SEARCH

SEARCH BY CITATION

Keywords:

  • Bois noir;
  • nucleotide sequencing;
  • PCR/RFLP;
  • tuf gene;
  • virtual digestion;
  • Vitis vinifera

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Aim:  Evaluation of the genetic variability of stolbur phytoplasma infecting grapevines, bindweeds and vegetables, collected in different central and southern Italian regions.

Materials and Results:  Phytoplasma isolates belonging to stolbur subgroup 16SrXII-A were subjected to molecular characterization by polymerase chain reaction/restriction fragment length polymorphism (PCR/RFLP), to investigate two different nonribosomal genes: tuf and vmp1. In grapevines, 32% of samples were infected by tuf-a type and 68% by tuf-b type, with different relative incidences in the regions surveyed. All herbaceous samples (bindweeds, tomato, tobacco, pepper, celery) were infected by tuf-b. The gene vmp1 showed higher polymorphism in grapevines (nine profiles) than herbaceous plants (six) by RFLP analysis, in agreement with nucleotide sequences’ analysis and virtual digestions.

Conclusions:  The phylogenetic analysis of vmp1 gene sequences supports the RFLP data and demonstrates the accuracy of RFLP for preliminary assessments of genetic diversity of stolbur phytoplasmas and for screening different vmp types.

Significance and Impact of the Study:  Stolbur represents a serious phytosanitary problem in the areas under investigation, owing to heavy economic losses in infected grapevines and vegetables. Molecular information about the complex genotyping of the vmp1 gene provides useful data towards a better understanding of stolbur epidemiology. Moreover, this study clarifies some different vmp1 genotype classifications of stolbur, providing molecular data in comparison with previous investigations.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Phytoplasmas are prokaryotic organisms that belong to the class Mollicutes, which are restricted to the phloem elements of plants and are transmitted by sap-sucking insects (Lee et al. 2000; Weintraub and Beanland 2006). Among phytoplasmas, those classified in the 16SrXII-A subgroup and associated with stolbur disease can cause severe production losses in grapevines and important vegetable crops. In grapevines (Vitis vinifera L.), stolbur phytoplasma is the agent of Bois noir (BN), a disease that is considered less epidemic than Flavescence dorée (FD), but which is showing increasing spread in several countries in the Mediterranean areas (Maixner 2006; Botti and Bertaccini 2007). Solanaceae (tomato, potato and pepper) and Apiaceae (e.g. celery) can be seriously damaged by stolbur (Carraro et al. 2008; Navratil et al. 2009). A key role in the spread of stolbur involves the polyphagy of the cixiid planthopper Hyalesthes obsoletus Signoret (Suchov and Vovk 1948; Fos et al. 1992; Maixner 1994; Sforza et al. 1998), which can transmit the phytoplasma to a wide range of wild plants, which can often be found along the borders of vegetable plots or in and around vineyards (Marcone et al. 1997; Borgo et al. 2008; Romanazzi et al. 2009a).

The complex interactions of stolbur phytoplasma with wild and cultivated annual and perennial host plants and insect vectors in different ecosystems might be responsible for generating genetic and phenotypic diversity, as it has been shown by variable symptoms recorded in periwinkle inoculated with different stolbur isolates (Marcone et al. 1999). The genetic diversity of stolbur has also been evaluated by considering different genes and molecular approaches. Using single-strand conformation polymorphism analysis, Seruga Music et al. (2008) showed polymorphism in the 16SrRNA gene, which was generally considered to be a conserved region. Using nucleotide sequence analysis and virtual digestion, Quaglino et al. (2009) detected distinct single nucleotide polymorphism lineages, which indicated a high degree of genetic heterogeneity within the stolbur population. Polymerase chain reaction/Restriction fragment length polymorphism analysis (PCR/RFLP) of the tuf gene, which encodes elongation factor Tu (EF-Tu), has revealed three variants, the tuf-a, tuf-b and tuf-c types, that show strong correlations with the herbaceous hosts Urtica dioica, Convolvolus arvensis and Calystegia sepium, respectively (Langer and Maixner 2004). A different geographical distribution of tuf types has been recorded in various Italian regions, as reported in several studies (Pasquini et al. 2007; Quaglino et al. 2007; Romanazzi and Murolo 2008).

The evidence for genetic diversity of stolbur increased considerably when the vmp1 gene, which encodes a putative membrane protein, was analysed by PCR/RFLP (Cimerman et al. 2009; Pacifico et al. 2009). A wide molecular characterization of stolbur based on this gene was carried out in the framework of the European project ‘Global epidemiology of phytoplasma diseases of economical importance in south-eastern Europe’ (SEE-ERA.NET, http://www.phytoplasma.eu), whereby at least 21 genotypes were identified based on RFLPs of vmp1. It is not yet known whether all of these genetic variants have the same or different host ranges and epidemiology. Such variability might result from exposure of VMP1 at the cell surface and the possibility that it has a role in host–phytoplasma interactions. Indeed, the genes encoding surface proteins such as AMP show greater variability than the rest of the genome (Suzuki et al. 2006), and they might therefore represent suitable markers for molecular epidemiology.

