SEARCH

SEARCH BY CITATION

Keywords:

  • Clostridium botulinum;
  • detection method;
  • foods;
  • LAMP

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Aims:  To develop a convenient and rapid detection method for toxigenic Clostridium botulinum types A and B using a loop-mediated isothermal amplification (LAMP) method.

Methods and results:  The LAMP primer sets for the type A or B botulinum neurotoxin gene, BoNT/A or BoNT/B, were designed. To determine the specificity of the LAMP assay, a total of 14 C. botulinum strains and 17 other Clostridium strains were tested. The assays for the BoNT/A or BoNT/B gene detected only type A or B C. botulinum strains, respectively, but not other types of C. botulinum or strains of other Clostridium species. Using purified chromosomal DNA, the sensitivity of LAMP for the BoNT/A or BoNT/B gene was 1 pg or 10 pg of DNA per assay, respectively. The assay times needed to detect 1 ng of DNA were only 23 and 22 min for types A and B, respectively. In food samples, the detection limit per reaction was one cell for type A and 10 cells for type B.

Conclusions:  The LAMP is a sensitive, specific and rapid detection method for C. botulinum types A and B.

Significance and Impact of the Study:  The LAMP assay would be useful for detection of C. botulinum in environmental samples.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Several outbreaks and sporadic cases of botulism have been reported recently (Kobayashi et al. 2003; Centers for Disease Control and Prevention (CDC) 2006, 2007a,b;Gottlieb et al. 2007). In addition, botulinum neurotoxin (BoNT) is considered a high-risk threat for bioterrorism owing to its extreme potency and lethality, ease of production and transport and need for prolonged intensive care.

Botulism intoxication is caused by Clostridium botulinum, which is a gram-positive spore-forming bacterium that produces one of the seven types of BoNT, A to G (Allen et al. 2003). Types A, B and E are most commonly associated with illness in humans. BoNT are composed of heavy and light chains: the heavy chain has a domain that binds to the neuronal cell membrane, while the protease-activated light chain is correlated with inhibition of acetylcholine release from the synaptic vesicles at neuromuscular junctions (Lalli et al. 2003). Consequently, neurotransmission fails and clinical symptoms of botulism become serious neurological disorders, such as flaccid paralysis and respiratory failure (Sobel 2005).

Currently, the mouse bioassay is the accepted method used for detection of BoNT because of its sensitivity and specificity (Karner and Allerberger 2006). However, this assay has some disadvantages, including costs, time and animal rights issues. Polymerase chain reaction (PCR)-based detection methods targeting the BoNT genes have also been developed (Szabo et al. 1993; Lindström et al. 2001). However, they require 1–2 h longer reaction time or much longer cultivation time ranging from one to several days and the end products must be evaluated by electrophoresis (Lindström and Korkeala 2006). Although real-time PCR methods have also been reported as methods without gel electrophoresis (Yoon et al. 2005; Fenicia et al. 2007; Raphael and Andreadis 2007), they require sophisticated equipment for the assay.

Recently, loop-mediated isothermal amplification (LAMP) has been reported as a rapid and sensitive detection method and applied to detect various bacterial species (Ohtsuka et al. 2005; Minami et al. 2006). This method is based on the principle of strand-displacing DNA synthesis performed by the Bst DNA polymerase large fragment and isothermal conditions at low temperature (60–65°C), thereby obviating the need for sophisticated equipment, such as a thermal cycler (Notomi et al. 2000). The technique is highly specific for the target sequence, which is attributable to recognition of the target sequence at six independent sites with four primers. Moreover, the LAMP method generates an increase in turbidity in positive samples allowing visual detection and by real-time monitoring based on the turbidity of the reaction mixture without performing agarose gel electrophoresis (Mori et al. 2001).

