SEARCH

SEARCH BY CITATION

Keywords:

  • anthrax;
  • Bacillus;
  • bioluminescence;
  • detection;
  • reporter phage

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Aims: Bacillus anthracis, the causative agent of anthrax, is a serious human pathogen. The aim of this study was to provide the proof of principle results for the development of a ‘bioluminescent’ reporter bacteriophage that was capable of specifically detecting B. anthracis.

Methods and Results:  The reporter phage was engineered by integrating the bacterial luxA and luxB reporter genes into a nonessential region of the lysogenic Wβ phage genome. This resulted in a phage that was capable of specifically infecting and conferring a bioluminescent phenotype to B. anthracis viable cells. No processing or cell preparation was required; the phage and cells were simply mixed, and the samples were analysed for bioluminescence. A bioluminescent signal was evident after 16 min postinfection of vegetative cells. The strength and time required to generate the signal was dependent on the number of cells present. Nevertheless, 103 CFU ml−1 was detectable within 60 min. The utility of the bioluminescent phage was analysed using spores as the starting material. The Wβ::luxAB phage was able to transduce a bioluminescent signal to germinating spores within 60 min.

Conclusions:  This proof of principle study demonstrates that the reporter phage displays promise as a tool for the rapid detection of B. anthracis.

Significance and Impact of the Study:  The new methodology offers the potential for the detection of viable cells from either environmental or clinical samples.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Bacillus anthracis is an aerobic, gram-positive, spore-forming bacterial pathogen that causes anthrax in animals and humans. Owing to the potential ease of weaponizing the infectious spore and the severity of the disease, B. anthracis is listed by the Centers for Disease Control and Prevention (CDC) and National Institute of Health (NIH) as a Category A pathogen most likely to be used during a bioterrorist attack (Greenfield and Bronze 2003). This was particularly evident in the autumn of 2001 when B. anthracis spores were released via the US postal system that caused 7 confirmed cases of cutaneous and 11 cases of inhalation anthrax (Bartlett et al. 2002).

Bacillus anthracis spores germinate under conditions rich in amino acids and nutrients such as in blood and tissues. Once the spores have germinated, replicating bacilli release three toxin components that combine to form the lethal and oedema toxins. In addition to the toxins, the bacilli have a capsule, which prevents phago-cytosis. In combination, these virulence factors enable the bacilli to multiply and cause cell damage that can result in haemorrhage, oedema, necrosis, and septicemia, and if left untreated, organ failure and death. As the prognosis of patients exhibiting clinical symptoms of anthrax is extremely poor, there is a critical need for rapid and sensitive identification tests following an anthrax attack and/or exposure in order to quickly implement public health measures. Bacillus anthracis isolates may be identified using microbiological techniques such as the γ-phage lysis assay, and by characteristic features such as lack of β-haemolytic activity, lack of motility, penicillin sensitivity, and selection on polymyxin B, lysozyme, EDTA, thallous acetate (PLET) agar (Klee et al. 2006). These procedures generally take 24–48 h to complete in a laboratory environment. Rapid and more portable identification methodologies such as antigen detection or molecular based-assays have been developed; however, immunoassays lack sensitivity and specificity such that they require fairly high concentrations of B. anthracis and cross-reaction with closely related Bacillus species may yield false-positives. Polymerase chain reaction (PCR) assays have the advantage of being specific but generally cannot discriminate between live and dead organisms (Bell et al. 2002).

Recombinant reporter phage may provide a ‘natural’ and specific approach for the detection of B. anthracis. Reporter phage-mediated detection systems have been developed for Listeria, Salmonella, mycobacteria, and Escherichia coli O157:H7 (Sarkis et al. 1995; Loessner et al. 1996, 1997; Kuhn et al. 2002; Brigati et al. 2007; Dusthackeer et al. 2008). Owing to the availability of specific and broad strain-range B. anthracis phage, a similar approach may be feasible for the detection of B. anthracis. A temperate B. anthracis phage was identified by McCloy (1951a,b), called phage W (subsequently renamed Wβ). Wβ infected all nonencapsulated B. anthracis strains tested (171 strains), and did not infect other Bacillus species such as Bacillus megaterium, Bacillus pumilis, Bacillus firmus, Bacillus subtilis, Bacillus mycoides, Bacillus coagulans, Bacillus licheniformis, and Bacillus circulans (Brown and Cherry 1955). Although Wβ has been shown to lyse a small number of Bacillus cereus strains, the susceptible B. cereus strains are classed as ‘atypical’. Phylogenetic analysis of B. cereus and B. anthracis has demonstrated that these two species are very closely related and B. anthracis should be considered a lineage of B. cereus (Helgason et al. 2000; Hill et al. 2004; Priest et al. 2004). Comparison of B. cereus and B. anthracis at the genome level has shown that a large core set of genes are conserved between the two species (Ivanova et al. 2003); however, additional studies have identified unique chromosomal markers that distinguish B. anthracis from other closely related Bacillus species including B. cereus (Radnedge et al. 2003). Although differences exist, atypical B. cereus strains are considered to be a potential surrogate for B. anthracis strains because they share similar phenotypic characteristics such as sensitivity to phage infection (Schuch et al. 2002; Schuch and Fischetti 2006). Brown and Cherry (1955) isolated a lytic variant of Wβ, designated as γ. Both Wβ and γ were ‘specific’ to B. anthracis; however, unlike Wβ, γ was able to lyse encapsulated B. anthracis strains. In a recent study, γ phage was able to infect and lyse 49 out of 51 B. anthracis strains collected from diverse geographical locations such as Pakistan, Canada, Argentina, England, USA, and South Africa (Abshire et al. 2005). Consequently, owing to its species specificity and ability to infect a large number of strains, γ is used as a standard tool by the CDC and various public health laboratories for the identification of B. anthracis isolates (Inglesby et al. 2002).

Wβ and γ are morphologically identical: they are similar to the Siphoviridae family of tailed phages [double-stranded (ds) DNA viruses] consisting of an icosahedral head and a long contractile tail (Schuch and Fischetti 2006). The Wβ and γ genomes were recently sequenced (40 864 and 37 373 bp, respectively) and genome comparison has revealed that the γ variant most likely evolved from Wβ. The major genetic differences between Wβ and γ are: (i) a 25 bp deletion between wp25 and wp26 (in the lysogenic locus); (ii) a 2003 bp deletion in wp28 and wp29, which encodes for a C1 repressor homologue (controls lysogenic functions), and (iii) 69 point mutations in the tail fibre gene wp14. These differences have been proposed to explain the distinct lysogenic and lytic lifestyles of the phages and the inability of Wβ to infect encapsulated strains. A key difference between Wβ and γ, which is unrelated to lifestyle and host range, is that γ has also acquired a 1360 bp antibiotic (fosfomycin) resistance module.

