Prevalence and diversity of class 1 integrons and resistance genes in antimicrobial-resistant Escherichia coli originating from beef cattle administered subtherapeutic antimicrobials

Authors


Tim A. McAllister, Agriculture and Agri-Food Canada, Lethbridge Research Centre, 5403-1st Avenue S, PO Box 3000, Lethbridge, AB T1J 4B1 Canada.
E-mail: tim.mcallister@agr.gc.ca

Abstract

Aims:  To characterize class 1 integrons and resistance genes in tetracycline-resistant Escherichia coli originating from beef cattle subtherapeutically administered chlortetracycline (A44), chlortetracycline and sulfamethazine (AS700), or no antimicrobials (control).

Methods and Results:  Tetracycline-resistant E. coli (control, = 111; AS700, = 53; A44, = 40) were studied. Class 1 integrons, inserted gene cassettes and the presence of other antimicrobial resistance genes, as well as phylogenetic analysis, were performed by PCR, restriction enzyme analysis and sequencing. Susceptibilities to 11 antimicrobials were conducted on all isolates. Prevalence of class 1 integrase was higher (< 0·001) in isolates from AS700 (33%) and A44 (28%) steers as compared to control (7%). Most integron gene cassettes belonged to the aad or dfr families. Correlations were found between the tet(A) gene and the genetic elements sul1 (= 0·44), aadA1 (= 0·61), cat (= 0·58) and intI1(= 0·37). Both closely and distantly related isolates harboured integrons with identical gene cassette arrays.

Conclusions:  Subtherapeutic administration of chlorotetracycline alone or in combination with sulfamethazine may select for class 1 integrons in bovine tetracycline-resistant E. coli isolates. Vertical spread and horizontal transfer are responsible for the dissemination of a particular type of class 1 integron, but this study could not differentiate if this phenomenon occurred within or outside of the feedlot. Tetracycline-resistant E. coli strains with sul1 and tet(A) genes were more likely to harbour class 1 integrons.

Significance and Impact of the Study:  Subtherapeutic use of chlortetracycline and sulfamethazine may promote the presence of class 1 integrons in tetracycline-resistant E. coli isolated from feedlot cattle.

Introduction

It is estimated that 50% of the world’s antimicrobial production is used in livestock production (WHO 2002). In agriculture, nearly 90% of antimicrobials are used prophylactically or as growth promoters (AGP) (OTA 1995; Khachatourians 1998), a practice that is common in North America. In beef cattle production, antimicrobials are used therapeutically to treat infection after clinical diagnosis and prophylactically to prevent disease at times of high disease risk such as when calves are weaned and first arrive at a feedlot. As AGP, antimicrobials may be fed to cattle throughout the majority of the feeding period to improve feed efficiency and growth rate (Cromwell 1991; NAS 1999). The administration of AGP to livestock has the potential to lead to the emergence, selection and dissemination of antimicrobial-resistant (AR) bacteria (O’Brien 2002). Selective pressure exerted by antimicrobials can increase the number of AR pathogenic and commensal bacteria. The latter may then serve as a reservoir of resistance genes that can be disseminated to virulent strains (Tenaillon et al. 2010). Furthermore, the use of AGP is of particular concern as a result of evidence suggesting AR bacteria can be transferred from animals to humans via the food chain (Barton 2000; van den Bogaard and Stobberingh 2000; Fabrega et al. 2008).

Integrons are natural genetic elements that have specific structures and abilities to capture or excise one or more resistance gene cassettes by site-specific recombination (Mazel 2006). Class 1 integrons are found commonly in clinical bacterial isolates and play an important role in the carriage and spread of antimicrobial resistance genes (Mazel 2006; Sunde and Norström 2006). Reports on the prevalence and diversity of integrons in isolates from a variety of sources, including faeces, abattoirs, and meat and meat products, have been reported (Kang et al. 2005; Sunde 2005; Barlow et al. 2008). In livestock, studies of the effects of AGP on antimicrobial resistance and presence of integrons have focused mainly on poultry (Soufi et al. 2009; Vasilakopoulou et al. 2009). There is limited knowledge about the effect of AGP on the presence of integrons in bacterial isolates from feedlot beef cattle (Barlow et al. 2009) administered known antimicrobials at defined dietary concentrations.

