang+++
C. fulvumCf1-1907-05-2006Hangzhou, Zhejiang+++
C. fulvumCf1-1907-05-2006Hangzhou, Zhejiang+++
C. fulvumCf1-2107-05-2006Hangzhou, Zhejiang+++
C. fulvumCf1-2407-05-2006Hangzhou, Zhejiang+++
C. fulvumCf2-207-14-2006Hangzhou, Zhejiang+++
C. fulvumCf2-307-14-2006Hangzhou, Zhejiang+++
C. fulvumCf2-407-14-2006Hangzhou, Zhejiang+++
C. fulvumCf2-607-14-2006Hangzhou, Zhejiang+++
C. fulvumCf2-807-14-2006Hangzhou, Zhejiang+++
C. fulvumCf2-907-14-2006Hangzhou, Zhejiang+++
C. fulvumCf2-1107-14-2006Hangzhou, Zhejiang+++
C. fulvumCf4-407-21-2006Meishan, Sichuan+++
C. fulvumCf4-1607-21-2006Meishan, Sichuan+++
C. fulvumCf5-808-14-2006Nanjing, Jiangsu+++
C. fulvumCf5-908-14-2006Nanjing, Jiangsu+++
C. fulvumCf5-1308-14-2006Nanjing, Jiangsu+++
C. fulvumCf5-1508-14-2006Nanjing, Jiangsu+++
Alternaria sp.A104-18-2006Fuzhou, Fujian
Aureobasidium pullulans Ap5206-09-2006Wuhan, Hubei
Botryisphaeria dothideaBd10112-02-2006Changsha, Hunan
Botrytis cinereaBc6311-05-2006Hangzhou, Zhejiang
Fusarium sp.Fu9809-20-2006Hangzhou, Zhejiang
Monilinia sp.Mo3611-16-2006Hangzhou, Zhejiang
Penicillium sp.Ps30709-15-2006Hangzhou, Zhejiang
Rhizoctonia solaniRs16808-25-2006Nanjing, Jiangsu
Gilbertella persicariaGp56312-09-2006Hangzhou, Zhejiang
Sclerotinia sclerotiorumSs97603-09-2006Jinhua, Zhejiang
Trichoderma sp.Ts11108-09-2006Hangzhou, Zhejiang
Ulocladium atrumUa36910-19-2006Hangzhou, Zhejiang

To extract fungal DNA, each isolate was grown on PDA plates at 24°C for 5 days. Conidia and mycelia of each isolate were harvested by gently scraping the surface of a culture with a sterilized loop, and placing into a 1·5-ml microcentrifuge tube. Total genomic DNA was extracted by a modification of a previously published protocol (Ma et al. 2001). Briefly, fresh fungal material (approximately 100 mg) was ground with a motor-driven pestle in 1 ml of hot (65°C) extraction buffer [2% hexadecyltrimethylammonium bromide (CTAB), 1·4 mol l−1 NaCl, 50 mmol l−1 Tris-HCl, pH 8·0, 10 mmol l−1 EDTA and 1%β-mercaptoethanol] in a 1·5-ml centrifuge tube. After incubation at 65°C for 1 h, an equal volume of phenol/chloroform/isoamyl alcohol (25 : 24 : 1) (v/v/v) was added into each tube to emulsify. The tubes were spun for 10 min at 10 000 g. The supernatants were transferred to new tubes, and an equal volume of isopropanol was added into each tube to precipitate DNA. After incubation at −20°C for 30 min, the tubes were spun for 15 min at 10 000 g. Recovered DNA pellets were washed with 70% ethanol and suspended in elution buffer (100 mmol l−1 Tris-HCl, pH 8·0) with RNase (20 mg l−1).

Development of species-specific PCR primers based on a microsatellite fragment from Cladosporium fulvum