The aim of this research was to generate a luxAB-tagged phage and demonstrate the proof of principle results that a reporter phage could be used for the detection of B. anthracis. To aid in the genetic manipulation and cloning of the recombinant phage, we utilized the lysogenic parent of γ phage, Wβ.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Bacterial strains

The B. cereus Wβ lysogen, the atypical strain, and ‘phage-resistant’ strain were obtained from the ATCC (11950, 4342, and 14579, respectively). Bacillus thuringiensis wild-type strains SLM5.A, HL51, T39 001, and Pbt 23 were obtained from the Bacillus Genetic Stock Center (BGSC identification numbers 4AG1, 4AK1, 4AY1, and 4BR1, respectively). The attenuated B. anthracis Sterne 34F2 strain was obtained from the CDC (kindly provided by Dr Elke Saile). Bacillus species were propagated in brain heart infusion (BHI) media supplemented with 100 μg ml−1 of spectinomycin (SPC) where appropriate. DNA manipulation and cloning was performed in E. coli ER2738 (New England Biolabs) supplemented with 5 μg ml−1 of chloramphenicol, 100 μg ml−1 of ampicillin or 100 μg ml−1 of SPC where appropriate. Escherichia coli/Bacillus shuttle plasmids were propagated through E. coli SCS110 (Dam Dcm; Stratagene) prior to Bacillus transformations.

Bacteriophage Wβ isolation and propagation

The Wβ lysogenic phage was isolated and induced from its prophage state as described by Schuch and Fischetti (2006). Briefly, a single colony of B. cereus ATCC11950 [containing predominantly Wβ and a rare α phage (McCloy 1951a)] was grown overnight in 2 ml of BHI broth at 37°C. After 16 h, the resulting culture was plated (35 μl) onto BHI agar plates supplemented with 20, 30, or 40 μg ml−1 of phosphomycin (disodium salt) and grown at 37°C for 17–20 h. The centre clearing zones were picked and restreaked onto BHI phosphomycin plates which, after overnight growth at 37°C produced characteristic ‘donut-shaped’ colonies (Schuch and Fischetti 2006). The center clearing zones were picked with sterile tips, pooled, mixed with SM buffer [50 mmol l–1 of Tris-HCl (pH 7·5), 0·1 mol l–1 of NaCl, 8 mmol l–1 of MgSO4·7H2O, 0·01% of gelatin], supplemented with 5 mmol l–1 of CaCl2 (SMC) and passed through a 0·22-μm pore size filter. Phages, eluted from single plaques, were successively amplified in exponentially growing B. cereus ATCC4342 cultures grown in BHI broth at 30°C. The phage stocks (106–107 PFU ml−1) were concentrated according to Carlson (2005). To ensure that the phage stocks contained Wβ and not the α phage, lysates were analysed by the agar overlay technique on the Wβ prophage strain (ATCC11950); as expected, the phage stocks were not able to superinfect this strain (McCloy 1951a; Schuch and Fischetti 2006).

Construction of a luxAB expression cassette

The Vibrio harveyi luxA and luxB genes were PCR-amplified (primers described in Table 1) using pQF110 (ATCC77113) as template. The PCR primers were designed to contain XbaI/BamHI and HindIII/XhoI, respectively, for directional cloning into the corresponding sites of pBluescript-SK (Stratagene). The luxA and luxB were sequentially cloned into pBluescript-SK (to create pluxABSK) by standard cloning methodology (Sambrook et al. 1989).

Table 1.   Polymerase chain reaction (PCR) primers and oligonucleotides used
NameOligonucleotide sequences and forward and reverse PCR primers, respectively (5′–3′)FeaturesPCR product size (bp)
  1. *Wβ numbers based on GenBank no. DQ289555.

  2. The bold sequences are indicative of the following: aagctt, HindIII; gtcgac, SalI; gaattc, EcoRI; ggatcc, BamHI; tctaga, XbaI; ctcgag, XhoI.

  3. NA, not applicable.

luxA TTTATTCTAGATAAGGAGGTAAAAAAATGAAATTTGGAAACTTCCTTCTC TTATTGGATCCTTACTGTTTTTCTTTGAGATATGGluxA PCR primers1089
luxBATACCAAGCTTAAGGAGGTAAAAAAATGAAATTTGGATTATTCTTCCTC TTATTCTCGAGTTACGAGTGGTATTTGACGATGluxB PCR primers990
TL17ATTTTTTTGGGCGGGGCCGCCCAAAAAAATGCATGCGGTACSequence of TL17 transcriptional terminatorNA
wp39GGAAAAGCTTAAGTGAGGAGAGATGGAAC AATTGTCGACTGAACCCCTTGAATCCCTTGPCR primers for the 5′ end of the recombination cassette. Wβ 33312–33686 (intergenic between wp39/wp40 through to the start of wp40)*374
wp41AATTGTCGACTGCATATCCAAGCTCCTCTC TATCGAATTCACATCCTCTTGCTTGGTGCPCR primers for the 3′ end of the recombination cassette. Wβ 35948–36331 (end of wp41 to the intergenic region of wp41/wp42)*383
Pro2CGTCGACTTTATTGACATTGTGAGCGGATATTAATATATTAACTTCGCSequence of the promoter for driving luxAB expressionNA
luxB2ATCGACCAACGGATTCTCAG ACTTCTTTGCTCGTCGCATTluxB screening primers184
SPCAATTCTCGAGAAAAATTTAGAAGCCAATGAAATC TTAACTCGAGAAATTGAAAAAAGTGTTTCCACCPCR primers for amplifying the spectinomycin resistance gene from pDG1728898
5′-INTATTAGGCGAATGCATGAAGG GCTTTGCCCAGATTAACCAAPCR primers for checking the 5′ site of integration988
3′-INTTAAACGCCAACATCGTCAAA CGCTTCTTCTCCACCTTGTTPCR primers for checking the 3′ site of integration1641
wp28GCGCTTTACAGAACACATGC CGCCAATTTTACACGCTACACPCR primers for the Wβ lysogeny module178
DELCACCCATTTGAACGAGTCCT ATAATGCTTGGAACCGCAACPCR primers designed against the β sequence, which should be replaced by the luxAB recombination event258
pHP13GCCTACATACCTCGCTCTGC GGCGCTTTCTCATAGCTCACPCR primers designed against the recombination plasmid (pHP13) backbone208

