SEARCH

SEARCH BY CITATION

Keywords:

  • antibiotic resistance;
  • Czech Republic;
  • intestinal bacteria;
  • Slovakia;
  • Sus scrofa

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Aims:  To determine the presence of antibiotic-resistant faecal Escherichia coli in populations of wild mammals in the Czech Republic and Slovakia.

Methods and Results:  Rectal swabs or faeces collected during 2006–2008 from wild mammals were spread on MacConkey agar and MacConkey agar containing 2 mg l−1 of cefotaxime. From plates with positive growth, one isolate was recovered and identified as E. coli. Susceptibility to 12 antibiotics was tested using the disk diffusion method. Resistance genes, class 1 and 2 integrons and gene cassettes were detected in resistant isolates by polymerase chain reaction (PCR). Extended-spectrum beta-lactamases (ESBL) were further characterized by DNA sequencing, macrorestriction profiling and determination of plasmid sizes. Plasmid DNA was subjected to EcoRV digestion, transferability by conjugation and incompatibility grouping by multiplex PCR. The prevalence of resistant isolates was 2% in small terrestrial mammals (rodents and insectivores, nE. coli = 242), 12% in wild ruminants and foxes (nE. coli = 42), while no resistant isolates were detected in brown bears (nE. coli = 16). In wild boars (Sus scrofa) (nE. coli = 290), the prevalence of resistant isolates was 6%. Class 1 and 2 integrons with various gene cassettes were recorded in resistant isolates. From wild boars, five (2%, nrectal smears = 293) multiresistant isolates producing ESBL were recovered: one isolate with blaCTX-M-1 + blaTEM-1, three with blaCTX-M-1 and one with blaTEM-52b. The blaCTX-M-1 genes were carried on approx. 90 kb IncI1 conjugative plasmids.

Conclusions:  Antibiotic-resistant E. coli occured in populations of wild mammals in various prevalences.

Significance and Impact of the Study:  Wild mammals are reservoirs of antibiotic-resistant E. coli including ESBL-producing strains which were found in wild boars.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

The increasing antimicrobial resistance in bacteria is a current problem in medicine. In the veterinary area, the alarming state of bacterial antibiotic resistance is seen in examining the Escherichia coli isolates, where attention has been given especially to food-producing animals such as pigs, cattle and domestic fowl (White 2006). A phenomenon studied rather more recently is the spreading of resistant E. coli strains into the environment beyond the populations directly influenced by the antibiotic practice and the subsequent colonization of wild animal populations.

We have studied the occurrence of resistant commensal E. coli in the populations of various wild bird species in the Czech Republic (Dolejska et al. 2007, 2008, 2009; Literak et al. 2007). The prevalence of resistant E. coli was found to be high in omnivorous synanthropic birds like black-headed gulls (Larus ridibundus) and rooks (Corvus frugilegus), while in house sparrows (Passer domesticus) from cattle stables the prevalence was substantially lower. Wild birds colonized by resistant E. coli, and particularly the synanthropic bird species with high prevalence of resistant E. coli, can thus become important reservoirs and vectors of these strains that are potentially concerning because of the presence of conjugatively transferable determinants of resistance.

Attention has been given to some species of wild mammals regarding the occurrence of commensal resistant E. coli in various parts of the world (Rolland et al. 1985; Routman et al. 1985; Graves et al. 1988; Kinjo et al. 1992; Gilliver et al. 1999; Livermore et al. 2001; Swiecicka et al. 2003; Costa et al. 2006; Kozak et al. 2009; Schierack et al. 2009). An extensive study analysing antibiotic resistance in 449 E. coli isolates from 77 wild mammal species of 14 families was carried out in Australia (Sherley et al. 2000). The results from Australia demonstrated a low but widespread prevalence of antimicrobial resistance in wild isolates. Geographical location and host group significantly influenced the antibiotic resistance profile of isolates.

The goal of the present study is to characterize the central European (Czech and Slovak) populations of wild mammals regarding the occurrence of commensal antimicrobial-resistant E. coli.

Material and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Animals

Small terrestrial mammals (Rodentia, Insectivora) were captured in a suburban and forest environment. They were snap trapped and dissected. During dissection, samples of the large intestines’ contents were collected for the subsequent E. coli isolation. In the suburban environment of the village of Kunin (north-eastern Czech Republic), small terrestrial mammals were captured near fields and family houses with gardens in May 2007 and 2008. In a forest environment frequented by people but not by farm animals near the village of Vracov (south-eastern Czech Republic), small terrestrial mammals were captured in September 2008.

Large wild mammals (Cervidae, Canidae) were examined in Poloniny National Park (NP) in north-eastern Slovakia. Faecal samples of these mammals were collected in winter of 2006/2007 and 2007/2008. The brown bear (Ursus arctos) is a carnivore living in the mountains of Slovakia. Its present population density is maintained by regulated culling. Rectal swabs were collected from brown bears that were shot in the Low Tatras NP in central Slovakia during 2005–2007. The wild boar (Sus scrofa) is common in central Europe and is a frequently hunted game species. Rectal swabs were collected from wild boars that were shot near Litomysl and Opava (central and north-eastern Czech Republic) in 2006 and 2007 (Fig. 1).

Figure 1.  Sampling sites in the Czech Republic and Slovakia.