In this study, we designed primer sets specific for the BoNT/A and BoNT/B genes and developed a LAMP assay to detect C. botulinum type A and B strains. The specificity and sensitivity of LAMP and the detection limit in food samples were examined.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Strains and culture

Fourteen C. botulinum strains and 17 non-C. botulinum strains were used in this study (Table 1). All clostridial strains were grown on modified Gifu anaerobic medium (GAM) agar (Nissui, Tokyo, Japan) plates for 1 or 2 days at 37°C. The plates were placed in a tightly sealed container with AnaeroPack (Mitsubishi Gas Chemical, Tokyo, Japan).

Table 1. Clostridium strains tested and loop-mediated isothermal amplification (LAMP) results
SpeciesStrainToxin typeSourceLAMP result (min)*
Type AType B
  1. *DNA amplification (+) or no DNA amplification (–) when 1 ng of template was applied. The times for a positive result are shown in minutes.

  2. †Department of Bacteriology, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama, Japan.

  3. ‡Department of Microbiology, Gifu University Graduate School of Medicine, Gifu, Japan.

  4. §RIKEN BioResource Center, Japan Collection of Microorganisms, Saitama, Japan.

Clostridium botulinumNIH AAOkayama†23
GTC1788AGifu‡20
NIH BB (group I)Okayama22
GTC1789B (group I)Gifu22
Lamanna BB (group I)Okayama20
GTC1790CGifu
1873DOkayama
GTC1792EGifu
GTC1793FGifu
Denmark FFOkayama
Lamanna FFOkayama
760FOkayama
2740GOkayama
GTC0157UnknownGifu
Clostridium baratiJCM1382 RIKENBRC§
JCM1385T RIKENBRC
JCM1409 RIKENBRC
Clostridium butyricumJCM1391T RIKENBRC
JCM7835 RIKENBRC
Clostridium difficileC.I. Okayama
JCM1296T RIKENBRC
Clostridium novyiJCM1406T RIKENBRC
Clostridium perfringensJCM1290T RIKENBRC
JCM3816 RIKENBRC
Clostridium sporogenesJCM1410 RIKENBRC
JCM1416T RIKENBRC
JCM7850 RIKENBRC
JCM11011 RIKENBRC
Clostridium subterminaleJCM1417T RIKENBRC
Clostridium tetaniKZ1113 Okayama
Sapporo Okayama

DNA preparation

Colonies from GAM agar plates were collected and suspended in 3 ml of distilled water on ice. Aliquots of 3 ml of colony suspension fluid were centrifuged at 5000 g for 10 min. DNA isolation was perofmred using a QIAampDNA minikit (Qiagen, Hilden, Germany). We followed the protocol for Gram-positive bacteria, which was provided by the manufacturer. Briefly, the bacterial pellets were resuspended in 180 μl of enzyme solution (20 mg ml−1 lysozyme, 20 mmol Tris-HCl, pH 8, 2 mmol EDTA, 1·2% TritonX-100 and 0·2% sodium dodecyl sulfate or SDS), incubated at 37°C for 30 min and digested with 20 μl of proteinase K (20 mg ml−1; Qiagen) for 30 min at 56°C with shaking in a water bath. The cells were then treated with 4 μl of RNaseA (100 mg ml−1; Qiagen). After incubation at room temperature for 2 min, DNA was extracted using a QIAampDNA minikit according to the instructions provided by the manufacturer. The final concentration of the DNA was determined using a DU800 spectrophotometer (Beckman Coulter, Fullerton, CA, USA).

BoNT gene cloning

The BoNT gene fragment encoding the light chain of C. botulinum was amplified by PCR using DNA from strains NIH A and NIH B with primers 5′-ATGCCCTTTGTTAATAAAC-3′ and 5′-CTTATTGTATCCTTCATCTAATG-3′ for type A and 5′-TTATGGGCATTAAAAGGG-3′ and 5′-AGGATCTGATATGCAAAC-3′ for type B. These PCR fragments were inserted into the pCR4 vector (Invitrogen, Carlsbad, CA, USA) and several clones were sequenced using ABI Big Dye Terminator v3·1 with an ABI 3130 genetic analyser. Type A and type B genes that exactly matched the sequence, GenBank accession nos AY166872 and M81186, respectively, were used in this study. The concentration of the plasmid DNA was determined by OD at 260 nm and the genome copy numbers were calculated.

