SEARCH

SEARCH BY CITATION

Keywords:

  • adhesion;
  • BIACORE;
  • glyceraldehyde-3-phosphate dehydrogenase;
  • human colonic mucin;
  • Lactobacillus plantarum;
  • probiotics

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Aims:  To characterize the adhesion molecule of Lactobacillus plantarum LA 318 that shows high adhesion to human colonic mucin (HCM).

Methods and Results:  The adhesion test used the BIACORE assay where PBS-washed bacterial cells showed a significant decrease in adherence to HCM than distilled water-washed cells. A component in the PBS wash fraction adhered to the HCM and a main protein was detected as a c. 40-kDa band using SDS-PAGE. Using homology comparisons of the N-terminal amino acid sequences compared with sequence databases, this protein was identified as glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The DNA sequence of LA 318 GAPDH was 100% identical to the GAPDH (gapB) of L. plantarum WCFS1. The purified GAPDH adhered to HCM.

Conclusions:  We found the adhesin of L. plantarum LA 318 to HCM in its culture PBS wash fraction. The molecule was identified as GAPDH. Because LA 318 possesses the same adhesin as many pathogens, the lactobacilli GAPDH may compete with pathogens infecting the intestine.

Significance and Impact of the Study:  This is the first report showing GAPDH expressed on the cell surface of lactobacilli adheres to mucin suggesting L. plantarum LA 318 adheres to HCM using GAPDH binding activity to colonize the human intestinal mucosa.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Lactobacillus are often isolated from the alimentary canal and faeces of man and animals (Ahrnéet al. 1998; Dunne et al. 1999; Song et al. 1999; Heilig et al. 2002), and are used in fermented foods acting as probiotics. The attachment ability of a strain to the intestinal mucosa is one of the criteria in selecting probiotic micro-organisms for use in foods. The reason for this is the adhesion may be a prerequisite for bacterial colonization. The adherence of lactobacilli to epithelial cells of mucosal surfaces often depends on specific binding of microbial adhesins to epithelial cell receptors. Uchida et al. (2004) found that the L. acidophilus group recognizes and binds human blood type-A antigen present on intestinal mucus using the BIACORE biosensor. This method is quantitatively based on the principle of surface plasmon resonance (SPR) (Uchida et al. 2004). Reports show a collagen binding protein to be a part of an ABC transporter system of L. reuteri (Roos et al. 1996) and the Cbs A protein of L. crispatus (Sillanpääet al. 2000) shows adhesion to a collagen of the extra-cellular matrix. In L. plantarum, a mannose-specific adhesin is suggested to be involved in the ability to colonize the intestine (Adlerberth et al. 1996).

Lactobacillus plantarum occupies diverse environmental niches such as plant material and the human gastrointestinal tract, and is used in fermented foods (Ahrnéet al. 1998; Duran-Quintana et al. 1999; Ouadghiri et al. 2005). Some strains have the capacity to adhere to the intestinal tract (Johansson et al. 1993; Maréet al. 2006; Tallon et al. 2007). L. plantarum 299v was shown to survive gastrointestinal passage after oral administration and persisted in the intestine of healthy volunteers for up to 11 days after 299v feeding cessation (Johansson et al. 1993). This suggests that these adherent L. plantarum strains may be good candidates for probiotics.

Earlier we found Lactobacillus plantarum LA 318 had this potential to be a probiotic bacterium. This strain was isolated from human intestinal tissue of a cancer patient (transverse colon, male, 48 years old, blood type O) and had high adhesion to human colonic mucin (HCM) that was mediated by a surface cell wall protein (Kinoshita et al. 2007). However, the protein on the cell surface relating to the adhesion was not characterized. Here, we characterize the adhesin molecule of Lactobacillus plantarum LA 318 and its ability to bind to HCM.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Bacterial strain and culture

We previously isolated Lactobacillus plantarum LA 318 from human intestinal tissue (transverse colon, male, 48 years old, blood type O) and identified the bacterium using 16S rDNA sequence analysis (Kinoshita et al. 2007). The strain (LA 318) before use was propagated two successive times at 37°C for 24 h in MRS broth (Difco Laboratories, Detroit, MI, USA) using a 2% (v/v) inoculums.