To obtain a microsatellite DNA fragment for design of species-specific PCR primers, the microsatellite primer M13 (Table 2) (Meyer et al. 1993) was used in microsatellite primed (MP-)PCR amplifications with C. fulvum genomic DNA as template. PCR was performed using a PTC-200 DNA Engine Cycler (MJ Research, Massachusetts, USA) in 50-μl volumes containing 10 ng fungal DNA, 0·2 μmol l−1 of the primer, 0·2 mmol l−1 of each dNTP, 2·0 mmol l−1 MgCl2, 1 ×  Promega Taq polymerase buffer (Promega, Shanghai, China) and 1·5 U of Promega Taq Polymerase. Amplification was performed using the following parameters: an initial preheat for 3 min at 95°C, 40 cycles of denaturation at 94°C for 1 min, annealing at 45°C for 1 min, extension at 72°C for 1·5 min, and a final extension at 72°C for 5 min. PCR products were separated by electrophoresis in 1·5% agarose gels in Tris-acetate (TAE) buffer and photographed after staining with ethidium bromide. An approximately 1300-bp bright band amplified by the primer M13 from each tested isolate of C. fulvum was purified using an UNIQ gel extraction kit (Sangon Co., Shanghai, China). The purified fragment was ligated into the pMD18-T Vector (TaKaRa Biotech. Co., Dalian, China), and transformed into Escherichia coli Cast & Chalm (strain DH5α) cells. The cloned fragment was sequenced by Invitrogen Biotech. Co. Ltd (Shanghai, China) using primers RV-M, M13-47.

Table 2.   The polymerase chain reaction (PCR) primers used in this study
PrimerSequence (5′-3′)Relevant characteristics
  1. ITS, internal transcribed spacer.

M13GAG GGT GGC GGT TCTA microsatellite primer
ITS1 (forward) ITS4 (reverse)TCCGTAGGTGAACCTGCGG TCCTCCGCTTATTGATATGCConserved primer pair for amplification of ITS regions of Cladosporium fulvum
CfF1 (forward) CfR1 (reverse)GAATGATAATGATACCCACGCAC CGGTGGGATAATACGAAAAACCSpecies-specific PCR primer pair developed based on DNA sequence of a microsatellite region for detection of C. fulvum
CfF2 (forward) CfR2 (reverse)TGAACCTTACCTACCGTTGCT GCCCGAGGGTTGAAATGASpecies-specific PCR primer pair developed based on DNA sequence of ITS regions for detection of C. fulvum
CfF3 (forward) CfR3 (reverse)AAGTTTCTCGCTGTTGCC TCCTGTCAATGGTTGTTCTGSpecies-specific PCR primer pair developed based on DNA sequence of β-tubulin gene for detection of C. fulvum

Based on the DNA sequence of this microsatellite fragment, a pair of PCR primers CfF1/CfR1 was designed to target this region (Table 2). The primer pair was expected to be specific to C. fulvum as the sequence of microsatellite fragment was identified to be unique using Blast from the NBCI (http://www.ncbi.nlm.nih.gov/).

Design of species-specific PCR primer pair based on the ITS regions of Cladosporium fulvum

To obtain the ITS regions from C. fulvum, the conserved PCR primers ITS1/ITS4 (Table 2) (White et al. 1990) were used to amplify the ITS regions of C. fulvum. PCR was performed using the same conditions as described earlier for the MP-PCR except that a pair of primers ITS1/ITS4 and the annealing temperature of 53°C were used. PCR products were separated by electrophoresis in 1·5% agarose gels in TAE buffer and photographed after staining with ethidium bromide. A single fragment (615 bp) was generated, purified and ligated into the pMD18-T Vector. The cloned fragment was sequenced by Invitrogen Biotech. Co. Ltd. The unique sequences in the ITS regions of C. fulvum were identified using the blast of NBCI. Based on the unique DNA sequences of the ITS regions from C. fulvum, a pair of PCR primers CfF2/CfR2 was designed to target unique sequences of C. fulvum ITS (Table 2).

Design of species-specific PCR primer pair based on DNA sequence of β-tubulin of Cladosporium fulvum

The design of PCR primers based on the sequences of the β-tubulin gene has gained widespread usage in PCR diagnosis of phytopathogenic fungi. Sequences of β-tubulin genes may have little variation in their translated amino acid sequences among genetically related fungal species, but their third codon position and intron regions appear to have relatively high rates of nucleotide substitutions and could be used for designing species-specific PCR primers (McCartney et al. 2003). In a previous study, β-tubulin was isolated from C. fulvum (Yan et al., unpublished, GenBank accession no. EF432762). Based on the DNA sequence of the β-tubulin gene, a pair of PCR primers CfF3/CfR3 (Table 2) was designed. The primers CfF3 and CfR3 were located within the first and third introns of the β-tubulin gene, respectively. As the sequence of introns was found to be unique using blast of NCBI, this primer pair was expected to target the β-tubulin of C. fulvum specifically.