Download figure to PowerPoint

image

Sample collection and processing

Individual rectal swabs from wild pigs, samples of intestinal content from small terrestrial mammals or samples of faeces were placed overnight in buffered peptone water (BPW) at 37°C, then cultivated for E. coli and tested for susceptibility to 12 antimicrobial agents as previously described (Literak et al. 2007). Briefly, one colony of each plate was tested for susceptibility to antimicrobial agents in accordance with CLSI (The Clinical and Laboratory Standards Institute, Wayne, PA, USA). Antibiotic susceptibility was tested by disk diffusion method on Mueller–Hinton agar (CM337; Oxoid, UK) using antibacterial substances: amoxicillin–clavulanic acid (30 μg), ampicillin (10 μg), cephalothin (30 μg), ceftazidime (30 μg), chloramphenicol (30 μg), ciprofloxacin (5 μg), gentamicin (10 μg), nalidixic acid (30 μg), streptomycin (10 μg), trimethoprim–sulfamethoxazole (25 μg), sulfonamides compounds (300 μg) and tetracycline (30 μg) (Oxoid). In E. coli isolates found to be resistant to one or more of the antibiotics listed above, polymerase chain reaction (PCR) was used to detect specific antibiotic-resistant genes, integrase genes int1 and int2, and gene cassettes within class 1 and 2 integrons (Dolejska et al. 2007; Literak et al. 2007). The presence of genes tetA, tetB, tetC, tetD, tetE, tetG, blaTEM, blaSHV, blaOXA-2-like, blaOXA-1/-30, cat, cmlA, floR, sul1, sul2, sul3, strA, int1, int2, variable region of class 1 integron, variable region of class 2 integron, dhfr1, dhfr12, dhfr17, aadA1, aadA2, aadA5, estX and sat1/2 was tested with primers and under the conditions listed in Table 1. The control strains E. coli F134, H195, HR17, M2, M44, M66, M148, OP1, R128, Aeromonas sp. A233, Salmonella enterica serovar Typhimurium DT104S1 and Klebsiella pneumoniae ATTC700603 were used. All E. coli strains were identified by the API 10S test (BioMerieux, France).

Table 1.   List of primers for antibiotic resistance genes used in the study
Primer Primer sequence (5′–3′)Amplified geneAnneling temp. (°C)Amplicon size (bp)Reference
tetA/FGCT ACA TCC TGC TTG CCT TCtetA55210Ng et al. (1999)
tetA/RCAT AGA TCG CCG TGA AGA GG
tetB/FTTG GTT AGG GGC AAG TTT TGtetB55659Ng et al. (1999)
tetB/RGTA ATG GGC CAA TAA CAC CG
tetC/FCTT GAG AGC CTT CAA CCC AGtetC55418Ng et al. (1999)
tetC/RATG GTC GTC ATC TAC CTG CC
tetD/FAAA CCA TTA CGG CAT TCT GCtetD55787Ng et al. (1999)
tetD/RGAC CGG ATA CAC CAT CCA TC
tetE/FAAA CCA CAT CCT CCA TAC GCtetE55278Ng et al. (1999)
tetE/RAAA TAG GCC ACA ACC GTC AG
tetG/FCAG CTT TCG GAT TCT TAC GGtetG55468Ng et al. (1999)
tetG/RGAT TGG TGA GGC TCG TTA GC
686ACC AAT GCT TAA TCA GTG AGblaTEM55964Bergenholtz et al. (2009)
757GCG GAA CCC CTA TTT G
1354ATG TGC AGY ACC AGT AAR GTK ATG GCblaCTX-M all60554Hasman et al. (2005)
1580TGG GTR AAR TAR GTS ACC AGA AYS AGC GG
1537CCA TGG TTA AAA AAT CAC TGC GblaCTX-M-1 group60593Bergenholtz et al. (2009)
1580TGG GTR AAR TAR GTS ACC AGA AYS AGC GG
blaSHV/FCAC TCA AGG ATG TAT TGT GblaSHV55702Brinas et al. (2002)
blaSHV/RTTA GCG TTG CCA GTG CTC G
blaOXA2/FTTC AAG CCA AAG GCA CGA TAGblaOXA-2 like55885Brinas et al. (2002)
blaOXA2/RTCC GAG TTG ACT GCC GGG TTG
blaOXA-1FCCA AAG ACG TGG ATGblaOXA-1/-3055831EU339234
blaOXA-1RGTT AAA TTC GAC CCC AAG TT
cat/FCCT GCC ACT CAT CGC AGTcat55623Guerra et al. (2001)
cat/RCCA CCG TTG ATA TAT CCC
cmlA/FTGT CAT TTA CGG CAT ACT CGcmlA55455Saenz et al. (2004)
cmlA/RATC AGG CAT CCC ATT CCC AT
floF/FGCG ATA TTC ATT ACT TTG GCfloR50425Faldynova et al. (2003)
floF/RTAG GAT GAA GGT GAG GAA TG
sul1/FCTT CGA TGA GAG CCG GCG GCsul168417Zhao et al. (2001)
sul1/RGCA AGG CGG AAA CCC GCG CC
sul2/FAGG GGG CAG ATG TGA TCG ACsul258249Faldynova et al. (2003)
sul2/RGCA GAT GAT TTC GCC AAT TG
sul3/FGAG CAA GAT TTT TGG AAT CGsul355789Perreten and Boerlin (2003)
sul3/RCAT CTG CAG CTA ACC TAG GGC TTT GGA
strA/FCCT ATC GGT TGA TCA ATG TCstrA58250Faldynova et al. (2003)
strA/RGAA GAG TTT TAG GGT CCA CC
intI1/FCCT CCC GCA CGA TGA TCintI155280Zhao et al. (2001)
intI1/RTCC ACG CAT CGT CAG GC
intI2/FCAC GGA TAT GCG ACA AAA AGG TintI255788Saenz et al. (2004)
intI2/RGTA GCA AAC GAG TGA CGA AAT G
5′CSGGC ATC CAA GCA GCA AGClass 1 integron55VariableLevesque et al. (1995)
3′CSAAG CAG ACT TGA CCT GA
Hep74CGGGATCCCGGACGGCATGCACGATTTGTAClass 2 integron55VariableWhite et al. (2001)
Hep51GATGCCATCGCAAGTACGAG
dhfr1/FACG GAT CCT GGC TGT TGG TTG GAC GCdhfr155254Gibreel and Skold (1998)
dhfr1/RCGG AAT TCA CCT TCC GGC TCG ATG TC
dhfr12/FACT CGG AAT CAG TAC GCAdhfr1251462Guerra et al. (2001)
dhfr12/RGTG TAC GGA ATT ACA GCT
dhfr17/FGAT TTC TGC AGT GTC AGAdhfr1750384Guerra et al. (2004)
dhfr17/RCTC AGG CAT TAT AGG GAA
aadA1/FCGA CTC AAC TAT CAG AGG TAaadA151384AY534545
aadA1/RCTT TTG TCA GCA AGA TAG CC
aadA2/FCGG TGA CCA TCG AAA TTT CGaadA255249Frana et al. (2001)
aadA2/RCTA TAG CGC GGA GCG TCT CGC
aadA5/FCAC TGG ACA CAA TCC ACC TGaadA555217EF571855
aadA5/RCCA AGG CAC TAC TTC GCT TC
estX/FCCCATGAACCCATTATCCTGestX55227DQ286459
estX/RATGAGCAGCTTCCAGACCAT
sat/FCCGACCAAGGCTTTGAACTAsat1/255234DQ286459
sat/RTCGCAAATTCGATGAGACTG