LAMP primers

Primers were designed based on regions of high sequence similarity. GenBank accession nos AF461540, AF488749, AY166872, AY953275, D67030, DQ185900, DQ185901, DQ310546, DQ409059, EF028391, EF028392, EF028393, EF033126, EF470981, EF470982, EF506572, EF506573, M27892, X52066, X73423, X87848 and Y14238, including subtypes A1, A2, A3 and A4, were aligned for type A. GenBank accession nos M81186, AB232927, Y13630, AF300466, AF295926, AF300469, AF300468, AF300467, AB084152, EF028394, EF028402, EF051570, X71343, X87849, AJ242628, X70817, Y14239, X70814, X70819, X71343 and Z11934, including groups I and II, were aligned for type B. PrimerExplorer (http://primerexplorer.jp/e/) was used for primer design based on the sequences of AY166872 and M81186 for types A and B, respectively. Sets of primers comprising two outer (F3 and B3) and two inner primers (FIP and BIP) were designed (Table 2). The inner primer FIP contained the sequence complementary to F1 (F1c), a TTTT spacer and F2. The inner primer BIP contained the sequence complementary to B1 (B1c), a TTTT spacer and B2. To increase the number of starting points for DNA synthesis, complementary loop primers were also designed based on the sequence between F1c and F2 (LF) and B1c and B2 (LB) as shown in Fig. 1. In order to check if the BoNT gene was amplified by LAMP primers, plasmid DNA was amplified by PCR with F3 and B3 primers (Table 2). The initial PCR mixture contained 1× reaction buffer, 0·2 mmol dNTP, 0·1 μmol of each primer, 0·26 U of KOD Dash DNA polymerase (Toyobo, Osaka, Japan) and 1 ng of template DNA in a 30 μl total reaction volume. Template DNA was denatured by heating at 94°C for 4 min, followed by 30 cycles of denaturation at 94°C for 30 s, annealing at 50°C for 5 s and extension at 72°C for 15 s. Amplified PCR products were analysed by electrophoresis on a 2·5% agarose gel, stained with ethidium bromide and visualized under ultraviolet (UV) light (LAS-3000; FujiFilm, Tokyo, Japan).

Table 2.   Primers for Clostridium botulinum types A and B
Primer nameSequences (5′–3′)
Type A
 bontA/F3TCAATACATTAGATTTAGCCCA
 bontA/B3CCCAAATGTTCTAAGTTCCT
 bontA/FIPGTAGCAAATTTGCCTGCACCTAAAATTTTCATTTGGTTTTGAGGAGTCA
 bontA/BIPAGCACATGAACTTATACATGCTGGATTTTGCTTACTTCTAACCCACTCA
 bontA/LFGAGGATTTGTATCAACTTCAA
 bontA/LB GCAATTAATCCAAATAGGGTTTT
Type B
 bontB/F3GCCAGTTTTAAATGAAAATGAGAC
 bontB/B3CTACTTTAATGCCATATAATCCATG
 bontB/FIPCGCTTACATATTCTGGTTTTAATCATTTTGCATCAAGGGA
 bontB/BIPTGTTCAAGAAAACAAAGGCGCAATTTTTAAGTTCATGCATTAATATCAAGGC
 bontB/LFGCATTATACCCCCGAAGCCT
 bontB/LBGTATATTTAATAGACGTGGATAT
image

Figure 1.  Loop-mediated isothermal amplification primer design for Clostridium botulinum neurotoxin type A and B genes. The numbers correspond to nucleotide sequence of GenBank accession nos AY166872 and M81186 for types A and B, respectively. The arrows indicate the location of priming sites for each primer.