A promoter (pro2; Table 1) was cloned upstream of luxA and luxB into the SacI/NotI sites. The ‘Bacillus’ promoter was designed to contain a SalI site at the 5′-end to facilitate downstream cloning. The transcriptional terminator TL17 (Wright et al. 1992) was cloned downstream (KpnI sites) of the luxA and luxB genes. The identity of the sequences was verified by deoxy dye-terminator sequencing. The luxAB cassette was flanked by SalI sites to facilitate subsequent cloning into the E. coli/Bacillus shuttle vector [pHP13; BGSC #ECE32].

Generation of the Wβ-targeting vector for homologous recombination

A 374-bp fragment encompassing the wp39/wp40 intergenic region and the 5′-end of wp40 (5′ flanking sequences for the recombination cassette, position 33 312–33 686; GenBank accession number DQ289555) was PCR-amplified using Wβ DNA as template. A 383 bp wp41 region (encompassing 35 948–36 331 bp of the Wβ genome) was also PCR-amplified and designated as the 3′ flanking sequence for the recombination cassette (Fig. 1). The wp39/wp40 and wp41 primers were designed to incorporate HindIII/SalI and SalI/EcoRI restriction sites, respectively at the 5′- and 3′-ends to facilitate subsequent cloning into pBluescript-SK. The wp39/wp40 and the wp41 Wβ phage DNA was then excised with HindIII/SalI or SalI/EcoRI, respectively, and cloned into the corresponding sites of the E. coli/Bacillus shuttle plasmid pHP13. By cloning wp39/wp40 and wp41 into the HindIII/SalI or SalI/EcoRI sites, respectively, a unique internal SalI site was available. Consequently, the luxAB expression cassette was then cloned into the internal SalI site, and was therefore flanked by the Wβ DNA at the 5′- and 3′-ends to create pwp39.luxAB.wp41.HP13. To provide positive selective pressure for recombinant phage isolation, the SPC antibiotic resistance gene was PCR-amplified from plasmid pDG1728 (BGSC #ECE114) and inserted into the recombination cassette 3′ of the luxAB genes to create pwp39.luxAB.SPC.wp41.HP13 (Fig. 1).

image

Figure 1.  Schematic of the Bacillus shuttle vector and homologous recombination process leading to integration of the luxAB expression cassette by a replacement/double cross-over event.

Download figure to PowerPoint

Homologous recombination and recombinant Wβ::luxAB phage isolation

The luxAB genes were integrated into the phage genome through homologous recombination (double cross-over event) between Wβ phage and integration cassette DNA. The B. cereus ATCC4342 Wβ lysogen was electroporated (Turgeon et al. 2006) with pwp39.luxAB.SPC.wp41.HP13 and the transformants were selected by growth on BHI agar plates supplemented with 100 μg ml−1 of SPC (BHI/SPC). The transformants were positive for bioluminescence as expected (data not shown). Single colonies were grown in BHI/SPC at 30°C for 18 h and the resulting cultures were clarified by centrifugation (10 000 g, 3 min). Supernatants (containing wild-type Wβ phage and a small number of recombinant Wβ::luxAB phage) were passed through a 0·22-μm pore size filter and treated with DNase I (20 units, 30°C, 30 min). The treated phage supernatants were used to infect B. cereus ATCC4342 and the cell-phage suspensions were plated onto BHI/SPC agar plates in order to select and isolate B. cereus Wβ::luxAB lysogens. After overnight growth at 30°C, six SPC-resistant B. cereus colonies were obtained. All of the six colonies were positive for bioluminescence (data not shown) and harboured recombinant Wβ::luxAB phage.

Bacillus anthracis Sterne spore preparation

Spores were generated by diluting an overnight culture (1 : 10) in minimal media (0·5 mmol l–1 of MgCl2, 0·01 mmol l–1 of MnCl2·4H2O, 0·05 mmol l–1 of FeCl3·6H2O, 0·05 mmol l–1 of ZnCl2, 0·2 mmol l–1 of CaCl2, 13 mmol l–1 of KH2PO4, 26 mmol l–1 of K2HPO4, 20 μg ml−1 of l-glutamine, 1 mg ml−1 of acid casein hydrolysate, 1 mg ml−1 of enzymatic casein hydrolysate, 0·4 mg ml−1 of yeast extract, and 0·6 mg ml−1 of glycerol) and incubating at 30°C with shaking (Stewart et al. 1981; Ireland and Hanna 2002a). After 48 h, phase-contrast microscopy indicated the presence of refractile spores; cultures consisted of >90% spores. The cultures were centrifuged for 15 min at 3000 g, washed four times with sterile distilled water (dH2O), and resuspended in 2 ml of dH2O. Following a 30 min incubation at 70°C (which killed the vegetative form), the spores were washed four times with dH2O, with the uppermost layer of the pellet discarded after each wash. The spores were stored in dH2O at room temperature. Using phase-contrast microscopy, the resulting suspension consisted of >99% spores; the vegetative cells were not observed in multiple fields of vision (data not shown). The spores were enumerated by colony counting after 24 h of growth at 30°C on BHI agar plates.

Bioluminescence assays

Unless otherwise indicated, Wβ::luxAB phage and B. anthracis cells were mixed and incubated at 30°C for the designated time points. ‘Flash’ bioluminescence was measured using a Biotek Synergy II multiplate detection reader. The cultures were injected with n-decanal (0·5%) and read for 10 s. Controls consisted of cells alone or phage alone. Results presented are representative of multiple independent experiments (n ≥ 3).

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Design of the luxAB expression cassette

The 5′luxA and luxB primers contained a consensus ribosome-binding site (TAAGGAGGTAAAAAA[ATG]), which has been shown to mediate efficient translation initiation in Gram-positive species (Schofield et al. 2003). To drive transcriptional expression of luxAB, a ‘Bacillus’ promoter was designed to contain a consensus –35 region, a 1 bp mismatch at the –10 region, and two conserved A nucleotides 3′ of the –10 (Voskuil and Chambliss 1998). To ensure efficient processing and to prevent runaway transcription, the transcriptional terminator TL17 (Wright et al. 1992) was cloned downstream of the luxA and luxB genes.