The samples from BPW were enriched with MacConkey broth and subcultivated onto MacConkey agar containing cefotaxime (2 mg l−1) to detect E. coli strains with extended-spectrum beta-lactamases (ESBLs) (Wu et al. 2008). The colonies were examined using the double-disc synergy test for the production of ESBL (Thomson and Sanders 1992; CLSI 2008a) and identified by the API 10S test. The genes responsible for the ESBL phenotype (blaTEM, blaSHV and blaCTX-M) were identified by PCR, and the products were further analysed using sequencing (ABI 310 Genetic Analyser; Applied Biosystems). The primers 1537 and 1580 were used for sequencing of blaCTX-M-1 group, and the primers 686 and 757 were used for sequence analysis of blaTEM (Table 1).

Antimicrobial susceptibility of all the ESBL-positive isolates was tested quantitatively by broth microdilution with cation-adjusted Mueller–Hinton broth, according to CLSI guidelines (CLSI 2008b). Microtitre trays were used with dehydrated dilution ranges of custom-made panels of antibiotics (Trek Diagnostic System, East Grinstead, UK). The following antimicrobial agents were included in the panel: amoxicillin–clavulanic acid, ampicillin, apramycin, cefpodoxime, ceftiofur, cephalotin, chloramphenicol, ciprofloxacin, colistin, florfenicol, gentamicin, nalidixic acid, neomycin, spectinomycin, streptomycin, sulfamethoxazole, tetracycline and trimethoprim with the test ranges and Subcommittee on Veterinary Antimicrobial Susceptibility Testing (CLSI/VAST) breakpoints as described previously (CLSI 2008b). Identification of E. coli phylogenetic groups was performed using a multiplex PCR assay (Clermont et al. 2000) in all the ESBL isolates. By this method, E. coli isolates can be devided into four main phylogenetic groups (A, B1, B2 and D) according to the presence of chuA and yjaA genes and DNA fragment TSPE4.C2. The isolates were typed by XbaI-pulsed field gel electrophoresis (PFGE) (CDCP 2004). The samples with no band differences were designed as indistinguishable and possibly epidemiologically linked, and the samples with the different PFGE patterns (more than three band changes) were epidemiologically unrelated (Tenover et al. 1995).

Transferability of bla genes was tested by conjugation. Plate mating experiments were performed using plasmid-free, rifampicin-resistant and nalidixic acid-resistant E. coli MT102RN and Salm. Typhimurium SL5325 as recipients (Caroff et al. 1999; Olesen et al. 2004). The strains were grown to exponential phase, mixed (1 : 1), and 500 μl of the donor and recipient mixture was incubated using a bacteriological filter on the surface of blood agar at 37°C overnight. Transconjugants were selected on brain heart infusion (BHI) medium supplemented with 25 mg l−1 rifampicin, 32 mg l−1 nalidixic acid and 2 mg l−1 cefotaxime.

Plasmids of ESBL strains were characterized by replicon typing and EcoRV digestion. Primarily plasmid DNA was extracted using the Qiagen plasmid midi kit (Qiagen, Germany). Plasmid DNA was introduced to competent E. coli Genehogs® (Invitrogen, USA) by electroporation followed by the selection of transformants on BHI agar supplemented with cefotaxime (2 mg l−1). The presence of relevant bla gene in transformants was confirmed by PCR. The size of the plasmid with ESBL gene from transformants was designated by S1-PFGE. Plasmid DNA from transformants was digested with EcoRV and subjected to gel electrophoresis in 0·8% agarose gel for 4 h at 4·0 V cm−1. Plasmids were replicon typed as previously described (Carattoli et al. 2005).

The following abbreviations are used for resistance phenotype in this study: ampicillin (A), amoxicillin–clavulanic acid (Ac), chloramphenicol (C), cephalotin (Cf), ceftazidime (Cfz), ciprofloxacin (Cip), gentamicin (Gn), nalidixic acid (Na), streptomycin (S), sulfonamides cp. (Su), trimethoprim–sulfamethoxazole (Sxt) and tetracycline (T).

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Rodentia, Insectivora

In the suburban environment of the village of Kunin, 75 small terrestrial mammals were examined (Mus musculus– 4 specimens, Apodemus agrarius– 24, Apodemus flavicollis– 20, Apodemus sylvaticus– 2, Microtus arvalis– 6, Microtus subterraneus– 13, Arvicola terrestris– 1, Sorex araneus– 1, Crocidura suaveolens– 4). Escherichia coli was recovered from 43 animals. Resistance to antibiotics was recorded in only one isolate (1/43, 2%) from striped field mouse (A. agrarius). It was a multiresistant isolate with the phenotype ACSSuSxtT and with resistance genes blaTEM, cat, strA, sul1, sul2 and tetB. Also detected was the class 1 integron (2·0 kb) with gene cassette dhfr12-orf-aadA2. No isolates with ESBL production were found.