The aim of this study was to investigate the vmp1 genetic variability of stolbur phytoplasma isolates infecting grapevines, bindweeds and vegetables and to assess the possible relationships among the genetic diversity marker (vmp1), host specificity and geographical distribution. Moreover, we provide a comparison across the RFLP profiles of the vmp1 PCR products that have been obtained during surveys carried out in different Italian regions.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Phytoplasma sources

Field surveys were carried out from the late summer of 2004 until 2009, in vineyards in central-eastern (Marche and the Abruzzi) and southern (Campania and Basilicata) Italy and in Sardinia. In these regions, 55, 62, 12, 25 and 13 leaf samples, respectively, were collected from BN-infected grapevines of different cultivars. In the vineyards, we also collected 20 samples from bindweed (C. arvensis), which represents one of the predominant herbaceous weeds in the vineyard ecosystem and which showed typical symptoms of stunting, leaf reduction and partial discoloration of the leaf veins. We also collected 40 leaf samples from vegetables (tobacco, tomato, pepper and celery) in the main horticultural areas of Basilicata, Campania and Sardinia.

Total DNA extraction, phytoplasma detection and identification

Molecular analyses were performed by extracting total DNA from 1 g of the grapevine leaf veins, and from the leaves and petioles of the bindweeds and vegetables, using DNeasy Plant Mini-kits (Qiagen, Hilden, Germany). The extracted DNA used as the template for PCR analysis was first diluted to 25 ng μl−1 with sterile deionized water. Amplifications were performed in a final reaction volume of 50 μl, containing 50 ng DNA template, 0·2 μmol l−1 of each primer, 200 μmol l−1 of each dNTP (Promega, Madison, WI, USA), 1 U Taq DNA polymerase (Promega) and the standard 1× PCR buffer with 1·5 mmol l−1 MgCl2. PCR was performed for 35 cycles in a programmable Bio-Rad Icycler (Bio-Rad, Hercules, CA, USA), using the universal phytoplasma rRNA primer pair P1 (Deng and Hiruki 1991) and P7 (Smart et al. 1996), which can amplify almost the entire 16S rRNA gene, the 16-23S rRNA spacer region, and the 5′-end of the 23S rRNA gene. One microlitre of 1 : 20 diluted PCR product was used as template in a second round of PCR with the group-specific ribosomal primer pairs R16(I)F1/R1, R16(III)F2/R1 and R16(V)F1/R1, according to the conditions described by Lee et al. (1994). EY1 (‘Candidatus Phytoplasma ulmi’, subgroup 16SrV-A), STOL (stolbur, subgroup 16SrXII-A) and AY1 (‘Ca. Phytoplasma asteris’, subgroup 16SrI-B) were kindly provided by Prof P.A. Bianco (University of Milan, Italy) and were used as reference strains. Samples from the healthy plants were used as negative controls. Ten microlitres of each PCR product was analysed by electrophoresis through 1% agarose (Sigma-Aldrich, St Louis, MO, USA) gels, with 1× TAE (40 mmol l−1 Tris-acetate, 1 mmol l−1 EDTA, pH 8·0) as running buffer. The gels were stained with ethidium bromide (0·5 μg ml−1), visualized under UV light at 312 nm using a trans-illuminator, and imaged with the Gel Doc™ XR imaging system (Bio-Rad). The expected lengths of the amplified DNA fragments were estimated by comparisons with a 100-bp DNA ladder (New England BioLabs, Beverly, MA, USA). The samples that provided an amplicon with R16(I)F1/R1 were digested with 2·5 U of endonuclease MseI (New England BioLabs) at 37°C for 4 h, to verify that the isolates belonged to the 16SrXII-A subgroup. Digestions were separated by electrophoresis through 8% nondenaturing polyacrylamide gels using 1× TBE (90 mmol l−1 Tris-borate, 2 mmol l−1 EDTA, pH 8·3) as running buffer. The products in the gels were resolved and recorded as described previously.

Molecular characterization of stolbur isolates

All of the phytoplasma isolates that belonged to the 16SrXII-A subgroup were subjected to further molecular characterization, to investigate two different nonribosomal genes: tuf and vmp1.

The tuf gene was amplified using the primers Tuf1f/r and then in nested PCR by the primer pair TufAyf/r, and genetic variability was evaluated by cleaved amplified polymorphism analysis (Langer and Maixner 2004). The amplicons were digested with 2·5 U of endonuclease HpaII (New England BioLabs) and incubated at 37°C for 4 h. The products in the gels were resolved and recorded as described previously.

The complete vmp1 gene was amplified in nested PCR with the primer pair StolH10F1 (5′AGGTTGTAAAATCTTTTATGT3′) and StolH10R1 (5′GCGGATGGCTTTTCATTATTTGAC3′) (Cimerman et al. 2009), which can overlap the start and stop codons of the gene, respectively, followed by the inner primer pair TYPH10F (5′AACGTTCATCAACAATCAGTC3′) and TYPH10R (5′CACTTCTTTCAGGCAACTTC3′) (Fialováet al. 2009). The PCR was performed in a programmable Bio-Rad Icycler (Bio-Rad) as follows: a predenaturation cycle at 94°C for 4 min, 35 cycles of a denaturation step at 94°C for 30 s, an annealing step at 52°C for 30 s, an extension step at 72°C for 2 min and finally an extra-extension step for 7 min. For nested PCR, the inner primer pair annealing temperature was set at 55°C, with the other parameters unchanged. The amplicons StolH10F1/R1 were also used as the template in the nested PCR with the internal primer pair H10F2/R2, according to the PCR conditions described by Pacifico et al. (2009).