Verification of the Wβ::luxAB recombinant phage

The Wβ phage was chosen for the proof of concept study as: (i) the ability to form a lysogen aids in the genetic manipulation and cloning of the recombinant phage, and (ii) the closely related variant γ is Food and Drug Administration (FDA)-approved for the identification of B. anthracis (γ-lysis assay). One of the major differences between lysogenic Wβ and the lytic γ variant is that wp40 and wp41 has been deleted in γ and replaced by a 1360 bp fosfomycin resistance module (Schuch and Fischetti 2006). Although the functions of Wp40 and Wp41 proteins are unknown, both proteins apparently do not play an essential role in phage propagation. Therefore, the wp40 and wp41 locus was chosen as a suitable site for specific integration of the luxAB cassette.

Plasmid preparations from the putative B. cereus lysogens did not yield detectable plasmid DNA (data not shown). To confirm that integration was accomplished through a double cross-over replacement event, and to verify the presence of Wβ::luxAB recombinant phage, cell-free phage supernatants were analysed by PCR for the presence of wp28 (Wβ DNA), luxB (reporter), the absence of plasmid backbone (pHP13), and the loss of the specific Wβ sequence (del), which was expected to be replaced by luxAB. PCR analysis of the Wβ::luxAB for the presence of wp28 and luxB produced the PCR products of the correct predicted size, and no products were generated using primers specific for the plasmid backbone (pHP13) or for the Wβ sequence (del) expected to be replaced by the double cross-over integration event (Fig. 2a). Therefore, the results confirmed the presence of Wβ::luxAB phage DNA.

image

Figure 2.  Polymerase chain reaction (PCR) identification of the recombinant Wβ::luxAB phage. (a) PCR primers were designed against Wβ phage DNA (wp28), the luxB gene (luxB2), a Wβ genomic segment that was predicted to be deleted in the recombinant phage (del), and the recombination plasmid backbone (pHP13). PCR analysis was performed in the absence of template (lane 1), with the wild-type Wβ phage (lane 2) or with the recombinant Wβ::luxAB phage (lane 3). The predicted PCR product sizes for wp28, luxB2, del, and pHP13 were 178, 184, 258, and 208 bp, respectively. PCR analysis of the recombinant phage was positive for luxB2 and wp28 as expected, and negative for the Wβ region that was predicted to be deleted (del), and negative for the plasmid backbone. M indictaes 100 bp marker DNA ladder. (b) PCR primers (5′-INT, 3′-INT) were designed to span the 5′- or 3′-integration sites. The primers were designed to bind either within the recombination cassette (luxAB) or in the phage genome 5′ or 3′ of the cassette. PCR analysis was performed in the absence of template (lane 1), with the wild-type Wβ phage (lane 2) or with the recombinant Wβ::luxAB phage (lane 3). The predicted PCR product size for the 5′ and 3′ junctions were 988 and 1641 bp, respectively. PCR analysis indicated that the luxAB cassette integrated into the Wβ genome at the expected location. M indicates 1·0 kb marker DNA ladder.

Download figure to PowerPoint

To analyse whether luxAB integration into Wβ had occurred at the correct site in the Wβ genome, primers were designed to span both integration junction sites (Table 1; 5′-INT and 3′-INT); each primer set was designed to ensure that primer binding occurred both within and outside the original integration cassette. PCR analysis using the 5′-INT and 3′-INT primers generated PCR products of the correct predicted size (Fig. 2b), indicating that the luxAB cassette integrated at the correct loci. In addition, as DNase1-treated cell-free phage supernatants were also able to transduce a bioluminescent phenotype to B. anthracis Sterne, these results collectively indicated that functional Wβ::luxAB phages were generated.

Wβ::luxAB detection of Bacillus anthracis vegetative cells

The bacterial luxAB genes were used as the reporter genes of choice as: (i) luciferase has been successfully used as a reporter signal for the phage-mediated detection of Listeria, Salmonella, and E. coli O157:H7 (Loessner et al. 1996, 1997; Kuhn et al. 2002; Brigati et al. 2007); (ii) no processing of the sample is required; the only requirement is the addition of the substrate n-decanal, and (iii) active metabolism is required for luxAB expression and luciferase production. Thus, only viable cells should produce a light signal, and ensures that only potentially infectious cells generate a response.

The signal response time of Wβ::luxAB to transduce a bioluminescent phenotype to B. anthracis vegetative cells was assessed. Exponentially growing B. anthracis (OD600 of c. 0·6) was harvested and mixed with phage. The ability of Wβ::luxAB to transduce bioluminescence (relative light units or RLU) was monitored over time using a Synergy II multiplate detection reader. A steady increase in bioluminescence was detected from B. anthracis phage-infected cells (Fig. 3a). Moreover, a detectable light signal above the background (phage alone or cells alone) was evident within 16 min after phage infection. Therefore, the results indicated that: (i) the Wβ::luxAB phages were able to infect and transduce a bioluminescent phenotype to B. anthracis vegetative cells; (ii) the luxAB genes were functional in B. anthracis and produced a steady detectable bioluminescent signal, and (iii) the signal response time was quick at 16 min after phage infection (Fig. 3a, arrow). In contrast, heat-treated cells (65°C incubation for 30 min in BHI), which caused more than a 106-fold drop in cell viability, were not able to produce a signal response (data not shown). This indicated that active cell metabolism was required for a bioluminescent signal and that the reporter phage had the capability of detecting viable (potentially infectious) cells only.

image

Figure 3.  Wβ::luxAB detection of Bacillus anthracis vegetative cells. (a) Signal response time: Wβ::luxAB detection within 16 min. Bacillus anthracis Sterne (1 × 108 CFU ml−1) was mixed with Wβ::luxAB phage (6 × 103 PFU ml−1) and the ability of Wβ::luxAB to transduce bioluminescence was monitored over time at 30°C. A detectable light signal above the background (phage alone or cells alone) was evident within 16 min after phage infection (arrow). The results are representative of multiple independent experiments (n = 3) [(–□–) Cells only; (–○–) Phage only; (–bsl00001–) Cells and phage]. (b) Assay sensitivity: Wβ::luxAB detection of 103 CFU ml−1. Different concentrations of B. anthracis Sterne cells were mixed with Wβ::luxAB phage (6·6 × 105 PFU ml−1) and the ability of Wβ::luxAB to transduce bioluminescence was monitored over time at 30°C. The results are representative of multiple independent experiments (n = 3) [(–□–) Cells only; (–○–) Phage only; (–bsl00001–) Phage & 1·6 × 107 CFU ml−1; (–•–) Phage & 1·6 × 105 CFU ml−1; (inline image) Phage & 1·6 × 103 CFU ml−1].