In the forest environment near the village of Vracov, 235 small terrestrial mammals were examined (A. flavicollis– 30 specimens, A. sylvaticus – 51, A. microps– 22, Microtus arvalis– 3, Microtus subterraneus– 11, Clethrionomys glareolus– 103, Sorex araneus– 12, Sorex minutus– 2, Crocidura suaveolens– 1). Escherichia coli was recovered from 199 animals. There were four resistant isolates (4/199, 2%). Three resistant isolates originated from bank voles (Clethrionomys glareolus): E. coli of the phenotype A (with the gene blaTEM), phenotype T (with the gene tetA) and phenotype Na. One resistant isolate was from A. sylvaticus: phenotype AT (with genes blaTEM and tetB). No isolates with ESBL production were found.

Cervidae, Canidae, Ursus arctos

Sixty samples of faeces from Poloniny NP were examined (Cervus elaphus– 53, Capreolus capreolus– 2, Vulpes vulpes– 5). Escherichia coli was isolated from 42 samples. Five isolates were resistant (5/42, 12%). Four resistant E. coli isolates originated from Cervus elaphus with phenotype T (with tetA gene) and one isolate originated from Vulpes vulpes with phenotype T (with tetB gene). A total of 21 rectal swabs were collected from U. arctos, and 16 E. coli isolates were recovered. In no U. arctos isolate was there recorded a resistance to the antimicrobials tested. No ESBL-producing isolates were found.

Sus scrofa

A total of 293 rectal swabs were collected from S. scrofa, and 290 E. coli were recovered. Antibiotic resistance was recorded in 17 isolates (17/290, 6%) (Table 2).

Table 2.   Overview of antibiotic-resistant Escherichia coli isolates from wild boars
Number of isolatesPhenotype of resistance*Resistance genes, integrons†: gene cassettes
  1. *A, ampicillin; Ac, amoxicillin–clavulanic acid; Na, nalidixic acid; S, streptomycin; Su, sulfonamides cp.; Sxt, trimethoprim–sulfamethoxazole; T, tetracycline.

  2. †I1, class 1 integron; I2, class 2 integron.

1AblaTEM
1Na 
1SstrA
1Sint2, estX-sat-aadA1
1Sint2, I2: 1·5 kb: sat-aadA1
2TtetA
3TtetB
1ASTblaTEM, strA, tetB
1NaSuSxtsul1, int1, I1: 1·7 kb: dhfr17-aadA5
1SSuTstrA, sul2, tetA
2SSuTstrA, sul2, tetB
1ASSuSxtTblaTEM, tetA, strA, sul1, sul2, int1, I1: 1·5 kb: dhfr1-aadA1
1AAcSSxtTblaTEM, strA, tetA, int2, I2: 2·0 kb: dhfr1-sat-aadA1

Of the 293 rectal swabs, five E. coli strains (5/293, 2%) were isolated on the medium with cefotaxime. All five strains produced ESBL (they were positive in the double disk synergy test). In all cases, the strains were multiresistant (with resistance to 3–8 antibiotics), and in two strains, class 2 integrons were found (Table 3). The genes blaCTX-M-1 (three strains), blaTEM-52b (one strain) and the combination of blaCTX-M-1 and blaTEM-1 (one strain) were found by PCR and sequencing. PFGE analysis of all five wild type isolates showed that each isolate produced a distinct pulse-type. All the isolates belonged to phylogenetic group A. The plasmids with blaCTX-M-1 were transferred by conjugation to the E. coli MT102RN and Salm. Typhimurium SL5325, while the plasmid with blaTEM-52b was transferred only to E. coli. The sul2 gene transferred together with blaCTX-M-1 genes by conjugation as well as transformation in all the strains, thus showing the presence of this gene on the same plasmid encoding blaCTX-M-1. All four plasmids encoding blaCTX-M-1 had identical EcoRV RFLP profile designated A. They belonged to the IncI group and had a size of approx. 90 kb. The blaTEM-52b-harbouring plasmid had a distinct RFLP profile (B), and the size of the plasmid was approx. 45 kb. In this plasmid, however, it was not possible to specify the Inc group by the method used.

Table 3.   Phenotypic and genotypic characteristics of ESBL-positive Escherichia coli strains from wild boars
IsolateNonbeta-lactam antibiotic resistance phenotype*bla genesOther antibiotic resistance genes and integrons†Phylogenetic group‡Plasmid type (EcoRV)bla gene on plasmidIncompatibility groupPlasmid size (approximate kb)Conjugation to
E. coliSalmonella enterica serovar Typhimurium
  1. ESBL, extended-spectrum beta-lactamase.

  2. *S, streptomycin; Spe, spectinomycin; Su, sulfonamides cp.; T, tetracycline.

  3. †I2, class 2 integron.

  4. ‡The phylogenetic groups were determinated by PCR for chuA and yjaA genes and DNA fragment TSPE4.C2 according to Clermont et al. (2000).

  5. §NT, incompatibility group not specified by the primers used in the study.

85DI/BSSuTblaCTX-M-1, blaTEM-1strA, sul2, tetAAAblaCTX-M-1IncI190++
137DI/BSSublaCTX-M-1strA, sul2AAblaCTX-M-1IncI190++
67DI/BSSpeSuTblaCTX-M-1tetB, sul2, int2, I2: 1·5 kb sat-aadA1AAblaCTX-M-1IncI190++
118DI/BSSpeSuTblaCTX-M-1tetA, sul2, int2, I2: 1·5 kb sat-aadA1AAblaCTX-M-1IncI190++
172DI/BTblaTEM-52btetAABblaTEM-52bNT§45+

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

The low prevalence (2%) of resistant E. coli isolates in the populations of small terrestrial mammals at two sites in Czech Republic was probably caused by an exceptional contact between the hosts and resistant E. coli strains produced by either humans or domestic animals that were capable of colonizing new hosts or at least of enabling the horizontal transfer of genetic determinants of antibiotic resistance to the E. coli strains that colonize small terrestrial mammals.