Determination of specificity and sensitivity of PCR primers pairs

To determine the specificity of the primer pairs CfF1/CfR1, CfF2/CfR2 and CfF3/CfR3, 21 isolates of C. fulvum, collected from three provinces of China and 12 isolates of other fungal species were used (Table 1) for the PCR amplifications with these primer pairs. Additionally, the DNA extracted from micro-organisms washed from 50 tomato leaves without any symptoms of leaf mould was also used to determine the specificity of these primer pairs. PCR reactions were performed as described earlier. The PCR amplification parameters were an initial preheat for 3 min at 95°C, 35 cycles of denaturation at 94°C for 30 s, annealing at 62°C for the primer pair CfF1/CfR1, 60°C for the CfF2/CfR2 or 58°C for the CfF3/CfR3 for 30 s, extension at 72°C for 30 s, and a final extension at 72°C for 5 min. PCR products (10 μl per sample) were analysed by electrophoresis in 1·5% agarose gels in TAE buffer. The experiment was repeated twice.

In sensitivity tests, serial dilutions of DNA (4 fg to 40 ng) were used as template for PCR amplification. The PCR amplifications were performed using the parameters described earlier in the specificity tests. After amplifications, PCR products (10 μl per sample) were separated by electrophoresis in 1·5% agarose gels in TAE buffer. The experiment was repeated twice.

Real-time PCR for the detection of Cladosporium fulvum from tomato leaves

In 2006, tomato leaves showing suspect incipient infections of C. fulvum were collected from a greenhouse and a field at the Hangzhou Vegetable Institute (Hangzhou, Zhejiang Province) and Meishan (Sichuan Province), respectively. A small leaf disk (0·2 × 0·2 cm) having suspect incipient infection was taken from each leaf. DNA from leaf disks (200 mg for each DNA sample) was extracted using the method described earlier, except that 2% polyvinyl polypyrrolidone (PVPP) was added in the DNA extraction buffer. To remove PCR inhibitors released from tomato tissue, DNA extract was further purified using the UNIQ gel extraction kit. The final DNA was resuspended in 20 μl elution buffer and a 1-μl aliquot of DNA was used for each real-time PCR amplification. DNA from 200-mg healthy tomato leaf disks was also extracted and used as the control in real-time PCR amplifications.

The primer pair CfF1/CfR1 was selected for the real-time PCR assay as this primer pair was more sensitive than the primers CfF2/CfR2 and CfF3/CfR3 (see Results in detail). Real-time PCR amplifications were performed with the DNA Engine Opticons 4 System (MJ Research, MA, USA) using the SYBR green I fluorescent dye detection. Amplifications were conducted in 20-μl volumes containing 10 μl iQ SYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA, USA), 1-μl template DNA, and 0·5 μl of both CfF1 and CfR1 (4 mmol l−1 each). To create a standard curve, 10-fold serial dilutions of C. fulvum DNA (ranging from 4 fg to 40 ng), which was extracted from the pure culture of isolate Cf1-1, spiked with 1-μl tomato DNA extracted from healthy leaves, were used for each experiment. Additionally, each experiment also included a positive control using C. fulvum DNA as template, and negative controls using DNA of healthy tomato leaves. The PCR amplifications were performed using the following parameters: an initial preheat for 3 min at 95°C, followed by 35 cycles at 95°C for 20 s, 62°C for 25 s, 72°C for 30 s and 79°C for 3 s in order to detect and quantify the fluorescence at a temperature above the denaturation of primer–dimers. Once amplifications were completed, melting curves were obtained based on a standard protocol (refer to manual) and used to identify PCR products. After the amplifications were completed, data were analysed by using the DNA Engine Opticons 4 software (version 2.02). There were two replicates for each DNA sample, and the experiment was repeated twice.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Development of species-specific PCR primers for detecting Cladosporium fulvum based on microsatellite and ITS regions

The microsatellite primer M13 amplified a 1320-bp DNA fragment from each C. fulvum isolate tested (Fig. 1). The sequence was submitted to GenBank under the accession number EF432763. Analysis of the DNA sequence of this fragment using Blast from the NBCI showed that the sequence was not homologous to any known sequences in the GenBank. Based on the DNA sequence of this fragment, the primer pair CfF1/CfR1 was designed. The primer pair was expected to amplify a 328-bp DNA fragment from C. fulvum genome only.

image

Figure 1.  DNA fingerprint patterns generated from genomic DNA of Cladosporium fulvum with the microsatellite primer M13. The arrow indicates the characteristic DNA fragment that was cloned, sequenced and used for the design of species-specific PCR primers for detecting C. fulvum.