Download figure to PowerPoint

To investigate assay sensitivity and dose-dependent characteristics, 107, 105, and 10CFU ml−1 of B. anthracis vegetative cells were mixed with Wβ::luxAB phage (6·6 × 105 PFU ml−1), incubated at 30°C, and analysed for bioluminescence over time. Bioluminescent assays with the highest CFU ml−1 (107) produced the strongest signal at over 10 000 RLU within 30 min; longer incubation times produced a stronger signal response; however, as the cell number decreased from 107 to 10CFU ml−1, the signal response (RLU) decreased, and the signal response time increased indicating dose–response characteristics (Fig. 3b). Nevertheless, 1600 CFU ml−1 was detectable above the background controls 60 min after mixing.

The Wβ (and γ) phages are able to infect and lyse a small number of atypical B. cereus strains (Schuch et al. 2002; Abshire et al. 2005; Schuch and Fischetti 2006). Therefore, we compared the ability of Wβ::luxAB to produce a bioluminescent signal upon infection of B. anthracis and the atypical B. cereus ATCC4342. As negative control, the phage-‘resistant’B. cereus strain ATCC14579 (Schuch et al. 2002) was also analysed. As expected, a bioluminescent signal was obtained for B. anthracis and the atypical B. cereus ATCC4342, but not for B. cereus ATCC14579 (Fig. 4); however, the signal response time for the detection of B. cereus ATCC4342 was longer than for B. anthracis. In addition, the strength of the signal (RLU) was an order of magnitude lower (50-fold lower 45 min postinfection). The ability of the reporter phage to detect four wild-type B. thuringiensis strains (SLM5.A, HL51, T39 001, and Pbt 23) was also assessed. As expected, the reporter phage was not able to confer a bioluminescent signal response to the B. thuringiensis strains (data not shown).

image

Figure 4.  Wβ::luxAB detection of Bacillus anthracis and Bacillus cereus vegetative cells. Bacillus anthracis (8 × 107 CFU ml−1), atypical (phage-susceptible) B. cereus ATCC4342 (1 × 108 CFU ml−1), and nonsusceptible B. cereus ATCC14579 (9 × 107 CFU ml−1) were mixed with Wβ::luxAB phage (3·6 × 105 PFU ml−1) and the ability of Wβ::luxAB to transduce bioluminescence was monitored over time at 30°C. A signal response was not detected for ATCC14579 as expected. A bioluminescent signal was obtained for B. cereus ATCC4342, although the response time, and signal strength was longer and lower, respectively, than for B. anthracis. The results are representative of multiple independent experiments (n = 3). (–○–) Phage only; (–□–) B. anthracis only; (inline image) B. cereus ATCC14579 only; (inline image) B. cereus ATCC4342 only; (–bsl00001–) B. anthracis & phage; (inline image) B. cereus ATCC14579 & phage; (inline image) B. cereus ATCC4342 & phage.

Download figure to PowerPoint

Wβ::luxAB detection of Bacillus anthracis spores

γ, and presumably Wβ phage, bind to a specific receptor on the B. anthracis cell wall termed GamR (Davison et al. 2005); however, Bacillus spores are refractory to phage binding. This is most likely because of the GamR phage receptor not being present for binding on the spore surface. Therefore, the phage must be delivered under conditions that induce spore germination. Bacillus anthracis spores are readily, and quickly germinated in BHI media supplemented with the amino acid l-alanine (100 mmol l–1; Titball and Manchee 1987; Ireland and Hanna 2002a,b). Therefore, the ability of Wβ::luxAB phage to infect and transduce a bioluminescent phenotype to B. anthracis spores was assessed in BHI with 100 mmol l–1 of l-alanine at 35°C. A detectable light signal was observed after 60 min incubation in germination-inducing medium (Fig. 5a, arrow). A signal response time of 60 min was obtained using either heat-activated or nonheat-activated spores (data not shown). This suggested that the phage receptor was expressed and accessible to phage binding on the cell surface within a short time period after spore germination. Collectively, the results demonstrated that Wβ::luxAB can effectively and quickly detect the presence of B. anthracis spores when used under conditions that promote spore germination. As only germinating spores are infected, this also ensures that only viable, potentially infectious cells are detectable by the phage reporter system. To investigate assay sensitivity and dose-dependent characteristics, 10-fold serial dilutions of spores (ranging from 1·6 × 108 to 1·6 × 104 spores ml−1) were mixed with Wβ::luxAB phage and incubated under germination-inducing conditions as described before. Assays containing 108 spores ml−1, elicited the strongest signal response of over 10 000 RLU within 90 min. As the number of spores decreased, bioluminescence decreased, and the signal response time increased (Fig. 5b). Nevertheless, 1·6 × 105 spores ml−1 generated a bioluminescent signal within 120 min postinfection.

image

Figure 5.  Wβ::luxAB bioluminescent detection of germinating Bacillus anthracis spores. (a) Signal response time: Wβ::luxAB detection of germinating spores in 60 min. The spores were heated at 65°C for 30 min before use. The spores (1·6 × 108 CFU ml−1) were mixed with Wβ::luxAB phage (6·6 × 105 PFU ml−1) and incubated under spore-germinating conditions (brain heart infusion or BHI/100 mmol l–1 of l-alanine, 35°C). A detectable light signal above the background (phage alone or spores alone) was evident 60 min after phage infection (arrow). The results are representative of multiple independent experiments (n = 3) [(inline image) Spores only; (–○–) Phage only; (–bsl00001–) Spores and phage]. (b) Assay sensitivity: Wβ::luxAB detection of 105 germinating spores. The spores were heated at 65°C for 30 min before use. Spores (108 to 104 CFU ml−1) were mixed with Wβ::luxAB (4·8 × 105 PFU ml−1) under germination-inducing conditions (BHI/l-alanine, 35°C) and assayed for bioluminescence at the designated time points. The results are representative of multiple independent experiments (n = 3) [(–□–) Spores only; (–○–) Phage only; (–bsl00001–) Phage & 1·6 × 108 spores ml−1; (–•;–) Phage & 1·6 × 107 spores ml−1; (inline image) Phage & 1·6 × 106 spores ml−1; (inline image) Phage & 1·6 × 105 spores ml−1; (inline image) Phage & 1·6 × 104 spores ml−1].