By examination of small terrestrial mammals originated from two pig farms in the Czech Republic, we found much higher prevalences of resistant E. coli in these mammals (11% and 54%, respectively) depending probably on the high prevalences of resistant E. coli isolates in pigs reared and treated with antibiotics in those farms (Literak et al. 2009). Recently, it was also suggested that E. coli isolates from wild small terrestrial mammals living on swine farms in Canada have higher rates of resistance and are more frequently multiresistant than E. coli isolates from environments, such as natural areas, that are less impacted by human and agricultural activities (Kozak et al. 2009).

Exceptional, yet still most frequent, was the resistance to tetracycline in E. coli from Czech small terrestrial mammals. Resistance to tetracycline had been frequent (unlike other antibiotics tested) also in E. coli isolates from bank voles examined in Poland (Swiecicka et al. 2003). A study of antibiotic resistance in E. coli from rats in Indonesia has suggested that tetracycline-resistant E. coli has become established in rats in West Java, whereas rats on the nearby uninhabited Krakatau Islands do not contain these bacteria (Graves et al. 1988). It was concluded that excessive or uncontrolled use of antibiotics by human population in areas where faecal contamination of the environment is inevitable leads to changes in the enteric flora of wild mammals living in these areas. We concur with that conclusion. Role of environmental bacteria as natural resistance reservoirs and possible source of genetic elements (Chopra and Roberts, 2001) could be another explanation for the frequent occurrence of tetracycline resistance in E. coli from wild mammals.

One E. coli strain isolated from the striped field mouse showed a multiresistant pattern. It is an exceptional finding in our study of small terrestrial mammals. However, the colonization of other small terrestrial mammals – 13-lined ground squirrels (Spermophilus tridecemlineatus) – by multiresistant isolates of other Gram-negative members of the γ-proteobacteria group was recorded in the USA (Cloud-Hansen et al. 2007).

In free-living ruminants, e.g. the Japanese serow (Capricornis crispus), the prevalence of resistant E. coli isolates was markedly lower compared to individuals of the same species in captivity (Kinjo et al. 1992). At Poloniny NP in Slovakia, the prevalence of resistant E. coli isolates from wild mammals, particularly ruminants but also the red fox, was 12%. This finding suggests the existence of important sources of colonization by resistant E. coli isolates in Poloniny NP. Meadows that are a food source for wild ruminants in the NP are also used for grazing of cattle. Cattle, especially calves, could be the source of resistant isolates (Dolejska et al. 2008). Foxes searching for food in the immediate vicinity of human habitations, and particularly in winter, can easily become infected with food contaminated by resistant isolates of human origin, or domestic animals could be the source. At villages within Poloniny NP, resistant E. coli isolates were found also in domestic dogs (data not shown). Both in wild ruminants and foxes from Poloniny NP, only monoresistant isolates with resistance to tetracycline were recorded, and we have not found the presence of ESBL in E. coli isolates. The occurrence of ESBL-producing E. coli from two deer (blaTEM-52) and one fox (blaCTX-M-14 + blaTEM-1) has recently been recorded in Portuguese NPs (Costa et al. 2006) suggesting the spreading of such strains also into the wildlife of NPs.

Antibiotic-resistant E. coli isolates were found among wild ruminants in the Stelvio NP, Italy (Caprioli et al. 1991). In Norway, antibiotic resistance was also found in E. coli isolates from wild cervids, and most of the resistant isolates were resistant to one type of antibiotics only (Lillehaug et al. 2005). Our results from Poloniny NP were similar. On the other hand, E. coli isolates from wild cervids and bank voles from remote areas of Finland were almost free of antimicrobial resistance (Osterblad et al. 2001), and thus it was suggested that the widespread resistance found in E. coli populations must be caused by human activities.

Class 1 and 2 integrons are genetic elements that play an important role in the development of antibiotic resistance. They have a worldwide distribution and are described from Gram-negative bacteria colonizing both humans and animals (Sunde 2005). Integrons so far characterized have originated mostly from bacteria isolated from environments where antibiotics are heavily used (Sunde 2005). Recently, a class 1 integron was found in E. coli isolated from wild reindeer (Rangifer tarandus) in a remote mountain area in Norway (Sunde 2005). In the present study, we have recorded class 1 and 2 integrons in striped field mouse and wild boars. In our other studies, we have recorded the occurrence of E. coli isolates with class 1 and 2 integrons in both domestic and wild animals as well as in surface waters in the Czech Republic (Dolejska et al. 2007, 2008, 2009; Literak et al. 2007). Class 1 integrons with the same gene cassettes as in wild boars were found in cattle, in black-headed gulls and in water from the pond where these gulls lived. Class 2 integrons with the same gene cassettes as in wild boars were also recorded in black-headed gulls. It seems that E. coli isolates possessing integrons with various gene cassettes are emerging more and more frequently in synanthropic wild animal populations, although these animals are not directly influenced by antibiotics.

The occurrence of multiresistant E. coli isolates from wild boars with ESBL-producing genes is a novelty in Europe. In central Europe, the wild boar is a common and widespread large mammal that lives in forest, field and suburban habitats and is intensively hunted in many countries (Herre 1986). Wild boars are omnivores and can visit communal refuse sites as well as the proximity of animal farms and consume animal waste containing resistant E. coli strains. We assume that the presence of multiresistant E. coli isolates with ESBL in wild boars is caused by these sources. Bacterial resistance to multiple antibiotics was recently documented in bacteria, including E. coli, colonizing the avian scavengers Egyptian vultures (Neophron percnopterus) in Spain (Blanco et al. 2007). The prevalence of antibiotic-resistant vulture bacteria was higher in areas where vultures consumed the highest proportion of carrion from stabled livestock, especially fattening pigs and poultry.