Isolation and purification of human colonic mucin

Human colonic mucin (HCM; blood type O) adherent to the normal mucosa of intestinal tissues was obtained by scraping the intestinal mucosa with a glass slide. Isolation and purification of HCM were performed as described previously (Uchida et al. 2004; Kinoshita et al. 2007). Lipid was removed from the crude HCM using three sequential extractions with chloroform : methanol (2:1, v/v) and diethylether. The lipid-free HCM was dissolved in 4 mol l−1 guanidine hydrochloride (GHCl) and fractionated using gel filtration chromatography with a Toyopearl HW-65F column (90 cm × 2·6 cm; Tosoh, Tokyo, Japan). Protein was measured at 280 nm and neutral sugars were detected at 490 nm using the phenol–H2SO4 method (Dubois et al. 1956). Fractions containing high concentrations of sugars were dialysed against distilled water at 4°C for 2 days and lyophilized. The purified HCM was used as the ligand for the subsequent binding studies using the Biacore method. This study was approved by the ethics committee of the Tohoku University School of Medicine.

Preparation of bacterial cells and cell wall surface proteins

LA 318 bacterial cells were washed three times with PBS to remove media components. After washing in PBS, cells were gently incubated in 4 mol l−1, 2 mol l−1, 1 mol l−1, 0·5 mol l−1 or 0·25 mol l−1 GHCl at 37°C for 2 h to extract cell surface proteins (Kinoshita et al. 2007). After centrifugation (8000 g, 20 min, 4°C), the supernatant (extracts) and the pellet (bacterial cells) were dialysed against distilled water and lyophilized. The lyophilized bacterial cells were used for the Biacore assay as the analyte and the lyophilized extracts were used for SDS-PAGE and the Biacore assay.

A 40-kDa protein from LA 318 was purified using a two-step chromatographic procedure (described below) and used for SDS-PAGE and the Biacore assay.

Biacore analysis

Adherence of the analyte to HCM was performed in triplicate using a biosensor Biacore 1000 (Biacore K.K., Tokyo, Japan) that uses quantitative SPR (Uchida et al. 2004; Kinoshita et al. 2007). The protein portion of HCM was fixed using amine coupling to the carboxyldextran layer of the sensor chip CM5 (Biacore K.K.) according to the manufacturer’s instructions. The analyte was suspended (0·1 mg ml−1) in HBS-EP buffer (HEPES-buffered saline with EDTA and polysorbate 20; 0·01 mol l−1 HEPES, pH 7·4, 0·15 mol l−1 NaCl, 3 mmol l−1 EDTA, 0·005% surfactant P20, Biacore K.K.). The analyte was allowed to interact with the sensor chip and combine with the HCM at a flow rate of 3 μl min−1 for 5 min at 25°C. After washing with HBS-EP buffer to remove unbound analyte, the resonance unit (RU) value to estimate the weight of bound analyte was measured for 200 s after cessation of sample addition. The cell surface of the sensor chip was regenerated by elution with 2 mol l−1 GHCl solution at a flow rate of 3 μl min−1 for 2 min. A response of 1000 RUs represents a weight change of 1 ng mm−2 analyte bound to the sensor chip surface. BSA (Sigma, St Louis, MO, USA) was used as a control protein with no adherence to HCM.

SDS-PAGE analysis

The cell wall surface proteins prepared from L. plantarum LA 318 were analysed using SDS-PAGE analysis according to the method of Laemmli (Cleveland et al. 1977). Molecular marker proteins and samples were dissolved in SDS buffer (60 mmol l−1 Tris, 25% glycerol, 2% SDS, 2%β-mercaptoethanol and 0·1% bromophenol blue, pH 6·8); followed by heating at 95°C for 10 min. Electrophoresis was performed on polyacrylamide gels using a discontinuous buffer system with a 4·5% stacking gel and a 12·5% separating gel (10 × 12 cm). The electrophoresis was performed using a Mini-protein III dual slab cell (Bio-Rad, Hercules, CA) at a constant current of 30 mA using a Power PAC 300 (Bio-Rad) in running buffer: 0·025 mol l−1 Tris, 0·2 mol l−1 glycine and 0·1% SDS. Protein bands were visualized by staining the gels with Comassie brilliant blue (CBB) (Rapid CBB; Kanto Chemical Co., Inc., Tokyo, Japan). Molecular weight markers from 17·2 to 200·0 kDa (Daiichi II) and from 14·4 to 97·4 kDa (Daiichi III) were obtained from Daiichi Pharmaceutical Co., Ltd (Tokyo, Japan). Database computer homology search for amino acid sequences was performed using blast from the National Center for Biotechnology Information (NCBI).