The objective of this study was to examine the effect of feeding chlortetracycline or a mixture of chlortetracycline and sulfamethazine to cattle on the prevalence and diversity of class 1 integrons in tetracycline-resistant Escherichia coli (Tetr), as well as characterize their resistance phenotype, genotype and phylotype. These AGP were selected based on their common use in the beef industry. We selected TetrE. coli as previous work has reported a linkage between the tetracycline resistance gene tet(A) and the sulfonamide resistance gene sul1 (Boerlin et al. 2005; Gow et al. 2008), with both genes being associated with E. coli class 1 integrons (Sunde and Norström 2006). Some studies have reported that the occurrence of class 1 integrons in E. coli increases in the presence of antimicrobials (Skurnik et al. 2009) and that these mobile elements are not acquired or maintained in the absence of antimicrobials (Díaz-Mejía et al. 2008). We hypothesized that the number of integron-carrying E. coli would be higher from cattle fed AGP, and isolates with sul1 and tet(A) genes would be more likely to harbour class 1 integrons.

Materials and Methods

Animals and bacterial strains

One hundred and forty cross-bred steer calves (6–8 months old, weighing 150 ± 20 kg) originated from Deseret Ranches (Raymond, Alberta, Canada) and had no previous history of antibiotic administration before the initiation of the experiment. Calves were transported to the Lethbridge Research Center research feedlot (Sharma et al. 2008). Steers were arbitrarily assigned to one of three treatments: (i) no antimicrobial agent (= 50; control); (ii) chlortetracycline (44 ppm; Aureomycin-100G; Alpharma Inc., Bridgewater, NJ, USA) (= 40; A44); and (iii) chlortetracycline and sulfamethazine (each at 44 ppm; Aureomycin-100G; Alpharma Inc.) (= 50; AS700). These antibiotics and concentrations were selected on the basis of conventional practices in the Canadian beef industry. The treatments were arranged in a randomized complete block design, with each block consisting of a separate pen containing 10 steers. Adjacent pens in the feedlot were supplied with a common watering bowl, but assignment of treatments to pens was arranged so that only cattle in the same treatment group drank form the same bowl.

To avoid cross-contamination, the antimicrobial agent was mixed with 5 kg of a supplement containing minerals and vitamins, and the mixture was spread manually over the surface of feed within each of the appropriate pens. All animals in the pen were able to access the feed trough at the same time. The antimicrobials were administered continually for 197 days starting on day 0 and were withdrawn 28 days prior to slaughter.

A total of 204 TetrE. coli were selected from the control (= 111), AS700 (= 53) and A44 (= 40) steers during feeding experiments conducted in two consecutive years. TetrE. coli isolates were cultured and identified from rectal faecal samples, faecal pats and the abattoir using the methods described previously (Sharma et al. 2008; Alexander et al. 2009, 2010). MacConkey agar containing tetracycline hydrochloride (16 μg ml−1) was used for isolation of TetrE. coli. Concentrations of antibiotics used in the MacConkey plates containing tetracycline were deliberately set below the standards for defining resistance described by CLSI (2008) to maximize the likelihood of isolating resistant E. coli. TetrE. coli isolated from rectal faecal samples that were collected on day 169 and 197 (steers have been administrated antimicrobials for 169 and 197 days) were chosen and included in this study. If more than one TetrE. coli isolate was obtained from a rectal faecal sample, faecal pats or abattoir samples, only one isolate was randomly chosen and included in this study.