Most of the ESBL isolates from wild boars contained the blaCTX-M-1 gene. CTX-M-1 is one of most prevalent ESBLs in Europe. It has been frequently detected in humans (Novais et al. 2007) as well as in food-producing animals (Meunier et al. 2006). ESBL-producing E. coli with blaCTX-M-1 has also been recently detected in wild birds (Poeta et al. 2008; Dolejska et al. 2009). The blaCTX-M-1 in all the isolates was carried on large 90 -kb plasmids. This plasmid also carried the sulfonamide-resistance gene sul2. This plasmid seems to be of relatively broad host range because of conjugation to the Salmonella recipient. All the plasmids had the same RFLP profile and belonged to the incompatibility group IncI1. This type of plasmid has recently been associated with blaCTX-M-1 in poultry in France (Girlich et al. 2007) and Denmark (data not published). It provides evidence that the ESBL-producing E. coli selected for in humans and food-producing animals are colonizing wild animals, which can thus become reservoirs and possible vectors of these strains into the environment.

The gene blaTEM-52b was found in one E. coli isolate from a wild boar. TEM-52 has been seen in nontyphoid Salmonella of human origin, and Salmonella seems to be the preferred reservoir for this ESBL type (Yates et al. 2004; Hasman et al. 2005). The gene blaTEM-52 has also been documented in E. coli from pets (Costa et al. 2004), food-producing animals (Brinas et al. 2005) and recently also in wild birds and game in Portugal (Costa et al. 2008; Poeta et al. 2008).

In central Europe, we can observe a widespread occurrence of antimicrobial resistance in E. coli isolates from wildlife. We suppose similarly as do Skurnik et al. (2006) that antimicrobial resistance found in E. coli from wild mammals is anthropogenic. Among wild mammals, the wild boar plays an important role in the circulation of resistant E. coli isolates including isolates with integrons and ESBL production. The wild boar can be considered an important reservoir and vector of these strains in the environment.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