N-terminal sequence analysis

After the SDS-PAGE analysis, cell wall surface proteins were electrophoretically transferred to a polyvinylidene difluoride membrane (Applied Biosystems, Tokyo, Japan) using a semi-dry blotting apparatus (SEMI-PHORTM, Hoefer Scientific, San Francisco, CA). Then, the 40-kDa protein band of L. plantarum LA 318 from the PBS wash fraction was cut from the gel and decolorized using 50% methanol and distilled water. After applying to BioBrene (Applied Biosystems)-treated fiberglass disks, the protein was Edman degradation sequenced using a Procise ABI 473A sequencer (Applied Biosystems) (Edman 1950).

Sequencing the 40-kDa protein gene

The gene for the LA 318 40-kDa protein was amplified using the direct colony PCR technique. The primers for PCR and sequencing were designed based on the complete genome sequences of L. plantarum WCFS1 (GenBank accession no. AL935254) (Kleerebezem et al. 2003). F1 and R1 primers were designed using the sequence of the central glycolytic regulator gene and the phosphoglycerate kinase that adjoins the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene (Table 1). The PCR reaction was performed after denaturation for 10 min at 95°C using 30 cycles: 95°C for 1 min, 55°C for 1 min and 72°C for 3 min; and a final extension for 7 min at 72°C. DNA sequencing of the PCR products was performed using the primer-walking sequencing methods (Double Strand Sequencing) with a BigDye Terminator v1·1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA) (Kieleczawa et al. 1992). The primers, F1 and R1, were used as a first primer set and the second primer set was designed after the first sequencing (Table 1). The electrophoresis was performed using an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems) for 140 min at 12·2 kV. The analysis was performed using sequencing analysis software v3·7 (Applied Biosystems).

Table 1.   Primers used for sequencing of GAPDH gene
Primer namePrimer sequence (5′–3′)
F1CATCGGGAGATTATACTCGC
F2CGGTGTTGACTTCGTTCTCG
F3GTGTTGTTGATGGTTCATTA
R1TCGTCACCAATTTTGCCGTC
R2CAGCAGTAACTTTCTTGTCTAA
R3GCACCAGCGTCCAAGTGAGC

Purification of the 40-kDa protein from LA 318

The 40-kDa protein was purified from the PBS wash fraction of LA 318 using a two-step chromatographic procedure. First, diethylaminoethyl (DEAE)–Toyopearl column chromatography was performed. The PBS wash fraction of LA 318 was dialysed against 50 mmol l−1 Tris-HCl buffer containing 0·1 mmol l−1 threo-1,4-dimercapto-2,3-butanediol (DTT) and 0·1 mmol l−1 EDTA (pH 7·5) overnight at 4°C. The dialysate was loaded on a DEAE-Toyopearl 650 mol l−1 column (2·6 × 20 cm Tosoh Co. Ltd, Tokyo, Japan) equilibrated using the same Tris-HCl buffer. After the unadsorbed proteins were washed from the column, the remaining protein adsorbed to the resin was eluted using a linear gradient of NaCl from 0 to 0·5 mol l−1 in the same buffer. The elution profile of the protein was monitored at 280 nm.

Next, we used hydroxyapatite column chromatography. The fraction containing the 40-kDa protein previously isolated was pooled and dialysed against 10 mmol l−1 phosphate buffer containing 0·1 mmol l−1 DTT and 0·1 mmol l−1 EDTA (pH 6·8). The dialysate was applied to a Bio-Gel HTP hydroxyapatite column (2·6 × 5 cm; Bio-Rad) equilibrated with the same Tris-HCl buffer. After the unadsorbed proteins were washed from the column, the protein adsorbed to the resin was eluted using a linear gradient of phosphate from 10 to 300 mmol l−1. The elution profile of the protein was monitored at 280 nm. The purified 40-kDa protein was used for SDS-PAGE and the Biacore assay.