Download figure to PowerPoint

LAMP

LAMP was performed using a Loopamp DNA Amplification Kit (Eiken Chemical, Tokyo, Japan), which requires 2× reaction mix containing 40 mmol of Tris-HCl (pH 8·8), 20 mmol of KCl, 16 mmol of MgSO4, 20 mnol of (NH4)2SO4, 0·2% Tween 20, 1·6 mol betaine and 2·8 mmol of each dNTP. The reactions were performed in a total volume of 25 μl with 1·6 μmol of FIP and BIP, 0·2 μmol of F3 and B3, 0·8 μmol of LF and LB, 2× reaction mix, Bst DNA polymerase and bacterial template DNA or plasmid DNA. Amplification was performed in 0·2-ml microtubes using a Loopamp Realtime Turbidimeter (LA-200; Teramecs, Kyoto, Japan) at a constant temperature of 63°C for 60 min. A turbidity measurement of >0·1 was determined as the cut-off for a positive result. DNA samples from all the clostridial strains listed in Table 1 and plasmid DNA were quantified and serially diluted in distilled water and then subjected to LAMP assay.

Spore preparation

Clostridium botulinum type A spores were prepared by growing NIH A strain on GAM agar plates at 30°C anaerobically for 7 days, followed by incubation at the same temperature aerobically for 2 days. NIH B strain was used for C. botulinum type B spore preparation. Incubation was performed at 37°C anaerobically for 7 days, followed by incubation at room temperature aerobically until vegetative cells disappeared and the dominance of spores was observed (Kasai et al. 2007). The spores were collected in ice-cold distilled water. They were centrifuged at 2187 g for 5 min and washed with 5 ml of ice-cold distilled water. Spore pellets were washed thrice, and then checked by microscopy (Zeiss Axioskop, Oberkochen, Germany) to confirm 100% spores. Type A and B spores were stored at –20° or 4°C before use.

DNA preparation from food samples inoculated with Clostridium botulinum

In order to test the LAMP applicability in food samples, 1 g of canned fish or honey were inoculated with 1 ml suspensions of 10-fold dilutions containing 1 × 104 to 1 × 108 spores or vegetative cells (NIH A and NIH B strains) to yield final concentrations of 1 to 1 × 104 CFU per assay. Samples were then mixed with 9 ml of ice-cold distilled water. CFU were confirmed by counting colonies on GAM agar plates before DNA was extracted. For the boiling DNA extraction method, 1 ml of each sample was boiled at 95°C for 20 min and aliquots of 1 μl of the suspensions were used for the assay. For the bead-beater DNA extraction method (Lövenklev et al. 2004), 1 ml of the suspension was frozen in liquid nitrogen for a few seconds with 0·5 g of 0·1 mm zirconia silica beads (Biospec Products, Bartlesville, OK, USA) and treated in a minibead beater (Biospec Products) at 4200 rev min−1 for 2 min. Aliquots of 1 μl of the suspensions were used for the assay.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Evaluation of LAMP using plasmid DNA

Sets of primers for the BoNT/A and BoNT/B genes listed in Table 2 were designed corresponding to the region of the BoNT light chain (Fig. 1). PCR was performed in order to confirm if the LAMP primers amplified the target region of C. botulinum. The BoNT/A and BoNT/B PCR products were observed at 250 and 240 bp, respectively on 2·5% agarose gel. This indicated that both the BoNT genes encoding the light chain of neurotoxin were amplified by LAMP primers F3 and B3. The sensitivity of the LAMP assay for BoNT/A and BoNT/B genes was determined by testing 10-fold serial dilutions of plasmid DNA ranging from 1 to 106 genome copy numbers. Figure 2 shows that there is a linear relationship between the log of the genome copy number and the time of positivity.

image

Figure 2.  The relation between the threshold times (Tt; turbidity of 0·1) and log of the template genome copy number. A linear function of r2 = 0·93 and 0·95 are indicated for types A and B, respectively.