We are grateful to K. Dibdakova, L. Hanusova, N. Horakova, L. Chudobova, F. Kupka, T. Najer, J. Mikulska, S. Ondrus, P. Slamova, M. Slavikova and E. Suchanova for their assistance in the field and/or in the laboratory. This study was funded by Grant No. MSM6215712402 of the Ministry of Education, Youth and Sports of the Czech Republic. Capture, euthanasia and examination of small terrestrial mammals were approved by the Ethical Commission of the Ministry of Education, Youth and Sports of the Czech Republic.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  • Bergenholtz, R.D., Jorgensen, M.S., Hansen, L.H., Jensen, L.B. and Hasman, H. (2009) Characterization of genetic determinants of extended-spectrum cephalosporinases (ESCs) in Escherichia isolates from Danish and imported poultry meat. J Antimicrob Chemother 64, 207209.
  • Blanco, G., Lemus, J.A., Grande, J., Gangoso, L., Grande, J.M., Donazar, J.A., Arroyo, B., Frias, O. et al. (2007) Geographical variation in cloacal microflora and bacterial antibiotic resistance in a threatened avian scavenger in relation to diet and livestock farming practices. Environ Microbiol 9, 17381749.
  • Brinas, L., Zarazaga, M., Saenz, Y., Ruiz-Larrea, F. and Torres, C. (2002) β-lactamases in ampicillin-resistant Escherichia coli isolates from foods, humans, and healthy animals. Antimicrob Agents Chemother 46, 31563160.
  • Brinas, L., Moreno, M.A. and Teshager, T. (2005) Monitoring and characterization of extended-spectrum beta-lactamases in Escherichia coli strains from healthy and sick animals in Spain in 2003. Antimicrob Agents Chemother 49, 12621264.
  • Caprioli, A., Donelli, G., Falbo, V., Passi, C., Pagano, A. and Mantovani, A. (1991) Antimicrobial resistance and production of toxins in Escherichia coli strains from wild ruminants and the alpine marmot. J Wildl Dis 27, 324327.
  • Carattoli, A., Bertini, A., Villa, L., Falbo, V., Hopkins, K.L. and Threlfall, E.J. (2005) Identification of plasmids by PCR-based replicon typing. J Microbiol Methods 63, 219228.
  • Caroff, N., Espaze, E., Berard, I., Richet, H. and Reynaud, A. (1999) Mutations in the ampC promoter of Escherichia coli isolates resistant to oxyiminocephalosporins without extended spectrum beta-lactamase production. FEMS Microbiol Lett 173, 459465.
  • Center for Disease Control and Prevention (2004) Standardized Molecular Subtyping of Foodborne Bacterial Pathogens by Pulsed-Field Gel Electrophoresis. Atlanta, GA: The National Molecular Network for Foodborne Disease Surveillance CDCP.
  • Chopra, I. and Roberts, M. (2001) Tetracyclin antibiotics: Mode of action, applications, molecular biology, and epidemiology of bacterial resisdance. Microbiol Mol Biol Rev 65, 232260.
  • Clermont, O., Bonacorsi, S. and Bingen, E. (2000) Rapid and simple determination of Escherichia coli phylogenetic group. Appl Environ Microbiol 66, 45554558.
  • Clinical and Laboratory Standards Institute (2008a) Performance Standards for Antimicrobial Susceptibility Testing; 8th Informational Supplement. Wayne, PA: CLSI.
  • Clinical and Laboratory Standards Institute (2008b) Performance Standards for Antimicrobial Disc and Dilution Susceptibility Tests for Bacteria Isolated From Animals; Approved Standard 3rd Edition. Wayne, PA: CLSI.
  • Cloud-Hansen, K.A., Villiard, K.M., Handelsman, J. and Carey, H.V. (2007) Thirteen-lined ground squirrels (Spermophilus tridecemlineatus) harbor multiantibiotic-resistant bacteria. J Am Assoc Lab Anim Sci 46, 1720.
  • Costa, D., Poeta, P., Brinas, L., Saenz, Y., Rodrigues, J. and Torres, C. (2004) Detection of CTX-M-1 and TEM-52 beta-lactamases in Escherichia coli strains from healthy pets in Portugal. J Antimicrob Chemother 54, 960961.
  • Costa, D., Poeta, P., Saenz, Y., Vinue, L., Rojo-Bezares, B., Jouini, A., Zarazaga, M., Rodrigues, J. et al. (2006) Detection of Escherichia coli harbouring extended-spectrum β-lactamases of the CTX-M, TEM and SHV classes in faecal samples of wild animals in Portugal. J Antimicrob Chemother 58, 13111312.
  • Costa, D., Poeta, P., Saenz, Y., Vinue, L., Coelho, A.C., Matos, M., Rojo-Bezares, B., Rodrigues, J. et al. (2008) Mechanisms of antibiotic resistance in Escherichia coli recovered from wild animals. Microb Drug Resist 14, 7177.
  • Dolejska, M., Cizek, A. and Literak, I. (2007) High prevalence of antimicrobial-resistant genes and integrons in Escherichia coli isolates from black-headed gulls in the Czech Republic. J Appl Microbiol 103, 1119.
  • Dolejska, M., Senk, D., Cizek, A., Rybarikova, J., Sychra, O. and Literak, I. (2008) Antimicrobial resistant Escherichia coli isolates in cattle and house sparrows on two Czech dairy farms. Res Vet Sci 85, 491494.
  • Dolejska, M., Bierosova, B., Kohoutova, L., Literak, I. and Cizek, A. (2009) Antibiotic-resistant Salmonella and Escherichia coli isolates with integrons and extended-spectrum beta-lactamases in surface water and sympatric black-headed gulls. J Appl Microbiol, 106, 19411950.
  • Faldynova, M., Pravcova, M., Sisak, F., Havlickova, H., Kolackova, I., Cizek, A., Karpiskova, R. and Rychlik, I. (2003) Evolution of antibiotic resistance in Salmonella enterica serovar Typhimurium strains isolated in Czech Republic between 1984 and 2002. Antimicrob Agents Chemother 47, 20022005.
  • Frana, T.S., Carlson, S.A. and Griffith, R.W. (2001) Relative and conservation of genes encoding aminoglycoside-modifying enzymes in Salmonella enterica serotype Typhimurium phage type DT104. Appl Environ Microbiol 67, 445448.
  • Gibreel, A. and Skold, O. (1998) High-level resistance to trimethoprim in clinical isolates of Campylobacter jejuni by acquisition of foreign genes (dfr1 and dfr9) expressing drug-intensive dihydrofolate reductases. Antimicrob Agents Chemother 42, 30593064.
  • Gilliver, M.A., Bennett, M., Begon, M., Hazel, S.M. and Hart, C.A. (1999) Antibiotic resistance found in wild rodents. Nature 401, 233234.
  • Girlich, D., Poirel, L., Carattoli, A., Kempf, I., Lartigue, M.F., Bertini, A. and Nordmann, P. (2007) Extended-spectrum beta-lactamase CTX-M-1 in Escherichia coli isolates from healthy poultry in France. Appl Environ Microbiol 73, 46814685.
  • Graves, S.R., Kennely-Merrit, S.A., Tidemann, C.R., Rawlinson, P.A., Harvey, K.J. and Thorton, I.W.B. (1988) Antibiotic resistance patterns of enteric bacteria of wild mammals on the Krakatau Islands and West Java, Indonesia. Philos Trans R Soc Lond B Biol Sci 322, 339353.
  • Guerra, B., Soto, S.M., Arguelles, J.M. and Mendoza, M.C. (2001) Multidrug resistance is mediated by large plasmids carrying a class 1 integron in the emergent Salmonella enterica serotype [4,5,12:i–]. Antimicrob Agents Chemother 45, 13051308.
  • Guerra, B., Junker, E., Miko, A., Helmuth, R. and Mendoza, M.C. (2004) Characterization and localization of drug resistance determinants in multidrug-resistant, integron-carrying Salmonella enterica serotype Typhimurium strains. Microb Drug Resist 10, 8391.