Agglutination test using LA 318 bacterial cells and antibody against GAPDH

An Agglutination test was performed using anti-glyceraldehyde-3-phosphate dehydrogenase IgG antibody (GAPDH antibody) (Nordic Immunological Laboratories, Tilburg, the Netherlands). The LA 318 bacterial cells were washed with sterilized distilled water three times and were incubated with GAPDH antibody in PBS (pH 7·2) at room temperature for 10 min. After incubation, the LA 318 bacterial cells were observed using a microscope (Olympus B ×40; Olympus Co., Tokyo, Japan).

Statistics

Statistical analyses of all data were performed using the Student’s t-test and reported as the mean ± SD.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Adhesion tests using treated bacterial cell fractions and the PBS wash fraction

Bacterial cells were tested for adhesion to HCM after washing with PBS and treating with GHCl using the biosensor Biacore assay. Although distilled water-washed bacterial cells (control) showed high adhesion (205 ± 40·9 RUs) to HCM, the adhesive activity drastically decreased by about 80% after washing with PBS at < 0·05 (Fig. 1). No large difference was observed between PBS-washed bacterial cells and each fraction of GHCl treated bacterial cells. The fraction washed with PBS (PBS wash fraction without cells) was also tested for the adhesion using the Biacore assay. Figure 2 shows a representative sensorgram for the PBS wash fraction. The PBS wash fraction showed high adhesion (88·1 RUs ± 3·5) to the HCM compared with BSA (4·7 RUs ± 3·3).

image

Figure 1.  Adhesion of bacterial cells treated with PBS or GHCl onto human colonic mucin (HCM) using the Biacore assay. Water (control): bacterial cells washed with distilled water, PBS: bacterial cells washed with PBS and 4–0·25 mol l−1 GHCl; bacterial cells treated with 4–0·25 mol l−1 GHCl after washing three times with PBS. *Significantly different from water-washed bacterial cells (control) (< 0·05). Each bar represents the mean of three data points and the error bars are ±SD.

Download figure to PowerPoint

image

Figure 2.  A representative sensorgram for the PBS wash fraction adhering to human colonic mucin (HCM) using the Biacore assay. (A) The sensorgram of PBS wash fraction. (B) The sensorgram of BSA as the control.

Download figure to PowerPoint

Identification of the adhesin from L. plantarum LA 318

The cell wall surface proteins in the PBS wash fraction and the GHCl treated fraction were analysed using SDS-PAGE. Although many proteins appeared in the GHCl fraction, a single prominent band was observed in the PBS wash fraction at c. 40 kDa (see the arrow in Fig. 3). The N-terminal amino acids from the 40-kDa band were sequenced after electrobloting and 20 amino acid residues were determined to be NH2-(M)SVKIGINGFGRIGRLAFRRI-. This partial sequence using comparison with NCBI databases was 100% identical to the GAPDH of L. plantarum WCFS1 (Kleerebezem et al. 2003). The 40-kDa protein gene of LA 318 was amplified using the primers designed from the complete genome sequence of L. plantarum WCFS1 (GenBank accession no. AL935254) and DNA sequencing of the PCR products was performed using the primer-walking method (Table 1). The LA 318 DNA sequence of GAPDH was 1023 base pairs and 340 amino acids and identical (100%) to the GAPDH (gapB) of L. plantarum WCFS1. The sequence did not show a typical N-terminal signal sequences.

image

Figure 3.  PBS wash fraction and GHCl treated fraction SDS-PAGE. M: molecular weight marker, Water: Water wash fraction, PBS: PBS wash fraction, 4–0·25 mol l−1 GHCl: 4–0·25 mol l−1 GHCl 1 treated fraction. The arrow represents c. 40-kDa protein.

Download figure to PowerPoint

Purification of the adhesin

The LA 318 adhesin-like protein was purified from the PBS wash fraction using a two-step chromatographic procedure: DEAE-Toyopearl anion-exchange column chromatography and hydroxyapatite column chromatography. In DEAE-Toyopearl anion-exchange column chromatography, the 40-kDa protein was detected in the first peak (fraction numbers 41–66) using SDS-PAGE (data not shown). We then used hydroxyapatite column chromatography. Seven fractions designated I (F9–29), II (F30–38), III (F120–124), IV (F125–130), V (F131–133), VI (F134–148) and VII (F149–155) were used for SDS-PAGE analysis (data not shown). The 40-kDa band was observed in both fractions VI and VII. A single predominant 40-kDa band was observed in fraction VII (Fig. 4). GAPDH could be purified to approx. 90% purity.

image

Figure 4.  SDS-PAGE of hydroxyapatite column chromatography fractions. M: molecular weight marker, I: fraction no. 9–29, II: fraction no. 30–38, III: fraction no. 120–124, IV: fraction no. 125–130, V: fraction no. 131–133, VI: fraction no. 134–148, VII: fraction no. 149–155.