Download figure to PowerPoint

LAMP specificity and sensitivity

To examine the specificity of the assay, 31 different clostridial strains were examined using LAMP with each primer set as listed in Table 1. The times of positivity were observed through real-time monitoring by spectrophotometric analysis using a real-time turbidimeter. The results of the LAMP assay using 1 ng of bacterial DNA are shown in Table 1. LAMP assays for BoNT/A and BoNT/B genes successfully detected only type A and type B strains, respectively, within 23 min, showing that these LAMP assays are both very rapid and highly specific for C. botulinum type A and B strains, respectively.

The sensitivity of the LAMP assay for BoNT/A and BoNT/B genes was determined by testing 10-fold serial dilutions of bacterial DNA ranging from 10 pg to 1 ng. NIH/A strain for type A and NIH/B strain for type B were used to determine the sensitivity. LAMP for BoNT/A could detect more than 1 pg of bacterial DNA from type A NIH A strain, while the assay for BoNT/B was successful for more than 10 pg of bacterial DNA from type B NIH B strain (Table 3). For both BoNT/A and BoNT/B, positive results were obtained within 30 min when the amount of DNA was more than 10 pg.

Table 3.   Sensitivity of loop-mediated isothermal amplification (LAMP) with bacterial DNA
 Time needed for DNA amplification* (min)
1 ng100 pg10 pg1 pg100 fg10 pgNC†
  1. *Times are shown as the averages of triplicate samples.

  2. †Negative control: distilled water was added to the tube instead of DNA solution.

  3. ‡NIH A and B strains were used in this assay as types A and B, respectively.

  4. §No DNA amplification was observed within 60 min.

Type A‡23252833–§
Type B‡222530

Detection of Clostridium botulinum types A and B in foods

Worldwide, more than 85% of food-borne botulism cases in humans are because of types A and B. As the LAMP assays for BoNT/A and BoNT/B genes were shown to be specific and sensitive for the detection of C. botulinum type A and B strains, we next examined the usefulness of the assays for detection of these strains in foods. For this purpose, we first evaluated the LAMP assays in boiled samples of canned fish and honey inoculated with spores or vegetative cells of NIH A or NIH B strain. Table 4 shows that LAMP could detect 10 CFU of type A and 102 CFU for type B strains heated at 95°C. Because the boiling method could not apply for spore detection, we next evaluated the LAMP assay using the bead-beater DNA extraction method. As shown in Table 5, the LAMP for BoNT/A gene could detect 1 CFU of vegetative cells and 10 CFU of spores in both fish and honey samples. For detection of 104 CFU spores, the time required for a positive reaction was only 22 min in fish and 24 min in honey. For vegetative cells, the assay needed 21 min to detect 104 cells in fish and 21 min in honey samples. For type B, the detection limit was 10 CFU for vegetative cells and 103 CFU for spores in both fish and honey samples. The detection time for 104 CFU of vegetative cells was only 24 min in fish and 23 min in honey. Negative controls without inoculation of spores or vegetative cells never showed any positive results for all the reactions tested.

Table 4.   Detection limit of boiled samples
BoNT typeSample materialTime of positivity* (min)
CFU per assay
104103102101100NC†
  1. *Times are shown as the averages of triplicate samples.

  2. †Negative control: distilled water was added to the tube instead of DNA solution.

  3. ‡No DNA amplification was observed within 60 min.

  4. BoNT, botulinum neurotoxin.

AVegetative cell in water22242937–‡
Vegetative cell in fish2830363947
Vegetative cell in honey28313944
BVegetative cell in water232744
Vegetative cell in fish232944
Vegetative cell in honey252844
Table 5.   Detection limit in food samples
BoNT typeSample materialTime of positivity* (min)
Vegetative cells (CFU per assay)Spores (CFU per assay)
104103102101100NC†104103102101100NC
  1. *Times are shown as the averages of triplicate samples.