The products of both of the nested PCRs were verified by electrophoresis through 1·2% agarose gel, and then an aliquot was digested with 2·5 U RsaI restriction enzyme (New England BioLabs) at 37°C, according to the manufacturer instructions. The digested products amplified from grapevine, bindweed and vegetable samples (see Tables 1 and 2) were analysed by electrophoresis on 2·5% agarose gels that were resolved and recorded as described earlier, with a 100-bp DNA ladder (New England Biolabs) used as the marker. Moreover, the picture captured by the Gel Doc™ XR imaging system (Bio-Rad) was analysed, and each band of the RFLP profiles was resolved by estimating the molarity using the QuantityOne® software (Bio-Rad).

Table 1.   The grapevine samples analysed by molecular tools in this study
IDVarietyRegionProvinceYear of collection
Ach2/Ach3/Ach4ChardonnayAbruzziChieti2007
Aa12/Aa13/Aa14/Aa15ChardonnayAbruzziChieti2006
Ate13/Ate14ChardonnayAbruzziTeramo2005
Ab1/Ag4a/Av3ChardonnayAbruzziTeramo2007
B49/B51ChardonnayBasilicataPotenza2008
Mch1/Mch2/Mch3ChardonnayMarcheAncona2008
Mch21/Mch22/Mch23/Mch25/Mch26/Mch27ChardonnayMarcheAscoli P.2009
Aaq10/Aaq11/Aaq12/Aaq15/Aaq19/Aaq22/Aaq24/Aaq25/Aaq26/Aaq27/Aaq28/Aaq29/Aaq30/Aaq33/Aaq35/Aaq36/Aaq37/Aaq38/Aaq39MontepulcianoAbruzziL’Aquila2006
Ape17MontepulcianoAbruzziL’Aquila2004
Ate1/Ate6/Ate7/Ate8MontepulcianoAbruzziTeramo2005
Aa16/Aa17/Aa19/Aa21/Aa22/Aa24/Aa25/Aa26/Aa27MontepulcianoAbruzziPescara2006
Mri10MontepulcianoMarcheAscoli P.2004
Mca21/Mca26/Mca27/Mca28/Mca29/Mca31/Mca32/Mur1/Mur2/MontepulcianoMarcheAncona2006
Mmp1MontepulcianoMarcheAncona2008
Mmp10/Mmp11/Mmp12/Mmp13MontepulcianoMarcheAscoli P.2009
B1844SangioveseBasilicataPotenza2006
Mc12/Mdx sainSangioveseMarcheAncona2008
Ate3/Ate4/Ate5GarganegaAbruzziTeramo2005
B4/B5/B7Trebbiano toscanoBasilicataPotenza2007
B8Trebbiano toscanoBasilicataPotenza2008
C1Trebbiano toscanoCampaniaSalerno2008
C3/C6Trebbiano toscanoCampaniaSalerno2007
B2035/B2118/B2120BarberaBasilicataPotenza2008
B2037/B2121BarberaBasilicataPotenza2006
B2119BarberaBasilicataPotenza2007
C1813FalanghinaCampaniaAvellino2008
C1814FalanghinaCampaniaBenevento2007
C1862FalanghinaCampaniaBenevento2008
Mfal/Mfa2FalanghinaMarcheAncona2008
Mver cer1/Mver cer2Vernaccia cerretanaMarcheAncona2008
Mp46/Mp47MorettoneMarcheFermo2006
S13/S14NuragusSardiniaCagliari2009
Mpr1PrimitivoMarcheAncona2008
Mp43PrimitivoMarcheFermo2006
Ape2Pinot neroAbruzziPescara2004
Mim1Incr. BruniMarcheFermo2008
Mp49Incr. BruniMarcheFermo2006
Ate17CococciolaAbruzziTeramo2005
Mp39Egiodola ismaMarcheFermo2006
Mp41Refosco prMarcheFermo2006
Mp42Tocai rossoMarcheFermo2006
Mp45BalsaminaMarcheFermo2006
Mfi1Fiano biancoMarcheFermo2004
Mp4, Mp7GaglioppoMarcheFermo2004
McilCiliegioloMarcheAncona2008
Mag1AglianicoMarcheAncona2008
Aaq1/Aaq3/Aaq4UnknownAbruzziL’Aquila2007
Ate1/Ate2UnknownAbruzziTeramo2007
Mn2UnknownMarcheAncona2008
Table 2.   The bindweed and vegetable samples analysed by molecular tools in this study
IDSpeciesRegionProvinceYear of collection
Aconv1-2BindweedAbruzziL’Aquila2006
B1103BindweedBasilicataPotenza2005
B2407/B2417/B2418BindweedBasilicataPotenza2008
B1098BindweedBasilicataPotenza2007
C1096-1097BindweedCampaniaCaserta2007
B1099/B1100/B1535/B1536/B1537/B1538/B1789/B1791/B1792TomatoBasilicataPotenza2007
B2078/B2206/B2207TomatoBasilicataPotenza2008
S5/S6TomatoSardiniaOristano2005
C1196/C1197/C1211/C1214TobaccoCampaniaSalerno2007
C1215/C1216TobaccoCampaniaCaserta2008
C1217TobaccoCampaniaCaserta2008
C1516/C1517PepperCampaniaSalerno2007
B1882/B1937PepperBasilicataPotenza2008
S1/S2CelerySardiniaOristano2005