Download figure to PowerPoint

Adherence of the purified adhesin-like protein to HCM

Figure 5 shows a representative sensorgram for purified 40-kDa protein adhering to HCM using the Biacore assay. Fraction VII showed strong adhesion to HCM at 148·1 RUs ± 35·9 (the highest RUs: 187.9) whereas BSA as a control showed no adhesion (2·4 RUs).

image

Figure 5.  A representative sensorgram for purified GAPDH adhering to human colonic mucin using the Biacore assay. (A) The sensorgram of purified GAPDH (Fraction VII). (B) The sensorgram of BSA as control.

Download figure to PowerPoint

Agglutination test of LA 318 bacterial cells using GAPDH antibody

Figure 6 shows the result of agglutination test of LA 318 bacterial cells using GAPDH antibody. Although no bacterial aggregation was observed without GAPDH antibody (Fig. 6a), some aggregation was clearly observed with antibody as shown with the arrows (Fig. 6b).

image

Figure 6.  Agglutination test of LA 318 bacterial cells using GAPDH antibody. (a) Photomicrograph of LA 318 bacterial cells without GAPDH antibody. (b) Photomicrograph of LA 318 bacterial cells with GAPDH antibody. The arrows represent aggregation of LA 318 bacterial cells by GAPDH antibody.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Probiotics have positive effects in animal and human health; however, the mechanisms of adhesion to aid intestinal colonization are poorly understood. We previously reported that the cell surface proteins of strain LA 318 adhered to HCM (Kinoshita et al. 2007). Here, we characterized one cell surface protein causing the adhesion. Interestingly, the protein was soluble in PBS where washed bacterial cells had significantly decreased adherence to HCM (Fig. 1). This suggested that the adhesin was in the PBS fraction after washing the cells. Washing bacterial cells with PBS before fractionation is a common laboratory technical procedure to remove media components; however, we here observed that caution should be taken with the soluble cell surface bacterial components or they may be discarded.

In the adhesion test with Biacore using the PBS wash fraction to HCM, an adhesion was observed (Fig. 2). The primary band appeared at c. 40 kDa using SDS-PAGE in the PBS wash fraction and suggested it may be the strain LA 318 adhesin (Fig. 3). The protein was identified as glyceraldehyde-3-phosphate dehydrogenase (GAPDH) by homology comparisons of the N-terminal aminoacid sequence in databases. Tests strongly suggested that the GAPDH was the strain LA 318 adhesin because the purified LA 318 GAPDH adhered to HCM (Fig. 5).

After extraction by GHCl, the adhesion of LA 318 cells remained. This suggested that GAPDH may remain after GHCl extraction or other adhesins may exist on LA 318. It has been reported that at least 12 proteins in L. plantarum WCFS1 are predicted to be directly involved in adherence to host components such as collagen and mucin and may play a role in the degradation of substrates by L. plantarum to sustain its growth in different environmental niches. (Boekhorst et al. 2006).

HCM has many sugar moieties compared with BSA which has none (Podolsky 1985). In our preliminary experiment, no adhesion of LA318 was observed on HCM after periodate oxidation (data not shown). This suggests GAPDH may be a lectin-like protein that recognizes the sugar chains on the HCM. Therefore, we are now performing adhesion tests with the LA 318 GAPDH using the neoglycoproteins-like blood type antigens (Uchida et al. 2004, 2006).