  2. †Negative control: distilled water was added to the tube instead of DNA solution.

  3. ‡No DNA amplification was observed within 60 min.

  4. BoNT, botulinum neurotoxin.

AFish2123252735–‡22252930
Honey212329373724273333
BFish242733333336
Honey233538413135

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

In this study, we developed LAMP assays for the BoNT/A and BoNT/B genes to detect C. botulinum type A and B strains. These assays for BoNT/A and BoNT/B genes could specifically detect type A or B C. botulinum strains, respectively, but not other types of C. botulinum or strains of other Clostridium species (Table 1). Thus, the LAMP assays for BoNT/A and BoNT/B were highly specific for the detection of C. botulinum types A and B, respectively. Although we used only group I strains for type B in this study, the target regions for LAMP amplification are highly conserved among group I and II strains (Hill et al. 2007). In addition, as the sequences recognized by each set of primers have been also highly conserved among type A and B strains, respectively (data from 22 strains of type A including subtypes A1, A2, A3 and A4 and 21 strains of type B including groups I and II as described in ‘Materials and methods’), these LAMP assays would also be useful for the detection of many other strains of type A or B.

The detection limit of LAMP for type A was less than 1 pg of C. botulinum type A DNA (Table 3). This sensitivity is almost equivalent to the PCR-based method for the BoNT/A gene reported previously by Szabo et al. (1993). Our LAMP method has the advantages of being both fast and extremely simple in comparison with the PCR-based method. Although real-time PCR-based methods have also been reported as methods without gel electrophoresis (Yoon et al. 2005; Fenicia et al. 2007; Raphael and Andreadis 2007), LAMP has still the great advantage. When we tested real-time PCR (Raphael and Andreadis 2007), 1 and 10 ng of DNA samples were detected at 30 cycles (about 37 min) and 26 cycles (about 31 min), respectively, but 100 pg of the sample showed negative results as well as negative controls. Some PCR-based methods that require an enrichment step to obtain better sensitivity have also been reported for types A and B (Dahlenborg et al. 2001; Lindström et al. 2001). However, LAMP is more sensitive than these methods, as the sensitivity of LAMP with crude cell lysates, which was heated at 95°C for 20 min was 10 cells per reaction for type A and 102 cells per reaction for type B (Table 4).

The detection limit of LAMP was also evaluated in food samples. Several studies have indicated that most isolates from honey samples are types A and B (Rall et al. 2003; Nevas et al. 2006), and several environmental samples, including those from a cattle farm (Notermans et al. 1981), faecal samples from slaughtered pigs (Dahlenborg et al. 2001) and intestinal samples from pigs (Myllykoski et al. 2006), showed high prevalence rate for type B. Recent data also showed that the major isolates from fish and environmental samples were type B (70%) followed by type A (22·5%) (Fach et al. 2002). Therefore, in this study, we used honey and canned fish to evaluate the LAMP assays for types A and B. Crude suspensions of foods containing vegetative cells or spores of C. botulinum, which were treated with microbeads, were used as templates for LAMP assays. For vegetative cells of type A, the detection limits of LAMP assays were only 1 CFU in both fish and honey samples, while those for type B were 10 CFU in both the samples (Table 4). It has been reported that the existence of a high concentration of micro-organisms has inhibitory effects on PCR (Dahlenborg et al. 2001) and derivatives from food samples have been suggested to inhibit real-time PCR (Yoon et al. 2005). In the LAMP assay, however, these inhibitory effects were not observed in either honey or fish samples when vegetative cells were applied for reactions, as the detection limits of LAMP in food samples artificially inoculated with vegetative cells was the same as those without food materials (Table 4). For spore detection, the guanidine isothiocyanate method and heat alkaline method have been reported for extraction of DNA from spores (Szabo et al. 1993; Yoon et al. 2005). In the present study, the spores were physically broken using a bead beater, and the assay using these crude lysates could successfully detect at least 10 or 103 spores for types A and B, respectively (Table 5). On the other hand, for detection of C. botulinum in a large amount of food samples (>1 kg), enrichment procedures such as long-time cultivation before DNA preparation or DNA preparation methods to concentrate bacterial DNA may be required, as the spore concentrations in original food samples, which can be detected by this method, are calculated as 104–10CFU g−1.