Download figure to PowerPoint

Wβ::luxAB detection of Bacillus anthracis in mixed bacterial populations

Environmental samples will consist of mixed populations of bacterial species. To examine the ability of the reporter phage to detect B. anthracis in the presence of other phage-resistant bacterial species, the ability of the reporter phage to transduce a bioluminescent signal response was assessed using: (i) B. anthracis spores in the presence of B. thuringiensis vegetative cells, and (ii) B. anthracis vegetative cells in the presence of B. cereus and/or B. thuringiensis spores. The reporter phage displayed an equal ability to transduce a bioluminescent signal response to B. anthracis spores in the presence or absence of B. thuringiensis vegetative cells (Fig. 6a). Similarly, the reporter phage was able to detect B. anthracis vegetative cells in the presence of B. cereus and/or B. thuringiensis spores (Fig. 6b). Therefore, the reporter phage was able to detect B. anthracis spores or vegetative cells in mixed bacterial populations containing vegetative cells or spores from other Bacillus species.

image

Figure 6.  Wβ::luxAB detection of Bacillus anthracis in mixed bacterial populations. (a) Detection of B. anthracis spores (sp.) in the presence of Bacillus thuringiensis vegetative cells. Bacillus anthracis spores (3·3 × 107 CFU ml−1) and vegetative cells of the phage-resistant strain B. thuringiensis SLM5.A (1·6 × 106 CFU ml−1) were mixed with Wβ::luxAB phage (1·2 × 105 PFU ml−1) and incubated under spore-germinating conditions. The reporter phage displayed a similar ability to transduce a bioluminescent signal response to B. anthracis in the presence or absence of B. thuringiensis. The results are representative of multiple independent experiments (n = 3) [(–○–), Phage only; (–□–) B. anthracis sp.; (inline image) B. thuringiensis; (inline image) B. anthracis sp. & B. thuringiensis; (–bsl00001–) B. anthracis sp. & phage; (inline image) B. thuringiensis & phage; (inline image) B. anthracis sp., & B. thuringiensis & phage)]. (b) Detection of B. anthracis vegetative cells in the presence of B. thuringiensis and/or Bacillus cereus spores (sp.). Bacillus anthracis vegetative cells (4·7 × 106 CFU ml−1) and spores of the phage-resistant strains, B. thuringiensis SLM5.A (5 × 107 CFU ml−1) and B. cereus ATCC14579 (5 × 106 CFU ml−1), were mixed with Wβ::luxAB phage (1·1 × 105 PFU ml−1) and incubated under spore-germinating conditions. The reporter phage displayed a similar ability to detect B. anthracis vegetative cells in the presence or absence of B. thuringiensis and/or B. cereus spores. The results are representative of multiple independent experiments (n = 3) [(–○–) Phage only; (inline image) B. anthracis; (inline image) B. anthracis, B. cereus sp.; (inline image) B. anthracis & B. thuringiensis sp.; (inline image) B. anthracis & B. thuringiensis sp., & B. cereus sp.; (inline image) B. anthracis & phage; (inline image) B. anthracis, B. cereus sp. & phage; (inline image) B. anthracis & B. thuringiensis sp. & phage; (inline image) B. anthracis & B. thuringiensis sp., B. cereus sp. & phage].

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Following the terrorist attacks of 11 September 2001 and the ensuing release of spores via the US postal system, there has been considerable interest in the development of improved technologies for bioterrorism preparedness. The use of B. anthracis phage offers a powerful, and natural tool to help in this development and different approaches are being explored to exploit the unique properties of phage for both detection and treatment strategies (Schuch et al. 2002; Yoong et al. 2006; Fujinami et al. 2007; Reiman et al. 2007). In particular, purified phage lytic enzymes are highly efficacious at lysing both vegetative cells and germinating spores, and thus hold promise as potential therapeutic agents for the treatment of anthrax (Fischetti 2005). Unlike many other phages, the B. anthracisγ phage (and to a lesser extent, the parental Wβ phage) are ideally suited as reporter phages because they exhibit broad host-range infectivity and species specificity. In a recent study, γ phage was able to infect and lyse 49 out of 51 B. anthracis strains collected from diverse geographical locations such as Pakistan, Canada, Argentina, England, USA, and South Africa (Abshire et al. 2005). The γ-phage lysis assay is FDA-approved, and is used by the CDC and various public health laboratories for the identification of B. anthracis isolates. After overnight growth on laboratory media, the presence of plaques (bacterial lysis) is a positive indication for the presence of B. anthracis. The γ-phage lysis assay, however, is laboratory-based and: (i) takes 18–24 h to complete (time required for the formation of plaques); (ii) requires laboratory-based equipment, and (iii) requires skilled technicians to interpret the data. As early and immediate diagnosis are essential for a successful prognosis, the identification of B. anthracis in environmental samples and clinical specimens are keys for the implementation of public health measures.

Although the identification of B. anthracis is complicated because of the close genetic similarity to B. cereus and B. thuringiensis, a number of different methodologies are available. Bacillus anthracis isolates can be identified by microbiological and morphological methods as the organism is sensitive to penicillin, is nonmotile, selectively grows on PLET agar, and is not β-haemolytic on sheep- or horse-blood agar plates. Identification based on colony morphology and biochemical tests (e.g. McFaydean’s capsule staining test) generally takes 12–24 h or longer (Edwards et al. 2006; Klee et al. 2006). Immunoassays based on surface antigens can provide a much more rapid detection time. For example, immunoassays targeting either spore antigens or the anthrax toxins can be completed within 15–120 min, which is comparable with the signal response time described in this report (Mabry et al. 2006; Hoile et al. 2007). However, in general, immunoassays lack sensitivity and specific detection is difficult owing to cross-reactivity with other Bacillus species. For example, the RAMP Anthrax test consistently produced negative results at concentrations below 5 × 105 CFU ml−1 (Hoile et al. 2007). In contrast, PCR assays (multiplex PCR, real-time PCR) targeting chromosomal markers (e.g. Ba813) or plasmid markers (pX01 or pX02) offer extremely sensitive detection (10 target copies) with a detection time within 60 min (Bell et al. 2002; Edwards et al. 2006). As active cell metabolism is required for reporter phage detection, a potential advantage of the reporter phage in comparison with PCR is that the latter methodology detects the presence of DNA, but offers no information on whether the cell is intact and potentially infectious. Therefore, the ability to only detect viable cells may offer a distinct and desirable utility.