GAPDH is an important enzyme existing in the cytosol and performs in the sixth reaction in glycolysis. It oxidizes glyceraldehyde-3-phosphate at the 1-carbon position converting an aldehyde to a carboxylic acid and simultaneously adding a phosphate. The product is 1,3-bisphosphoglycerate. However, the agglutination test using GAPDH antibody strongly suggests that the GAPDH was located on the surface of LA 318 bacterial cells surface (Fig. 6). Moreover, we saw that LA 318 bacterial cell did not burst after PBS washing using an electron microscope (data not shown) suggesting that the GAPDH was derived from the cell surface. Reports show that some pathogens possess a GAPDH on their cell surface and they have been identified as adhesins. Streptococcal surface GAPDH (SDH) from the group A Streptococcus show multiple binding activities to plasmin(ogen) (Winram and Lottenberg 1996; D’Costa and Boyle 2000), fibronectin, lysozyme, myosin and actin (Pancholi and Fischetti 1992).

SDH recognizes uPAR/CD87 as its receptor on human pharyngeal cells and mediates bacterial adherence to host cells (Jin et al. 2005). Seifert et al. (2003) report enzymatically active GAPDH is capable of binding to cytoskeletal and extra-cellular matrix proteins and is expressed on the surface of group B Streptococcus. Surface-localized GAPDHs of Staphylococcus aureus and Staphylococcus epidermidis bind transferrin (Modun and Williams 1999); whereas the GAPDH of Candida albicans binds fibronectin and laminin (Gozalbo et al. 1998). The fimbriae of Porphyromonas gingivalis, a predominant periodontal pathogen, mediates coagglutination using the GAPDH of Streptococcus oralis (Maeda et al. 2004) to bind to human oral epithelial cells (Sojar and Genco 2005). Therefore, many pathogenic bacteria possess GAPDH on their surfaces that show binding to multiple tissues.

However, it is not known why the GAPDH exists on the cell surface without a conventional N-terminal signal peptide. It has been shown that the N-terminal half of the Candida albicans GAPDH polypeptide coded by the TDH3 gene is able to direct its incorporation into the yeast cell wall (Delgado et al. 2003). In another protein, it has been reported that one of the bacteriocins, Enterocin Q isolated from Enterococcus faecium L50 was also synthesized without an N-terminal leader sequence or signal peptide. The absence of a signal leader peptide in this bacteriocin suggests that it can be externalized by some ABC transporters (Cintas et al. 2000). More studies are needed to clarify the mechanism of how the GAPDH transfers from cytosol to the cell surface.

At the time of this publication, it was reported L. crispatus strain ST1 expresses both enolase and GAPDH on its cell surface (Hurmalainen et al. 2007) and shows a pH-dependent binding to plasminogen (Antikainen et al. 2007). However, this GAPDH was not tested against HCM. Therefore, our report is the first showing L. plantarum LA 318 isolated from human intestine combines to HCM with strong adhesion; and the strain may have multiple binding activities to colonize the intestine. As LA 318 possesses the same GAPDH adhesin as many pathogens, this suggests that they may compete in the mouth or intestine with pathogens and block infections. LA 318 may be useful in the development of new probiotic foods to protect human health.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