In conclusion, the assay system developed in this study, which consists of DNA extraction by microbeads and detection by LAMP assay, is very simple and highly specific and sensitive for the detection of strains of C. botulinum types A and B. In addition, the assay is very rapid allowing the detection of 1 ng of DNA within only 23 min. Taken together, these results of the present study indicate that our LAMP assay would be useful for detection of C. botulinum in environmental samples.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

This work was supported by a grant from the Japan Science and Technology Agency, Japan. The authors thank Jeremiah Morrison for editing the manuscript, Dr Keiji Oguma for providing the Clostridium strains used in this study and Aiko Fukuma for technical assistance.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  • Allen, S.D., Emery, C.L. and Lyerly, D.M. (2003) Anaerobic bacteria, Clostridium. In Manual of Clinical Microbiology, 8th edn ed. Murray, P.R., Baron, E.J., Pfaller, M.A., Jorgensen, J.H. and Yolken, R.H. pp. 835856 Washington, DC: ASM Press.
  • Centers for Disease Control and Prevention (CDC) (2006) Botulism associated with commercial carrot juice – Georgia and Florida, September 2006. MMWR Morb Mortal Wkly Rep 55, 10981099.
  • Centers for Disease Control and Prevention (CDC). (2007a) Brief report: foodborne botulism from home-prepared fermented tofu – California, 2006. MMWR Morb Mortal Wkly Rep 56, 9697.
  • Centers for Disease Control and Prevention (CDC) (2007b) Botulism associated with commercially canned chili sauce – Texas and Indiana, July 2007. MMWR Morb Mortal Wkly Rep 56, 767769.
  • Dahlenborg, M., Borch, E. and Rådström, P. (2001) Development of a combined selection and enrichment PCR procedure for Clostridium botulinum types B, E, and F and its use to determine prevalence in fecal samples from slaughtered pigs. Appl Environ Microbiol 67, 47814788.
  • Fach, P., Perelle, S., Dilasser, F., Grout, J., Dargaignaratz, C., Botella, L., Gourreau, J.-M., Carlin, F. et al. (2002) Detection by PCR-enzyme-linked immunosorbent assay of Clostridium botulinum in fish and environmental samples from a coastal area in Northern France. Appl Environ Microbiol 68, 58705876.
  • Fenicia, L., Anniballi, F., De Medici, D., Delibato, E. and Aureli, P. (2007) SYBR green real-time PCR method to detect Clostridium botulinum type A. Appl Environ Microbiol 73, 28912896.
  • Gottlieb, S.L., Kretsinger, K., Tarkhashvili, N., Chakvetadze, N., Chokheli, M., Chubinidze, M., Michael Hoekstra, R., Jhorjholiani, E. et al. (2007) Long-term outcomes of 217 botulism cases in the Republic of Georgia. Clin Infect Dis 45, 174180.
  • Hill, K.K., Smith, T.J., Helma, C.H., Ticknor, L.O., Foley, B.T., Svensson, R.T., Brown, J.L., Johnson, E.A. et al. (2007) Genetic diversity among botulinum neurotoxin-producing clostridial strains. J Bacteriol 189, 818832.
  • Karner, J. and Allerberger, F. (2006) Detecting Clostridium botulinum. Emerg Infect Dis 12, 1292.
  • Kasai, Y., Kimura, B., Tajima, Y. and Fujii, T. (2007) Quantitative duplex PCR of Clostridium botulinum types A and B neurotoxin genes. J Food Hyg Soc Jpn 48, 1926.