Download figure to PowerPoint

The conserved primers ITS1/ITS4 amplified a 615-bp fragment from C. fulvum. The sequence was submitted to GenBank under accession number EF432764. Using the Blast of NBCI and clustalw programs, unique sequences in ITS1 and ITS2 regions of C. fulvum were identified (data not shown) and used for designing species-specific primers. The primers CfF2 and CfR2 were located at ITS1 and ITS2, respectively, and expected to amplify a 312-bp fragment from C. fulvum.

Specificity and sensitivity of PCR primers

In specificity tests, the primer pair CfF1/CfR1 based on the 1320-bp microsatellite fragment, the primer pair CfF2/CfR2 based on the sequence of the ITS regions, and the primer pair CfF3/CfR3 based on the intron sequences of the β-tubulin gene of C. fulvum amplified the expected 328-, 312- and 283-bp fragments, respectively, from each C. fulvum isolate, but not from any other fungal species tested (Fig. 2a–c; Table 1) nor from the micro-organisms washed from healthy tomato leaves, which indicated that these primer pairs were specific to C. fulvum.

image

Figure 2.  Specificity of primer pairs: (a) CfF1/CfR1; (b) CfF2/CfR2; and (c) CfF3/CfR3, which were developed based on DNA sequences of a microsatellite region, internal transcribed spacer regions and β-tubulin gene, respectively, for the detection of Cladosporium fulvum.

Download figure to PowerPoint

Sensitivity assays showed that both PCR primer pairs CfF1/CfR1 and CfF2/CfR2 consistently amplified expected fragments in 0·4 pg of C. fulvum DNA (Fig. 3a, b) in two repeated tests. However, the intensity of the band amplified by primer pair CfF2/CfR2 was weaker than that amplified by CfF1/CfR1 when 4 or 0·4 pg of C. fulvum DNA was used as template for amplification. The PCR assay with primer pair CfF1/CfR1 was 100-fold more sensitive than that with primer pair CfF3/CfR3 (Fig. 3a, c). Thus, the most sensitive primer pair CfF1/CfR1 was used in the real-time PCR tests for the detection of C. fulvum in tomato leaves.

image

Figure 3.  Sensitivity of primer pairs: (a) CfF1/CfR1; (b) CfF2/CfR2; and (c) CfF3/CfR3, which were developed based on DNA sequences of a microsatellite region, internal transcribed spacer regions, and β-tubulin gene, respectively, for the detection of Cladosporium fulvum.

Download figure to PowerPoint

Real-time PCR for the detection of Cladosporium fulvum in tomato leaves

In real-time PCR amplifications with the primer pair CfF1/CfR1, different SYBR green I signal intensities were detected from serial dilutions of C. fulvum DNA spiked with DNA from healthy tomato leaves. An expected 328-bp DNA fragment amplified by this primer pair had a peak at 81·2°C in the melting curve. Using the DNA Engine Opticon 4 software, a standard curve was generated (Fig. 4), and the amount of C. fulvum in the tested samples was calculated by comparing Ct values to the crossing point values of the linear regression line of the standard curve. The C. fulvum DNA was not detected from healthy tomato leaves, but the amount of C. fulvum DNA in the five tested samples detected by the real-time PCR ranged from 0·28 to 20·78 pg (Table 3).

image

Figure 4.  Standard curve obtained by plotting the log amount of Cladosporium fulvum DNA (ng) vs the threshold cycle of each reaction detected by real-time polymerase chain reaction with the primer pair CfF1/CfR1.

Download figure to PowerPoint

Table 3.   Quantification of Cladosporium fulvum DNA extracted from tomato leaves collected from a greenhouse in Hangzhou (Zhejiang province) and a field in Meishan (Sichuan province), China. The two cities are more than 2000 km apart
SampleLocationDate of collectionAmount of C. fulvum DNA determined by real-time PCR (pg)*
  1. PCR, polymerase chain reaction.

  2. *Values in the columns are the averages of three experiments; standard errors are in the parentheses.