This study was partly supported by a Grant-in-Aid for Scientific Research (B) (2) (No. 16380179) and for Exploratory Research (No. 00118358) from the Japan Society for the Promotion of Science (JSPS) to Dr T. Saito. This study was also supported by Ryoshoku Kenkyukai (Odawara, Japan) to Dr T. Saito.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  • Adlerberth, I., Ahrné, S., Johansson, M.L., Molin, G., Hanson, L.Å. and Wold, A.E. (1996) A mannose-specific adherence mechanism in Lactobacillus plantarum conferring binding to the human colonic cell line HT-29. Appl Environ Microbiol 62, 22442251.
  • Ahrné, S., Nobaek, S., Jeppsson, B., Adlerberth, I., Wold, A.E. and Molin, G. (1998) The normal Lactobacillus flora of healthy human rectal and oral mucosa. J Appl Microbiol 85, 8894.
  • Antikainen, J., Kupannen, V., Lähteenmäki, K. and Korhonen, T.K. (2007) pH-Dependent association of enolase and glyceraldehydes-3-phosphate dehydrogenase of Lactobacillus crispatus with the cell wall and lipoteichoic acids. J Bacteriol 189, 45394543.
  • Boekhorst, J., Wels, M., Kleerebezem, M. and Siezen, R.J. (2006) The predicted secretome of Lacatobacillus plantarum WCFS1 sheds light on interactions with its environment. Microbiology 152, 31753183.
  • Cintas, L.M., Casaus, P., Herranz, C., Havarstein, L.S., Holo, H., Herna’ndes, P.E. and Nes, I.F. (2000) Biochemical and genetic evidence that Enterococcus faecium L50 produces enterocins L50A and L50B, the sec-dependent Enterocin P, and a novel bacteriocin secreted without an N-terminal extension termed Enterocin Q. J Bacteriol 182, 68066814.
  • Cleveland, D.W., Fischer, S.G., Kirschner, M.W. and Laemmli, U.K. (1977) Peptide mapping by limited proteolysis in sodium dodecyl sulfate and analysis by gel electrophoresis. J Biol Chem 252, 11021106.
  • D’Costa, S.S. and Boyle, M.D. (2000) Interaction of group A streptococci with human plasmin(ogen) under physiological conditions. Methods 21, 165177.
  • Delgado, M.L., Gil, M.L. and Gozalbo, D. (2003) Candida albicans TDH3 gene promotes secretion of internal invertase when expressed in Saccharomyces cerevisiae as a glyceraldehyde-3-phosphate dehydrogenase-invertase fusion protein. Yeast 20, 713722.
  • Dubois, M., Gilles, K.A., Hamilton, J.K., Rebers, P.A. and Smith, F. (1956) Colorimetric method for determination of sugars and related substances. Anal Chem 28, 350356.
  • Dunne, C., Murphy, L., Flynn, S., O’Mahony, L., O’Halloran, S., Feeney, M., Morrissey, D., Thornton, G. et al. (1999) Probiotics: from myth to reality. Demonstration of functionality in animal models of disease and in human clinical trials. Antonie Van Leeuwenhoek 76, 279292.
  • Duran-Quintana, M.C., Garcia-Garcia, P. and Garrido-Fernandez, A. (1999) Establishment of conditions for green table olive fermentation at low temperature. Int J Food Microbiol 51, 133143.
  • Edman, P. (1950) Edman degradation. Acta Chem Scand 4, 283.
  • Gozalbo, D., Gil-Navarro, I., Azorin, I., Renau-Piqueras, I., Martinez, J.P. and Gil, M.L. (1998) The cell wall-associated glyceraldehyde-3-phosphate dehydrogenase of Candida albicans is also a fibronectin and laminin binding protein. Infect Immun 66, 20522059.
  • Heilig, H.G.H.J., Zoetendal, E.G., Vaughan, E.E., Marteau, P., Akkermans, A.D.L. and De Vos, W.M. (2002) Molecular diversity of Lactobacillus spp. and other lactic acid bacteria in the human intestine as determined by specific amplification of 16S ribosomal DNA. Appl Environ Microbiol 68, 114123.
  • Hurmalainen, V., Edelman, S., Antikainen, J., Baumann, M., Lähteenmäki, K. and Korhonen, T. K. (2007) Extracellular proteins of Lacobacillus crispatus enhance activation of human plasminogen. Microbiology 153, 11121122.
  • Jin, H., Song, Y.P., Boel, G., Kochar, J. and Pancholi, V. (2005) Group A streptococcal surface GAPDH, SDH, recognizes uPAR/CD87 as its receptor on the human pharyngeal cell and mediates bacterial adherence to host cells. J Mol Biol 350, 2741.
  • Johansson, M.L., Molin, G., Jeppsson, B., Nobaek, S., Ahrné, S. and Bengmark, S. (1993) Administration of different Lactobacillus strains in fermented oatmeal soup: in vivo colonization of human intestinal mucosa and effect on the indigenous flora. Appl Environ Microbiol 59, 1520.