Bacillus anthracis detection methodologies such as the reporter phage described in this report and the FDA-approved γ assay, do have limitations. As the phage can infect four rare B. cereus strains (McCloy 1951b; Brown and Cherry 1955; Schuch and Fischetti 2006), a light signal (or plaque) may not necessarily indicate the positive identification of B. anthracis. Therefore, further confirmatory tests may be required. The existence of isolates that are resistant to phage infection may also be problematic. Phage resistance can occur through different mechanisms and at different points during the phage life cycle; e.g. through superinfection immunity (lysogenic isolates), mutations in the phage receptor, abortive infection, and lysis-resistant mutants. Abshire et al. (2005) found that 2 B. anthracis isolates out of the 51 tested were resistant to the lytic actions of the γ phage. Although the possibility exists that this resistance may be attributed to the inability of the phage to lyse its host, it is likely that some isolates will be refractory to reporter phage infection and/or expression of the luxAB genes, and hence identification.

Our results demonstrate that the Wβ::luxAB-tagged phage can quickly confer a bioluminescent phenotype to B. anthracis vegetative cells and germinating spores. Thus, the reporter phage detection system may be applicable for use with both environmental samples and diagnostic specimens; however, although not an issue for the proof of principle concept, a limitation of the reporter phage described herein is that the Wβ::luxAB phage can only infect (and detect) nonencapsulated strains. Therefore, future work will change the tropism of Wβ phage to allow infection of encapsulated and nonencapsulated B. anthracis. The lytic γ phage is thought to have originally evolved from the lysogenic Wβ phage (Schuch and Fischetti 2006). Comparison of Wβ and γ indicated that the γ variant evolved from lysogenic Wβ by deletions and modification at the lysogenic locus and by key mutations (69 point mutations) in the tail fibre gene, wp14. The tail fibres are responsible for cell recognition and binding to the correct cell receptors. γ Gp14 is a more basic protein compared with Wp14 (with pI values of 6·66 and 7·74, respectively), which is consistent with a protein that more effectively penetrates the negatively charged B. anthracis capsule (Schuch and Fischetti 2006). Therefore, mutation of the Wβ tail fibre gene may convert Wβ into a phage with γ-like broad-strain infectivity.

In summary, we have generated the proof of principle results that a luxAB-tagged reporter phage may be used for the detection of B. anthracis and displays promise as a tool for use with environmental or clinical samples.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