HZ6-2Hangzhou, Zhejiang province07/20068·56 (8·55)
HZ6-3Hangzhou, Zhejiang province07/20060·28 (0·37)
HZ6-aHangzhou, Zhejiang province11/200615·71 (7·92)
HZ6-bHangzhou, Zhejiang province11/20060·79 (1·11)
SC4-1Meishan, Sichuan province07/200620·78 (11·82)

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

A reliable PCR assay depends on having highly sensitive PCR primers that are specific to the target organism. There are several approaches that have been used to develop PCR primers for the detection of plant pathogens (Ma and Michailides 2007). In the present study, we found that the primers developed based on the sequence of a microsatellite region amplified by the primer M13 were 100 times more sensitive than the primers developed based on the single-copy β-tubulin gene. In a previous study (Ma et al. 2003), and the preliminary tests of this study, we found that the microsatellite primer M13 was able to amplify unique intensive bands from most tested phytopathogenic fungal species, including Alternaria spp., Botryisphaeria dothidea, Botrytis cinerea, Fusarium spp., Monilinia spp., Penicillium spp. and Rhizoctonia solani. Recently, Gente et al. (2006) also found that DNA fingerprints generated by the primer M13 were able to distinguish 26 fungal species belonging to the genus of Geotrichum. Thus, DNA regions amplified by this microsatellite primer have a high potential for developing highly sensitive species-specific PCR primers for many other fungi.

An obstacle in using PCR for the detection of pathogens from plant tissues is the presence of PCR inhibitors. To attenuate the effects of PCR inhibitors, dilution of DNA extracts has been proven to eliminate the effects of PCR inhibitors in many studies, but it causes a reduction in PCR sensitivity (Ma and Michailides 2007). Addition of amplification facilitators, such as citric acid, sodium sulfite, polyvinylpyrrolidone (PVP), polyvinyl PVPP, BLOTTO (10% skim milk powder and 0·2% NaN3), dimethyl sulfoxide (DMSO), skim milk, bovine serum albumin (BSA) or T4 gene 32 protein (gp32) to DNA extraction buffers or to PCR mixtures has been well documented (Wilson 1997; Garcia-Pedrajas et al. 1999; Louws et al. 1999; Singh et al. 2002). However, the optimal concentrations of such compounds have to be tested in each case, as some of these reagents might also inhibit PCR amplifications when they are used at high concentrations (Wilson 1997; Koonjul et al. 1999). In this study, 2% PVPP was added into DNA extraction buffer. Following the DNA extraction, the DNA extracts were further purified using a commercial kit, UNIQ gel extraction kit ($0·35 per sample). This procedure was able to remove PCR inhibitors effectively. Using this DNA extraction procedure together with the real-time PCR method developed in this study, we were able to detect even a minute amount of C. fulvum DNA (as little as 0·28 pg) extracted from tomato leaves within a few hours. This rapid method could be used to detect early infection of C. fulvum, and also the pathogen in infected seeds.

Real-time PCR is one of the most promising methodologies for detecting pathogens, but it requires expensive equipment. The cost of the real-time PCR assay depends on how many samples can be processed simultaneously. Generally, samples taken from 42 fields (two replicates for each field sample, plus 12 wells for the construction of the standard curves) can be processed within 1 day using the DNA Engine Opticons 4 System. The average cost of the real-time PCR assay is estimated to be around $1 per reaction, excluding the cost of labour for the sample collection. However, considering that the results of the assay can be obtained within a few hours, the cost and time should be generally acceptable for most tomato growers. Currently, none of the specific molecular methods are available to the average grower in China owing to expensive equipment. However, some private diagnostic laboratories have been adopting molecular methods for detecting and identifying plant diseases. The real-time PCR assay developed in this study could be used in those diagnostic laboratories to detect early infection of C. fulvum and help growers make a timely decision on fungicide application.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