Sequencing, virtual digestion and phylogenetic relationships based on the vmp1 gene

Sequence analysis was carried out on amplicons generated by the primer pair TYPH10F/TYPH10R. For each geographical region, one stolbur isolate was generally chosen to be a representative of the nine profiles (from A and I). According to this criterium, 20 amplicons were purified through the Wizard SV Gel and PCR Clean-Up kit (Promega), and then quantified using a Versa Fluor™ Fluorimeter (Bio-Rad). These were then sequenced in both directions (forward/reverse) using an ABI 3730 × l DNA sequencer (Applied Biosystems, Carlsbad, California) at the BMR Genomics sequencing service (BMR Genomics, University of Padova, Padova, Italy, http://www.bmr-genomics.it). The forward and reverse nucleotide sequences were read and edited using the Chromas ver. 2.33 software and were assembled using the GAP4 Staden Package (http://www.staden.sourceforge.net/), to obtain a consensus sequence. We used the bioedit software, ver. 7.0.0 (http://www.mbio.ncsu.edu/Bioedit/bioedit.html) to cut-off c. 20–30 bp of the terminal end sequence. To verify the accuracy in the determination and recognition of the different RFLP pattern types obtained in the PCR/RFLP analysis, the pDRAW32 software, ver. 1.1.101 (AcaClone software, http://www.acaclone.com), was used for virtual digestion with the RsaI endonuclease of the 20 nucleotide consensus sequences. The nucleotide sequences have been submitted to the NCBI database under the accession numbers given in Table 5.

Table 5.   The stolbur sequences used in the phylogenetic analysis in this study
IsolateHostCountry, regionNCBI accession no.
CH-1GrapevineItalyAM992105
Charente-1Hyalesthes obsoletusFranceAM992098
GGYGrapevineGermanyAM992102
LGTomatoFranceAM992097
MolierePrunus mahalebFranceAM992096
P7PeriwinkleLebanonAM992100
POH. obsoletusFranceAM992095
STOLPepperSerbiaAM992103
T2_92TomatoItalyAM992106
19-25GrapevineGermanyAM992101
400-05GrapevineItalyEF655660
T2_56TomatoItalyAM992104
Mca21GrapevineItaly, MarcheHM008599
B51GrapevineItaly, BasilicataHM008600
Aaq1GrapevineItaly, AbruzziHM008601
Aa16GrapevineItaly, AbruzziHM008602
C3GrapevineItaly, CampaniaHM008603
B49GrapevineItaly, BasilicataHM008604
Ag4aGrapevineItaly, AbruzziHM008605
Mp46GrapevineItaly, MarcheHM008606
Mp49GrapevineItaly, MarcheHM008607
B7GrapevineItaly, BasilicataHM008608
Mca28GrapevineItaly, MarcheHM008609
C1GrapevineItaly, CampaniaHM008610
B2035GrapevineItaly, BasilicataHM008611
Mvercer2GrapevineItaly, MarcheHM008612
Mag1GrapevineItaly, MarcheHM008613
Aa25GrapevineItaly, AbruzziHM008614
Mri10GrapevineItaly, MarcheHM008615
S13GrapevineItaly, SardiniaHM008616
B4GrapevineItaly, BasilicataHM008617
C6GrapevineItaly, CampaniaHM008618

The same bioinformatic software was used to obtain the in silico RFLP profiles of the stolbur isolates available in the NCBI database (Cimerman et al. 2009), starting from the H10F2/R2 amplicons. Nucleotide sequences compiled in FASTA format were aligned using ClustalX (ver. 1.83) (Thompson et al. 1997). mega3 (http://www.megasoftware.net/index.html) (Kumar et al. 2004) was used to calculate the phylogenetic relationships among the RFLP types according to the neighbour-joining method (Saitou and Nei 1987), with 1000 bootstrap replicates.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Phytoplasma detection

From the detection carried out on the 16S rDNA, among the 167 samples collected from grapevines, 150 showed amplification using the R16(I)F1/R1 primers, which are specific for phytoplasma belonging to the 16SrI and 16SrXII groups, and which yield a fragment of about 1050 bp. The ribosomal primer pairs R16(V)F1/R1, which is specific for phytoplasma belonging to the 16SrV, and R16(III)F1/R2, which is specific for the 16SrIII group, did not show amplification for any of the samples. Also, no amplification was seen for the healthy grapevines or the symptomless bindweeds and vegetables. On the basis of the MseI PCR/RFLP analysis, all of the samples showed the same pattern, which is characteristic of members of the stolbur 16SrXII-A subgroup. On the other hand, most of the herbaceous plants (48 of 60) showed direct amplification by the universal primer pair P1/P7, yielding a 1800-bp fragment, and none of the other samples were infected by stolbur, even following the nested PCR.