The authors thank Dr Raymond Schuch (Rockefeller University) for advice on Wβ phage isolation and the Medical University of South Carolina Biotechnology Resource laboratory for sequencing data. This research was supported by the Small Business Innovation Research (SBIR) programme of the USDA Cooperative State Research, Education, and Extension Service (CSREES), grant number 2007-33610-18000 to D.A.S of Guild Associates, Inc.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  • Abshire, T.G.., Brown, J.E. and Ezzell, J.W. (2005) Production and validation of the use of gamma phage for identification of Bacillus anthracis. J Clin Microbiol 43, 47804788.
  • Bartlett, J.G., Inglesby, T.V. Jr and Borio, L. (2002) Management of anthrax. Clin Infect Dis 35, 851858.
  • Bell, C.A., Uhl, J.R., Hadfield, T.L., David, J.C., Meyer, R.F., Smith, T.F. and Cockerill, F.R. III (2002) Detection of Bacillus anthracis DNA by LightCycler PCR. J Clin Microbiol 40, 28972902.
  • Brigati, J.R., Ripp, S.A., Johnson, C.M., Iakova, P.A., Jegier, P. and Sayler, G.S. (2007) Bacteriophage-based bioluminescent bioreporter for the detection of Escherichia coli 0157:H7. J Food Protect 70, 13861392.
  • Brown, E.R. and Cherry, W.B. (1955) Specific identification of Bacillus anthracis by means of a variant bacteriophage. J Infect Dis 96, 3439.
  • Carlson, K. (2005) Working with bacteriophages: common techniques and methodological approaches. In Bacteriophages: Biology and Applications ed. Kutter, E. and Sulakvelidze, A. pp. 437494 Boca Raton: CRC Press.
  • Davison, S., Couture-Tosi, E., Candela, T., Mock, M. and Fouet, A. (2005) Identification of the Bacillus anthracis (gamma) phage receptor. J Bacteriol 187, 67426749.
  • Dusthackeer, A., Kumar, V., Subbian, S., Sivaramakrishnan, G., Zhu, G., Subramanyam, B., Hassan, S., Nagamaiah, S. et al. (2008) Construction and evaluation of luciferase reporter phages for the detection of active and non-replicating tubercle bacilli. J Microbiol Methods 73, 1825.
  • Edwards, K.A., Clancy, H.A. and Baeumner, A.J. (2006) Bacillus anthracis: toxicology, epidemiology and current rapid-detection methods. Anal Bioanal Chem 384, 7384.
  • Fischetti, V.A. (2005) The use of phage lytic enzymes to control bacterial infections. In Bacteriophages: Biology and Applications ed. Kutter, E. and Sulakvelidze, A. pp. 321334 Boca Raton: CRC Press.
  • Fujinami, Y., Hirai, Y., Sakai, I., Yoshino, M. and Yasuda, J. (2007) Sensitive detection of Bacillus anthracis using a binding protein originating from gamma-phage. Microbiol Immunol 51, 163169.
  • Greenfield, R.A. and Bronze, M.S. (2003) Prevention and treatment of bacterial diseases caused by bacterial bioterrorism threat agents. Drug Discov Today 8, 881888.
  • Helgason, E., Okstad, O.A., Caugant, D.A., Johansen, H.A., Fouet, A., Mock, M., Hegna, I. and Kolsto, A.B. (2000) Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis– one species on the basis of genetic evidence. Appl Environ Microbiol 66, 26272630.
  • Hill, K.K., Ticknor, L.O., Okinaka, R.T., Asay, M., Blair, H., Bliss, K.A., Laker, M., Pardington, P.E. et al. (2004) Fluorescent amplified fragment length polymorphism analysis of Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis isolates. Appl Environ Microbiol 70, 10681080.
  • Hoile, R., Yuen, M., James, G. and Gilbert, G.L. (2007) Evaluation of the rapid analyte measurement platform (RAMP) for the detection of Bacillus anthracis at a crime scene. Forensic Sci Int 171, 14.
  • Inglesby, T.V., O’Toole, T., Henderson, D.A., Bartlett, J.G., Ascher, M.S., Eitzen, E., Friedlander, A.M., Gerberding, J. et al. (2002) Anthrax as a biological weapon, 2002: updated recommendations for management. JAMA 287, 22362252.
  • Ireland, J.A. and Hanna, P.C. (2002a) Amino acid- and purine ribonucleoside-induced germination of Bacillus anthracis DeltaSterne endospores: gerS mediates responses to aromatic ring structures. J Bacteriol 184, 12961303.
  • Ireland, J.A. and Hanna, P.C. (2002b) Macrophage-enhanced germination of Bacillus anthracis endospores requires gerS. Infect Immun 70, 58705872.
  • Ivanova, N., Sorokin, A., Anderson, I., Galleron, N., Candelon, B., Kapatral, V., Bhattacharyya, A., Reznik, G. et al. (2003) Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis. Nature 423, 8791.
  • Klee, S.R., Nattermann, H., Becker, S., Urban-Schriefer, M., Franz, T., Jacob, D. and Appel, B. (2006) Evaluation of different methods to discriminate Bacillus anthracis from other bacteria of the Bacillus cereus group. J Appl Microbiol 100, 673681.
  • Kuhn, J., Suissa, M., Wyse, J., Cohen, I., Weiser, I., Reznick, S., Lubinsky-Mink, S., Stewart, G. et al. (2002) Detection of bacteria using foreign DNA: the development of a bacteriophage reagent for Salmonella. Int J Food Microbiol 74, 229238.
  • Loessner, M.J., Rees, C.E., Stewart, G.S. and Scherer, S. (1996) Construction of luciferase reporter bacteriophage A511::luxAB for rapid and sensitive detection of viable Listeria cells. Appl Environ Microbiol 62, 11331140.
  • Loessner, M.J., Rudolf, M. and Scherer, S. (1997) Evaluation of luciferase reporter bacteriophage A511::luxAB for detection of Listeria monocytogenes in contaminated foods. Appl Environ Microbiol 63, 29612965.
  • Mabry, R., Brasky, K., Geiger, R., Carrion, R. Jr, Hubbard, G.B., Leppla, S., Patterson, J.L., Georgiou, G. et al. (2006) Detection of anthrax toxin in the serum of animals infected with Bacillus anthracis by using engineered immunoassays. Clin Vaccine Immunol 13, 671677.
  • McCloy, E.W. (1951a) Unusual behaviour of a lysogenic Bacillus strain. J Gen Microbiol 5, xivxv.
  • McCloy, E.W. (1951b) Studies on a lysogenic strain. A bacteriophage specific for B. anthracis. J Hyg 50, 114125.
  • Priest, F.G., Barker, M., Baillie, L.W., Holmes, E.C. and Maiden, M.C. (2004) Population structure and evolution of the Bacillus cereus group. J Bacteriol 186, 79597970.
  • Radnedge, L., Agron, P.G., Hill, K.K., Jackson, P.J., Ticknor, L.O., Keim, P. and Andersen, G.L. (2003) Genome differences that distinguish Bacillus anthracis from Bacillus cereus and Bacillus thuringiensis. Appl Environ Microbiol 69, 27552764.
  • Reiman, R.W., Atchley, D.H. and Voorhees, K.J. (2007) Indirect detection of Bacillus anthracis using real-time PCR to detect amplified gamma phage DNA. J Microbiol Methods 68, 651653.
  • Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual. New York: Cold Spring Harbor Press.
  • Sarkis, G.J., Jacobs, W.R. Jr and Hatfull, G.F. (1995) L5 luciferase reporter mycobacteriophages: a sensitive tool for the detection and assay of live mycobacteria. Mol Microbiol 15, 10551067.
  • Schofield, D.A., Westwater, C., Hoel, B.D., Werner, P.A., Norris, J.S. and Schmidt, M.G. (2003) Development of a thermally regulated broad-spectrum promoter system for use in pathogenic gram-positive species. Appl Environ Microbiol 69, 33853392.
  • Schuch, R. and Fischetti, V.A. (2006) Detailed genomic analysis of the Wbeta and gamma phages infecting Bacillus anthracis: implications for evolution of environmental fitness and antibiotic resistance. J Bacteriol 188, 30373051.
  • Schuch, R., Nelson, D. and Fischetti, V.A. (2002) A bacteriolytic agent that detects and kills Bacillus anthracis. Nature 418, 884889.
  • Stewart, G.S., Johnstone, K., Hagelberg, E. and Ellar, D.J. (1981) Commitment of bacterial spores to germinate. A measure of the trigger reaction. Biochem J 198, 101106.
  • Titball, R.W. and Manchee, R.J. (1987) Factors affecting the germination of spores of Bacillus anthracis. J Appl Bacteriol 62, 269273.
  • Turgeon, N., Laflamme, C., Ho, J. and Duchaine, C. (2006) Elaboration of an electroporation protocol for Bacillus cereus ATCC 14579. J Microbiol Methods 67, 543548.
  • Voskuil, M.I. and Chambliss, G.H. (1998) The –16 region of Bacillus subtilis and other gram-positive bacterial promoters. Nucleic Acids Res 26, 35843590.
  • Wright, J.J., Kumar, A. and Hayward, R.S. (1992) Hypersymmetry in a transcriptional terminator of Escherichia coli confers increased efficiency as well as bidirectionality. EMBO J 11, 19571964.
  • Yoong, P., Schuch, R., Nelson, D. and Fischetti, V.A. (2006) PlyPH, a bacteriolytic enzyme with a broad pH range of activity and lytic action against Bacillus anthracis. J Bacteriol 188, 27112714.