  • Kobayashi, H., Fujisawa, K., Saito, Y., Kamijo, M., Oshima, S., Kubo, M., Eto, Y., Monma, C. et al. (2003) A botulism case of a 12-year old-girl caused by intestinal colonization of Clostridium botulinum Type Ab. Jpn J Infect Dis 56, 7374.
  • Lalli, G., Bohnert, S., Deinhardt, K., Verastegui, C. and Schiavo, G. (2003) The journey of tetanus and botulinum neurotoxin in neurons. Trends Microbiol 11, 431437.
  • Lindström, M. and Korkeala, H. (2006) Laboratory diagnostics of botulism. Clin Microbiol Rev 19, 298314.
  • Lindström, M., Keto, R., Markkula, A., Nevas, M., Hielm, S. and Korkeala, H. (2001) Multiplex PCR assay for detection and identification of Clostridium botulinum types A, B, E, and F in food and fecal material. Appl Environ Microbiol 67, 56945699.
  • Lövenklev, M., Holst, E., Borch, E. and Rådström, P. (2004) Relative neurotoxin gene expression in Clostridium botulinum type B, determined using quantitative reverse transcription-PCR. Appl Environ Microbiol 70, 29192927.
  • Minami, M., Ohta, M., Ohkura, T., Ando, T., Torii, K., Hasegawa, T. and Goto, H. (2006) Use of a combination of brushing technique and the loop-mediated isothermal amplification method as a novel rapid, and safe system for detection of Helicobacter pylori. J Clin Microbiol 44, 40324037.
  • Mori, Y., Nagamine, K., Tomita, N. and Notomi, T. (2001) Detection of loop-mediated isothermal amplification reaction by turbidity derived from magnesium pyrophosphate formation. Biochem Biophys Res Commun 289, 150154.
  • Myllykoski, J., Nevas, M., Lindström, M. and Korkeala, H. (2006) The detection and prevalence of Clostridium botulinum in pig intestinal samples. Int J Food Microbiol 110, 172177.
  • Nevas, M., Lindström, M., Hörman, A., Keto-Timonen, R. and Korkeala, H. (2006) Contamination routes of Clostridium botulinum in the honey production environment. Environ Microbiol 8, 10851094.
  • Notermans, S., Dufrenne, J. and Oosterom, J. (1981) Persistence of Clostridium botulinum type B on a cattle farm after an outbreak of botulism. Appl Environ Microbiol 41, 179183.
  • Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N. and Hase, T. (2000) Loop-mediated isothermal amplification of DNA. Nucleic Acids Res 28, E63.
  • Ohtsuka, K., Yanagawa, K., Takatori, K. and Hara-Kudo, Y. (2005) Detection of Salmonella enterica in naturally contaminated liquid eggs by loop-mediated isothermal amplification, and characterization of Salmonella isolates. Appl Environ Microbiol 71, 67306735.
  • Rall, V.L.M., Bombo, A.J., Lopes, T.F., Carvalho, L.R. and Silva, M.G. (2003) Honey consumption in the state of São Paulo: a risk to human health? Anaerobe 9, 299303.
  • Raphael, B.H. and Andreadis, J.D. (2007) Real-time PCR detection of the nontoxic nonhemagglutinin gene as a rapid screening method for bacterial isolates harboring the botulinum neurotoxin (A–G) gene complex. J Microbiol Methods 71, 343346.
  • Sobel, J. (2005) Botulism. Clin Infect Dis 41, 11671173.
  • Szabo, E.A., Pemberton, J.M. and Desmarchelier, P.M. (1993) Detection of the genes encoding botulinum neurotoxin types A to E by the polymerase chain reaction. Appl Environ Microbiol 59, 30113020.
  • Yoon, S.-O., Chung, G.T., Kang, D.-H., Ryu, C., Yoo, C.-K. and Seong, W.-K. (2005) Application of real-time PCR for quantitative detection of Clostridium botulinum type A toxin gene in food. Microbiol Immunol 49, 505511.