Molecular characterization of the tuf gene in stolbur isolates

An amplicon of about 940 bp was obtained in nested PCR from 143 infected grapevines, and from 48 of the bindweed and vegetable samples analysed. No PCR products were obtained from healthy control plants. PCR/RFLP analysis revealed the presence of tuf-a andtuf-b types in the BN-infected grapevines from the Abruzzi (in 33 and 27 samples, respectively), Marche (nine and 42 samples) and Campania (two and four samples). In Sardinia and Basilicata, all of the samples analysed were infected by the tuf-b type (8 and 18, respectively). All of the C. arvensis plants collected in the sampled vineyards, and all of the vegetables collected in Campania, Basilicata and Sardinia, which included tobacco, tomato, celery and pepper, were infected by the tuf-b type.

Molecular characterization of the vmp1 gene in isolates infecting grapevines and herbaceous hosts

A further molecular characterization of 191 samples amplified by the tuf primers (143 from grapevines and 48 from herbaceous hosts) was carried out for the nonribosomal gene vmp1, to investigate the genetic variability of the stolbur isolates. No amplification was obtained from healthy control plants. The nested PCR using the primer pair TYPH10F/R amplified specific amplicons from 122 of the 143 grapevine samples. Ten of these isolates showed an amplicon of c. 1700 bp, while in all of the other isolates showed amplification of a c. 1450-bp fragment (Fig. 1). The PCR/RFLP using RsaI gave nine different profiles V2, V3, V4, V5, V12, V14, V15 and V16 which are showed in Figs 2 and 3; their relationships according to the location of the plants and the infected species are summarized in Table 3.

image

Figure 1.  Representative amplicon sizes obtained with the primer pair StolH10F1/R1 and the nested primer pair TYPH10F/R. Lanes 1–5 and 9–12 showed an amplicon of c. 1450 bp, while lanes 6–8 show an amplicon of c. 1700 bp. M: Ladder, 1 kb (New England Biolabs).

Download figure to PowerPoint

image

Figure 2.  (a) ‘Wet’ and (b) virtual restriction fragment length polymorphism patterns of the representative vmp1 gene sequences amplified with the primer pair TYPH10F/R from the nine representative stolbur strains. M 100 bp: Ladder, 100 bp (New England Biolabs).

Download figure to PowerPoint

image

Figure 3.  Phylogenetic tree of the vmp1 gene sequences from the stolbur strains, constructed by the neighbour-joining method with 1000 bootstrap replicates. Right: The relationships between the polymerase chain reaction/restriction fragment length polymorphism patterns obtained by digestion of the amplicons with the endonuclease RsaI.

Download figure to PowerPoint

Table 3.   Geographical distribution of the restriction fragment length polymorphism types obtained by RsaI digestion of the vmp1 gene sequences in Bois noir-infected grapevines collected in the different Italian regions
Profiles according to Pacifico et al. 2009 and SEE-ERANETRegion
AbruzziMarcheCampaniaBasilicataSardiniaTotal
V2001023
V331840043
V4080109
V5020002
V125401010
V14112003034
V15601209
V16120508
V17010102
Mixed infection 1 (V4+V12) 1 (V4+V12)0002
Total55466132122

Digestion of the c. 1700-bp fragments of the BN-infected grapevines with RsaI only yielded the V12 profile, whereas eight different profiles were distinguishable from the amplicons of c. 1450 bp. The V3 and V5 were highly correlated (100%) with isolates characterized as the tuf-a type, which were found in the Abruzzi, Marche and Campania samples. The remaining profiles were associated with the tuf-b type, with V14 (in 34 samples) as the most prevalent, followed by V4, V12, V15 and V16 (in 8 to 10 samples each). Samples showing the V2 profile were detected sporadically in Campania and Sardinia, with V17 in Marche and Basilicata and V5 in Marche. The greatest number of RFLP profiles was recorded in Marche (V3, V4, V5, V12, V14, V16 and V17), followed by Basilicata (V4, V12, V14, V15, V16 and V17) and the Abruzzi (V3, V12, V14, V15, and V16). Two BN-infected isolates, one which originated from Marche (cv Montepulciano) and the other from the Abruzzi (unknown cultivar), showed complex profiles, which resulted from the combination of the two simple profiles V4 and V12.

In the herbaceous plants, amplification using primer pair TYPH10F/R yielded a specific amplicon in 36 of 48 samples of bindweeds and vegetable crops (tomato, pepper, celery and tobacco). After digestion of the specific PCR fragments of c. 1450 and 1700 bp, six of the nine RFLP patterns identified in the grapevine samples were found in these herbaceous plants (V2, V12, V14, V15 and V17) (Table 4). In particular, the V12 profile, which was strictly related to the digestion of the c. 1700- bp fragment, was the most common profile here (11 samples), and it was found in all of the herbaceous species except pepper. On the other hand, the less frequent profiles were V14 and V17 which were detected in pepper and tomato, V2 in tomato and celery, and V16 in bindweed and tobacco. The greatest ranges of different RFLP profiles were detected in tomato (V2, V12, V14, V15 and V17) and bindweed (V12, V14, V15 and V16). Two mixed infections were recorded in tobacco samples from Campania (V12 and V16) and one in bindweed collected in the Abruzzi (V12 and V15).