  • Kieleczawa, J., Dunn, J.J. and Studier, F.W. (1992) DNA sequencing by primer walking with strings of contiguous hexamers. Science 258, 17871791.
  • Kinoshita, H., Uchida, H., Kawai, Y., Kitazawa, H., Miura, K., Shiiba, K., Horii, A. and Saito, T. (2007) Quantitative evaluation of adhesion of lactobacilli isolated from human intestinal tissues to human colonic mucin using surface plasmon resonance (BIACORE assay). J Appl Microbiol 102, 116123.
  • Kleerebezem, M., Boekhorst, J., Van Kranenburg, R., Molenaar, D., Kuipers, O.P., Leer, R., Tarchini, R., Peters, S.A. et al. (2003) Complete genome sequence of Lactobacillus plantarum WCFS1. Proc Natl Acad Sci USA 100, 19901995.
  • Maeda, K., Nagata, H., Yamamoto, Y., Tanaka, M., Tanaka, J., Minamino, N. and Shizukuishi, S. (2004) Glyceraldehyde-3-phosphate dehydrogenase of Streptococcus oralis functions as a coadhesin for Porphyromonas gingivalis major fimbriae. Infect Immun 72, 13411348.
  • Maré, L., Wolfaardt, G.M. and Dicks, L.M.T. (2006) Adhesion of Lactobacillus plantarum 423 and Lactobacillus salivarius 241 to the intestinal tract of piglets, as recorded with fluorescent in situ hybridization (FISH), and production of plantaricin 423 by cells colonized to the ileum. J Appl Microbiol 100, 838845.
  • Modun, B. and Williams, P. (1999) The staphylococcal transferrin-binding protein is a cell wall glyceraldehyde-3-phosophate dehydrogenase. Infect Immun 67, 10861092.
  • Ouadghiri, M., Amar, M., Vancanneyt, M. and Swings, J. (2005) Biodiversity of lactic acid bacteria in Moroccan soft white cheese (Jben). FEMS Microbiol Lett 251, 267271.
  • Pancholi, V. and Fischetti, V. (1992) A major surface protein on group A streptococci is a glyceraldehyde-3-phosphate-desydrogenase with multiple binding activity. J Exp Med 176, 415426.
  • Podolsky, D.K. (1985) Oligosaccharide structures of isolated human colonic mucin species. J Biol Chem 260, 1551015515.
  • Roos, S., Aleljung, P., Robert, N., Lee, B., Wadström, T., Lindberg, M. and Jonsson, H. (1996) A collagen binding protein from Lactobacillus reuteri is part of an ABC transporter system? FEMS Microbiol Lett 144, 3338.
  • Seifert, K.N., McArthur, W.P., Bleiweis, A.S. and Brady, L.J. (2003) Characterization of group B streptococcal glyceraldehyde-3-phosphate dehydrogenase: surface localization, enzymatic activity, and protein-protein interactions. Can J Microbiol 49, 350356.
  • Sillanpää, J., Martinez, B., Antikainen, J., Toba, T., Kalkkinen, N., Tankka, S., Lounatmaa, K., Keränen, J. et al. (2000) Characterization of the collagen-binding S-layer protein CbsA of Lactobacillus crispatus. J Bacteriol 182, 64406450.
  • Sojar, H.T. and Genco, R.J. (2005) Identification of glyceraldehyde-3-phosphate dehydrogenase of epithelial cells as a second molecule that binds to Porphyromonas gingivalis fimbriae. FEMS Immunol Med Microbiol 45, 2530.
  • Song, Y.L., Kato, N., Matsumiya, Y., Liu, C.X., Kato, H. and Watanabe, K. (1999) Identification of and hydrogen peroxide production by fecal and vaginal lactobacilli isolated from Japanese woman and newborn infants. J Clin Microbiol 37, 30623064.
  • Tallon, R., Arias, S., Bressollier, P. and Urdaci, M.C. (2007) Strain- and matrix-dependent adhesion of Lactobacillus plantarum is mediated by proteinaceous bacterial compounds. J Appl Microbiol 102, 442451.
  • Uchida, H., Fujitani, K., Kawai, Y., Kitazawa, H., Horii, A., Shiiba, K., Saito, K. and Saito, T. (2004) A new assay using surface plasmon resonance (SPR) to determine binding of the Lactobacillus acidophilus group to human colonic mucin. Biosci Biotechnol Biochem 68, 17.
  • Uchida, H., Kawai, Y., Kinoshita, H., Kitazawa, H., Miura, K., Shiiba, K., Horii, A., Kimura, K. et al. (2006) Lactic acid bacteria (LAB) bind to human B- or H-antigens expressed on intestinal mucosa. Biosci Biotechnol Biochem 70, 30733076.
  • Winram, S.B. and Lottenberg, R. (1996) The plasmin-binding protein Plr of group A streptococci is identified as glyceraldehyde-3-phosphate dehydrogenase. Microbiology 142, 23112320.