The research was supported by National Key Basic Research and Development Program (2006CB101907), the Fund for the New Century Talent Program from MOE (NCET-06-0518), and National Science Foundation of China (30500334). We thank Michael A. Yoshimura (Biological Sciences Department, California Polytechnic State University, San Luis Obispo) for reviewing the manuscript prior to submission.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  • Balloux, F. and Lugon-Moulin, N. (2002) The estimate of population differentiation with microsatellite markers. Mol Ecol 11, 155165.
  • Chistiakov, D.A., Hellemans, B. and Volckert, F.A.M. (2005) Microsatellites and their genomic distribution, evolution, function and applications: a review with special reference to fish genetics. Aquaculture 255, 129.
  • Garcia-Pedrajas, M.D., Bainbridge, B.W., Heale, J.B., Perez-Artes, E. and Jimenez-Diaz, R.M. (1999) A simple PCR-based method for detection of the chickpea-wilt pathogen Fusarium oxysporum f. sp. ciceris in artificial and natural soil. Eur J Plant Pathol 105, 251259.
  • Gente, S., Sohier, D., Coton, E., Duhamel, C. and Gueguen, M. (2006) Identification of Geotrichum candidumat the species and strain level: proposal for a standardized protocol. J Ind Microbiol Biotechnol 33, 10191031.
  • Jones, J.B., Jones, J.P., Stall, R.E. and Zitter, T.A. (1997) Compendium of Tomato Diseases. St. Paul, MN: APS Press.
  • Kong, P., Hong, C.X., Tooley, P.W., Ivors, K., Garbelotto, M.M. and Richardson, P.A. (2004) Rapid identification of Phytophthora ramorum using PCR-SSCP analysis of ribosomal DNA ITS-1. Lett Appl Microbiol 38, 433439.
  • Koonjul, P.K., Brandt, W.F., Farrant, J.M. and Lindsey, G.G. (1999) Inclusion of polyvinylpyrrolidone in the polymerase chain reverses the inhibitory effects of polyphenolic contamination of RNA. Nucleic Acid Res 27, 915916.
  • Louws, F.J., Rademaker, J.W. and De Bruijn, F.J. (1999) The three Ds of PCR-based genomic analysis of phytobacteria: diversity, detection, and disease diagnosis. Annu Rev Phytopathol 37, 81125.
  • Ma, Z. and Michailides, T.J. (2007) Approaches for eliminating PCR inhibitors and designing PCR primers for the detection of phytopathogenic fungi. Crop Prot 26, 145161.
  • Ma, Z., Boehm, E.W.A, Luo, Y. and Michailides, T.J. (2001) Population structure of Botryosphaeria dothidea from pistachio and other hosts in California. Phytopathology 91, 665672.
  • Ma, Z., Luo, Y. and Michailides, T.J. (2003) Nested PCR assays for detection of Monilinia fructicola in stone fruit orchards and Botryosphaeria dothidea from pistachios in California. J Phytopathol 151, 312322.
  • McCartney, H.A., Foster, S.J., Fraaije, B. and Ward, E. (2003) Molecular diagnostics for fungal plant pathogens. Pest Manage Sci 59, 129142.
  • Meyer, W., Mitchell, T.G., Freedman, E.Z. and Vilgalys, R. (1993) Hybridization probes for conventional DNA fingerprinting used as single primers in the polymerase chain reaction to distinguish strains of Cryptococcus neoformans. J Clin Microbiol 31, 22742280.
  • Singh, R.P., Nie, X., Singh, M., Coffin, R. and Duplessis, P. (2002) Sodium sulphite inhibition of potato and cherry polyphenolics in nucleic acid extraction for virus detection by RT-PCR. J Virol Methods 99, 123131.
  • Stergiopoulos, I., Groenewald, M., Staats, M., Lindhout, P., Crous, P.W. and De Wit, P.J.G.M. (2007) Mating-type genes and the genetic structure of a world-wide collection of the tomato pathogen Cladosporium fulvum. Fungal Genet Biol (in press).
  • Thomma, B.P.H J., Van Esse, H.P., Crous, P. and De Wit, P.J.G.M. (2005) Cladosporium fulvum (syn. Passalora fulva), a highly specialized plant pathogen as a model for functional studies on plant pathogenic Mycosphaerellaceae. Mol Plant Pathol 6, 379393.
  • Wang, Q., Wang, H., Liu, H. and Hang, Q. (2003) Bionomics of Fulvia fulva (Cooke) Ciferri. J Shanxi Agric Univ 23, 303307.
  • White, T.J., Bruns, T., Lee, S. and Taylor, J. (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications ed Innis, M.A., Gelfamd, D.H., Sninsky, J.J. and White, T.J. pp. 315322 San Diego, CA: Academic Press.
  • Wilson, I.G. (1997) Inhibition and facilitation of nucleic acid amplification. Appl Environ Microbiol 63, 37413751.