Table 4.   Restriction fragment length polymorphism types obtained by RsaI digestion of the vmp1 gene sequences of stolbur isolates infecting herbaceous hosts
Profiles according to Pacifico et al. 2009 and SEE-ERANETHerbaceous host
BindweedCeleryPepperTomatoTobaccoTotal
V2010203
V124104211
V14101204
V15202408
V16100034
V17001203
Mixed infection1 (V12+V15)0002 (V12+V16)3
Total92414736

The samples when amplified in nested PCR with primer pair H10F2/R2 allowed to get again two types of amplicons of c. 1600 and 2000 bp, respectively (data not shown). Even the digestion of these fragments corroborates the possibility to distinguish nine different profiles for grapevine samples and six for herbaceous ones.

In the phylogenetic analysis, 20 nucleotide sequences representative of the RFLP types and 12 that were available in GenBank, used as references, were analysed (Table 5). In the phylogenetic tree, the sequences generally clustered according to the typology of the RFLP patterns (Fig. 3). Three new isolate clusters were revealed by comparison with the clusters that have been described previously (Cimerman et al. 2009). The B4/C6, Mp49/B7 and C3/B49/Ag4a/Mp46 (V14 according to the unpublished SEE-ERANET nomenclature) phyla constitute clear monophyletic lineages that are supported by high bootstrap values. Some of the others, e.g. Aa25/Mri10, could be distinguished, but remained genetically close to their reference strain, e.g. 19–25. In contrast, a different RFLP pattern was obtained for Aa16 (V15), despite it being very similar to sequences that showed RFLP patterns of type V4. However, in most cases, isolates with the same RFLP pattern had very similar, if not identical, sequences. This was seen, for example, in the case of B51/MCa21/Maq1 and RFLP pattern V4.

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Amplification using universal primers P1 and P7 detected the phytoplasma infections directly only in the herbaceous host samples. The failure of direct PCR to detect phytoplasma in most of the grapevine samples might be because of the low phytoplasma titre, and consequently the nested PCR assays with group-specific primers were needed. However, among the different primer pairs used in this study, R16(I)F1/R1 showed the highest efficiency in priming the sequence, in comparison with the tufAYf/r and TYPH10f/r primers pairs.

To evaluate the stolbur phytoplasma genetic diversity, the tuf and vmp1 genes were considered. The stolbur isolates analysed here belonged to the tuf-a (32%) and tuf-b (68%) types. In particular, a comparable number of infections were identified for each tuf type in the Abruzzi vineyards, where symptomatic bindweeds were also collected. No symptomatic nettle was observed in these vineyards, even though tuf-a type infections were detected in the grapevines. On the other hand, in Marche, Sardinia and Basilicata, where there was a prevalence of the tuf-b type recorded, infected bindweed samples were also found. All of the samples from the herbaceous hosts revealed the same tuf profile, corresponding to the tuf-b type. In Germany, however, Langer and Maixner (2004) distinguished in C. sepium a further tuf type, the tuf-c type, which was not recorded in the present study.

Another gene, vmp1, was studied to explore the phytoplasma genetic diversity. The primer pair TYPH10F/R amplified a specific fragment in about 85% of the grapevine samples, with an amplification efficiency lower than that observed using the ribosomal primer pair. In the present study, two amplicon sizes were visualized in the agarose gels, of c. 1700 and 1450 bp. In contrast, Fialováet al. (2009) showed that all of their Czech isolates amplified with this same primer pair gave the same vmp1 amplicon size. In particular, the genetic variability was higher in our grapevine samples (nine profiles) than in our herbaceous samples (six). Most of polymorphism here arose from the shortest amplicon, which was represented by eight RFLP profiles, while only profile V12 was obtained from the longer amplicon. The amplicon of isolates Mvercer2 (HM008612), representative of V12 profile, was characterized by an insertion of about 249 nt (corresponding to 83 aa) which shared high homology with nucleotide sequences EF655660 and EF655659 (99%) and corresponding to a fragment of 2070 bp obtained using H10F2/R2 primer pair (Supporting information).

Pacifico et al. (2009) obtained higher variability amplifying amplicons of three different sizes and 12 different RFLP types, although this maybe justified by the larger number of samples that originated from various regions in Italy and France. If we consider the RFLP profiles identified in their Italian samples, similar numbers were recorded in the present study. However, north-western and central regions of Italy were explored in this previous survey (Pacifico et al. 2009), whereas except for Sardinia, we investigated the BN genetic diversity in other regions of central and southern Italy. As a different primer pair was used in the present study, to clarify whether the new RFLP profiles were really different, we also sequenced vmp1 amplicons from 20 stolbur isolates in both strands, and then the consensus sequences were virtually digested by RsaI using the pDraw32 software, which can calculate the sizes of the restriction fragments.