  • Hasman, H., Mevius, D., Veldman, K., Olesen, I. and Aarestrup, F.M. (2005) Beta-lactamases among extended-spectrum beta-lactamase (ESBL)-resistant Salmonella from poultry, poultry products and human patients in The Netherlands. J Antimicrob Chemother 56, 115121.
  • Herre, W. (1986) Sus scrofa– Wildschwein. In Handbuch der Saugetiere Europas. Band2/II Paarhufer – Artiodactyla (Suidae, Cervidae, Bovidae) ed. Niethammer, J. and Krapp, F. pp. 3666. Wiesbaden, Germany: AULA-Verlag.
  • Kinjo, T., Minamoto, N., Sugiyama, M. and Sugiyama, Y. (1992) Comparison of antimicrobial resistant Escherichia coli in wild and captive Japanese serows. J Vet Med Sci 54, 821827.
  • Kozak, G.K., Boerlin, P., Janecko, N., Reid-Smith, R.J. and Jardine, C. (2009) Antimicrobial resistance in Escherichia coli isolates from swine and wild small mammals in the proximity of swine farms and in natural environments in Ontario, Canada. Appl Environ Microbiol 75, 559566.
  • Levesque, C., Piche, L., Larose, C.L. and Roy, P.H. (1995) PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrob Agents Chemother 29, 185191.
  • Lillehaug, A., Bergsjo, B., Schau, J., Bruheim, T., Vikoren, T. and Handeland, K. (2005) Campylobacter spp., Salmonella spp., verocytogenic Escherichia coli, and antibiotic resistance in indicator organisms in wild cervids. Acta Vet Scand 46, 2332.
  • Literak, I., Vanko, R., Dolejska, M., Cizek, A. and Karpiskova, R. (2007) Antibiotic resistant Escherichia coli and Salmonella in Russian rooks (Corvus frugilegus) wintering in the Czech Republic. Lett Appl Microbiol 45, 616625.
  • Literak, I., Dolejska, M., Rybarikova, J., Cizek, A., Strejckova, P., Vyskocilova, M., Friedman, M. and Klimes, J. (2009) Highly variable patterns of antimicrobial resistance in commensal Escherichia coli isolates from pigs, rodents and flies. Microb Drug Resist 15, 229234.
  • Livermore, D.M., Warner, M., Hall, L.M.C., Enne, V.I., Projan, S.J., Dunman, P.M., Wooster, S.L. and Harrison, G. (2001) Antibiotic resistance in bacteria from magpies (Pica pica) and rabbits (Oryctolagus cuniculus) from west Wales. Environ Microbiol 3, 658661.
  • Meunier, D., Jouy, E., Lazizzera, C., Kobisch, M. and Madec, J.Y. (2006) CTX-M-1 and CTX-M-15-type beta-lactamases in clinical Escherichia coli isolates recovered from food-producing animals in France. Int J Antimicrob Agents 28, 402407.
  • Ng, L.K., Mulvey, M.R., Martin, I., Peters, G.A. and Johnson, W. (1999) Genetic characterization of antimicrobial resistance in Canadian isolates of Salmonella serovar typhimurium DT104. Antimicrob Agents Chemother 43, 30183021.
  • Novais, A., Canton, R., Moreira, R., Peixe, L., Baquero, F. and Coque, T.M. (2007) Emergence and dissemination of Enterobacteriaceae isolates producing CTX-M-1-like enzymes in Spain are associated with IncFII (CTX-M-15) and broad-host-range (CTX-M-1, -3, and -32) plasmids. Antimicrob Agents Chemother 51, 796799.
  • Olesen, I., Hasman, H. and Aarestrup, F.M. (2004) Prevalence of beta-lactamases among ampicillin-resistant Escherichia coli and Salmonella isolated from food animals in Denmark. Microb Drug Resist 10, 334340.
  • Osterblad, M., Norrdahl, K., Korpimaki, E. and Huovinen, P. (2001) Antibiotic resistance. How wild are wild mammals? Nature 409, 3738.
  • Perreten, V. and Boerlin, P. (2003) A new sulfonamide resistance gene (sul3) in Escherichia coli is widespread in pig population of Switzerland. Antimicrob Agents Chemother 47, 11691172.
  • Poeta, P., Radhouani, H., Igrejas, G., Goncalves, A., Carvalho, C., Rodrigues, J., Vinue, L., Somalo, S. et al. (2008) Seagulls of the Berlengas natural reserve of Portugal as carriers of fecal Escherichia coli harboring CTX-M and TEM extended-spectrum beta-lactamases. Appl Environ Microbiol 74, 74397441.
  • Rolland, R.M., Hausfater, G., Marshall, B. and Levy, S.B. (1985) Antibiotic resistant bacteria in wild primates: increased prevalence in baboons feeding on human refuse. Appl Environ Microbiol 49, 791794.
  • Routman, E., Miller, R.D., Phillips-Conroy, J. and Hartl, D.L. (1985) Antibiotic resistance and population structure in Escherichia coli from free-ranging African yellow baboons. Appl Environ Microbiol 50, 749754.
  • Saenz, Y., Brinas, L., Dominguez, E., Ruiz, J., Zarazaga, M., Vila, J. and Torres, C. (2004) Mechanisms of resistance in multiple-antibiotic-resistant Escherichia coli strains of human, animal, and food origin. Antimicrob Agents Chemother 48, 39964001.
  • Schierack, P., Romer, A., Jores, J., Kaspar, H., Guenther, S., Filter, M., Eichberg, J. and Wieler, L.H. (2009) Isolation and characterization of intestinal Escherichia coli clones from wild boars in Germany. Appl Environ Microbiol 75, 695702.
  • Sherley, M., Gordon, D.M. and Collignon, P.J. (2000) Variations in antibiotic resistance profile in Enterobacteriaceae isolated from wild Australian mammals. Environ Microbiol 2, 620631.
  • Skurnik, D., Ruimy, R., Andremont, A., Amorin, C., Rouquet, P., Picard, B. and Denamur, E. (2006) Effect of human vicinity on antimicrobial resistance and integrons in animal faecal Escherichia coli. J Antimicrob Chemother 57, 12151219.
  • Sunde, M. (2005) Class I integron with a group II intron detected in an Escherichia coli strain from a free-range reindeer. Antimicrob Agents Chemother 49, 25122514.
  • Swiecicka, I., Buczek, J. and Iwaniuk, A. (2003) Analysis of genetic relationships and antimicrobial susceptibility of Escherichia coli isolated from Clethrionomys glareolus. J Gen Appl Microbiol 49, 315320.
  • Tenover, F.C., Arbeit, R.D., Goering, R.V., Mickelsen, P.A., Murray, B.E., Persing, D.H. and Swaminathan, B. (1995) Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol 3, 22332239.
  • Thomson, K.S. and Sanders, C.C. (1992) Detection of extended-spectrum beta-lactamases in members of the family Enterobacteriaceae: comparison of the double-disk and three-dimensional tests. Antimicrob Agents Chemother 36, 18771882.
  • White, D.G. (2006) Antimicrobial resistance in pathogenic Escherichia coli from animals. In Antimicrobial Resistance in Bacteria of Animal Origin ed. Aarestrup, F.M. pp. 145166. Washington, DC: ASM Press.
  • White, P.A., McIver, C.J. and Rawlinson, W.D. (2001) Integrons and gene cassettes in the Enterobacteriaceae. Antimicrob Agents Chemother 45, 26582661.
  • Wu, S., Chouliara, E., Hasman, H., Dalsgaard, A., Vieira, A. and Jensen, L.B. (2008) Detection of a single isolate of CTX-M-1-producing Escherichia coli from healthy pigs in Denmark. J Antimicrob Chemother 61, 747749.
  • Yates, C.M., Brown, D.J., Edwards, G.F. and Amyes, S.G. (2004) Detection of TEM-52 in Salmonella enterica serovar Enteritidis isolated in Scotland. J Antimicrob Chemother 53, 407408.
  • Zhao, S., White, D.G., Ge, B., Ayers, S., Friedman, S., English, L., Wagner, D., Gainers, S. et al. (2001) Identification and characterization of integron-mediated antibiotic resistance among shiga toxin-producing Escherichia coli isolates. Appl Environ Microbiol 67, 15581564.