In analysing the geographical distributions of the RFLP types, V3 is the most abundant of the northern stolbur isolates (Pacifico et al. 2009), and we recorded it here also in central-eastern Italy (the Abruzzi, Marche) and sporadically in southern regions (Campania). V5 was only detected in the Marche region. V14 was detected mainly in the Abruzzi and Marche regions which are located on the Adriatic coast, opposite to Serbia and Macedonia where this genotype was first recorded (S. Krnjajic, personal communication in Fialováet al. 2009), which is also later found in the Czech Republic (Fialováet al. 2009). All of the herbaceous hosts, except for celery and tobacco, were infected with the V14 profile. The V12 profile that is well represented in Piedmont was mainly detected in samples from the Abruzzi and Marche, as well as in bindweed and tomato. In the present study, profile V4 was only found in grapevine samples, and these mainly came from Marche; this is a different situation to that seen in France, where V4 was detected in all of the regions sampled (Pacifico et al. 2009). The RFLP profile V17 has only been detected in northern Lebanon and in the Czech Republic (E. Choueiri, personal communication in Fialováet al. 2009), and this was identified in a few of our grapevine samples, as well as in pepper and tomato. Profiles V15 and V16, which have previously been identified in a few insect samples (SEE-ERA.NET), were detected in the present study in grapevines from the Abruzzi and the Basilicata regions, as well as in herbaceous hosts.

In both the grapevine and herbaceous samples, we sporadically detected mixed infections of BN strains here, as was also reported by Pacifico et al. (2009). These data lead us to hypothesize that the phytoplasma strains rarely co-infect the same host plant, as opposed to what has been reported for the Grapevine virus A population infecting grapevines (Murolo et al. 2008).

This important diversity of vmp1 is believed to be owing to strong positive selection exerted on this gene, potentially resulting from necessary adaptations of the phytoplasma to its complex and changing environment (Cimerman et al. 2009). It has been reported that H. obsoletus feeds preferentially on specific plant species in different geographical areas (Lessio et al. 2007). From this first evidence, it will be interesting to investigate how the different vmp1 genotypes can interact with the plant hosts (e.g. the symptom severity), with the vectors (e.g. the transmission efficiency) and the wild plants (e.g. the infection reservoir). Moreover, it is worth noting that this RFLP analysis supported by nucleotide sequencing and virtual digestion has allowed us to clarify the different stolbur genotypes and to set up a classification based on the vmp1 gene. Even the phylogenetic analysis supported the results obtained by RFLP, demonstrating the accuracy of this technique which proves to be a useful preliminary procedure for the estimation of genetic diversity and for screening of different vmp-types. An exception is seen in the V15 profile, for which the sequences split into two different parts of the phylogenetic tree. This behaviour was forecast by the slightly higher value of within the genetic diversity calculated among the sequences belong to V15 profile (data not shown).

The data obtained in the present study help us to better understand the epidemiology of BN of the grapevine, a disease for which currently there are no specific control measures (Romanazzi et al. 2009b). This will also promote further studies to relate these different profiles to the biological properties of this BN, to be able to draw up the strategies that are needed for its containment.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Work carried out within the project ‘Diagnosis and molecular characterization of plant pathogens’ funded by Marche Polytechnic University. We are grateful to Dr E. Bitocchi (Marche Polytechnic University) for helpful advice on the interpretation of our molecular data.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information
  • Borgo, M., Albanese, G., Quaglino, F., Casati, P., Ermacora, P., Ferretti, L., Ferrini, F., Filippin, L. et al. (2008) Role of other plants in the epidemiology of phytoplasmas associated to Flavescence dorée and Bois noir. Petria 18, 8486.
  • Botti, S. and Bertaccini, A. (2007) Grapevine yellows in northern Italy: molecular identification of Flavescence dorée phytoplasma strains and of Bois noir phytoplasmas. J Appl Microbiol 103, 23252330.
  • Carraro, L., Ferrini, F., Martini, M., Ermacora, P. and Loi, N. (2008) A serious epidemic of Stolbur on celery. J Plant Pathol 90, 131135.
  • Cimerman, A., Pacifico, D., Salar, P., Marzachi, C. and Foissac, X. (2009) Striking diversity of vmp1, a variable gene encoding a putative membrane protein of the stolbur phytoplasma. Appl Environ Microbiol 75, 29512957.
  • Deng, S. and Hiruki, C. (1991) Amplification of 16S rRNA genes from culturable and non-culturable mollicutes. J Microbiol Meth 14, 5361.
  • Fialová, R., Válová, P., Balakishiyeva, G., Danet, J.-L., Šafářová, D., Foissac, X. and Navrátil, M. (2009) Genetic variability of stolbur phytoplasma in annual crop and wild plant species in South Moravia (Czech Republic). J Plant Pathol 91, 411416.
  • Fos, A., Danet, J.L., Zreik, L., Garnier, M. and Bové, J.M. (1992) Use of a monoclonal antibody to detect the stolbur mycoplasma-like organism in plants and insects and to identify a vector in France. Plant Dis 76, 10921096.
  • Kumar, S., Tamura, K. and Nei, M. (2004) MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief Bioinform 5, 150163.
  • Langer, M. and Maixner, M. (2004) Molecular characterization of grapevine-yellows-associated phytoplasmas of the stolbur group, based on RFLP-analysis of non-ribosomal DNA. Vitis 43, 191200.
  • Lee, I.-M., Gundersen, D.E., Hammond, R.W. and Davis, R.E. (1994) Use of mycoplasma-like organisms (MLO) group-specific oligonucleotide primers for nested-PCR assays to detect mixed-MLO infections in a single host plant. Phytopathology 84, 559566.
  • Lee, I.-M., Davis, R.E. and Gundersen, D.E. (2000) Phytoplasma: phytopathogenic molicutes. Annu Rev Microbiol 54, 221255.
  • Lessio, F., Tedeschi, R. and Alma, A. (2007) Population dynamics, host plants and infection rate with Stolbur phytoplasma of Hyalesthes obsoletus Signoret in north-western Italy. J Plant Pathol 89, 97102.
  • Maixner, M. (1994) Transmission of German grapevine yellows (Vergilbungskrankheit) by the planthopper Hyalesthes obsoletus (Auchenorrhyncha: Cixiidae). Vitis 33, 103104.
  • Maixner, M. (2006) Grapevine yellows – Current developments and unsolved questions. 15th Meeting of the International Council for the Study of Virus and Virus-like Diseases of the Grapevine, Stellenbosch, South Africa, pp. 8688.
  • Marcone, C., Ragozzino, A. and Seemuller, E. (1997) Detection and identification of phytoplasmas in yellows-diseased weeds in Italy. Plant Pathol 46, 530537.
  • Marcone, C., Neimark, H., Ragozzino, A., Lauer, U. and Seemüller, E. (1999) Chromosome sizes of phytoplasmas composing major phylogenetic groups and subgroups. Phytopathology 89, 805810.
  • Murolo, S., Romanazzi, G., Rowhani, A., Minafra, A., La Notte, P., Branzanti, M.B. and Savino, V. (2008) Genetic variability and population structure of Grapevine virus A coat protein gene from naturally infected Italian vines. Eur J Plant Pathol 120, 137145.
  • Navratil, M., Valova, P., Fialova, R., Lauterer, P., Safarova, D. and Star, M. (2009) The incidence of stolbur disease and associated yield losses in vegetable crops in South Moravia (Czech Republic). Crop Sci 28, 898904.
  • Pacifico, D., Alma, A., Bagnoli, B., Foissac, X., Pasquini, G., Tessitori, M. and Marzachì, C. (2009) Characterization of Bois noir isolates by restriction fragment length polymorphism of a stolbur-specific putative membrane protein gene. Phytopathology 99, 711715.
  • Pasquini, G., Ferretti, L., Gentili, A., Bagnoli, B., Cavalieri, V. and Barba, M. (2007) Molecular characterization of stolbur isolates collected in grapevines, weeds and insects in central and southern Italy. Bull Insectology 60, 355356.
  • Quaglino, F., Romanazzi, G., Zorloni, A., Casati, P., Murolo, S., Durante, G. and Bianco, P.A. (2007) Molecular characterization of phytoplasma associated to grapevine Bois noir. Italus Hortus 14, 218220.
  • Quaglino, F., Zhao, Y., Bianco, P.A., Wei, W., Casati, P., Durante, G. and Davis, R.E. (2009) New 16Sr subgroups and distinct SNP lineages among grapevine Bois noir phytoplasma populations. Ann Appl Biol 154, 279289.
  • Romanazzi, G. and Murolo, S. (2008) Molecular characterization of grapevine Bois noir isolates in the Marche region. Petria 18, 284286.
  • Romanazzi, G., D’Ascenzo, D. and Murolo, S. (2009a) Tussilago farfara: a new natural host of stolbur phytoplasma. Plant Pathol 58, 392.
  • Romanazzi, G., Musetti, R., Marzachì, C. and Casati, P. (2009b) Induction of resistance in the control of phytoplasma diseases. Petria 19, 113119.
  • Saitou, N. and Nei, M. (1987) The neighbour-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4, 406425.
  • Seruga Music, M., Krajacic, M. and Skoric, D. (2008) The use of SSCP analysis in the assessment of phytoplasma gene variability. J Microbiol Meth 73, 6972.
  • Sforza, R., Clair, D., Daire, X., Larrue, J. and Boudon-Padieu, E. (1998) The role of Hyalesthes obsoletus (Hemiptera: Cixiidae) in the occurence of Bois noir of grapevines in France. J Phytopathol 146, 549556.
  • Smart, C.D., Schneider, B., Blomquist, C.L., Guerra, L.J., Harrison, N.A., Ahrens, U., Lorenz, K.H., Seemuller, E. et al. (1996) Phytoplasma-specific PCR primers based on sequences of the 16-23S rRNA spacer region. Appl Environ Microbiol 62, 29882993.
  • Suchov, K.C. and Vovk, A.M. (1948) Biology of the leafhopper Hyalesthes obsoletus Signoret, vector of the stolbur virus. Trudy Instituta Genetiki 15, 193202.
  • Suzuki, S., Oshima, K., Kakizawa, S., Arashida, R., Jung, H.Y., Yamaji, Y., Nishigawa, H. et al. (2006) Interaction between the membrane protein of a pathogen and insect microfilament complex determines insect-vector specificity. Proc Natl Acad Sci USA 103, 42524257.
  • Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F. and Higgins, D.G. (1997) The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 25, 48764882.
  • Weintraub, P.G. and Beanland, L. (2006) Insect vectors of phytoplasmas. Annu Rev Entomol 51, 91111.

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  9. Supporting Information

Figure S1 Alignment of partial vmp1 nucleotide sequences of stolbur isolates Mvercer2 (HM008612) and isolates 400-05 (EF655660) and 120-04 (EF655659) showing an insertion, highlighted in yellow, respect to HM008607, HM008618 and EF655658.

FilenameFormatSizeDescription
JAM_4835_sm_figS1.doc68KSupporting info item

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.