Antimicrobial susceptibility

Escherichia coli isolates were grown overnight on Trypticase soy agar (TSA, Difco Laboratories, Detroit, MI, USA) supplemented with 5% sheep blood (Dalynn Biologicals, Calgary, AB, Canada) and then suspended in phosphate-buffered saline (PBS) and tested using the antimicrobial disc diffusion assay following CLSI (2008) guidelines. The direct colony suspension method was performed, and isolates were inoculated onto 150-mm Mueller–Hinton agar (Difco Laboratories). Resistance to antimicrobial agents was evaluated using 11 antimicrobial discs (Becton Dickinson and company, Sparks, MD, USA) with the aid of a 12-place BBL™ Sensi-Disc™ Disc Dispenser (VWR International, Mississauga, ON, Canada). Antimicrobials tested included amoxicillin/clavulanic acid (20/10 μg, AMC); ampicillin (10 μg, AMP); ceftazidime (30 μg, CAZ); cephalothin (30 μg, CEP); chloramphenicol (30 μg, CHL); ciprofloxacin (5 μg, CIP); gentamicin (10 μg, GEN); streptomycin (10 μg, STR); sulfisoxazole (250 μg, SUL); tetracycline (30 μg, TET); and trimethoprim/sulfamethoxazole (1·25/23·75 μg, TMSZ). After incubation at 37°C for 18 h, zone diameters were measured using a BIOMIC® V3 digital imaging system and analysis software (Giles Scientific Inc., Santa Barbara, CA, USA). The software estimates the diameter of inhibition zones and designates isolates as susceptible/intermediate or resistant based on CLSI (2008) guidelines. Isolates that were tested as intermediate were considered susceptible. Reference stains E. coli (ATCC 25922 and 35218) and Enterococcus faecalis (ATCC 29212) were included with each susceptibility determination as controls.

Detection of class 1 integrons and phylogenetic groups

All isolates were screened for the presence of class 1 integrons by PCR analysis of the class 1 integrase-specific intI1 gene according to Mazel et al. (2000). Integron gene cassettes were detected by conserved-segment PCR (CS-PCR) using the 5′-CS and 3′-CS primer sets reported in Table 1. To obtain DNA template for PCR, a loopful of bacteria from a fresh overnight culture on a Luria–Bertani agar plate was resuspended in 100 μl of TE buffer (10 mmol l−1 Tris–HCl, 1 mmol l−1 EDTA; pH 7·4) and heat lysed at 99°C for 5 min. The suspension was centrifuged (16 000 g for 2 min), and 2 μl was added to the PCR mixture as a DNA template. Each PCR mixture (25 μl) contained 12·5 μl HotStarTaq® Master Mix (Qiagen, Mississauga, ON, Canada) and 0·2 μmol l−1 of each primer. The PCR conditions were as follows: 95°C for 10 min, 40 cycles of 94°C for 1 min, respective annealing temperatures for 1 min and 72°C for 2 min, with a final extension at 72°C for 10 min. Multiplex PCR was performed to assign isolates to four phylogenetic groups (A, B1, B2 and D) as previously described (Clermont et al. 2000). All PCR were performed using an Eppendorf Mastercycler thermal cycler (Eppendorf, Mississauga, ON, Canada), and each run included a negative control (water in place of DNA template) and an appropriate positive control (Table 1). After electrophoresis, PCR products (20 μl) were resolved on a 1% or 1·5% (wt/vol) agarose gels containing ethidium bromide. A 100-bp DNA plus ladder (MBI Fermentas, Burlington, ON, Canada) was used to determine amplicon size.

Table 1.   PCR primers and control strains/plasmids used in this study
PrimersSequence (5′–3′)Target GenesFragment Size (bp)Annealing temp (°C)Positive control strains/plasmidsReference
  1. *Data are from the present study.

IntI1-F
IntI1-R
GCCTTGATGTTACCCGAGAG
GATCGGTCGAATGCGTGT
intI148360Escherichia coli B221B1Mazel et al. (2000)
5-CS
3-CS
GGCATCCAAGCAGCAAG
AAGCAGACTTGACCTGA
CSVariable55Escherichia coli B221B1Lévesque and Roy (1993)
ChuA-F
ChuA-R
GACGAACCAACGGTCAGGAT
TGCCGCCAGTACCAAAGACA
chuA27955E. coli ATCC 25922Clermont et al. (2000)
YjaA-F
YjaA-R
TGAAGTGTCAGGAGACGCTG
ATGGAGAATGCGTTCCTCAAC
yjaA21155E. coli ATCC 25922Clermont et al. (2000)
TspE4C21-F
TspE4C21-R
GAGTAATGTCGGGGCATTCA
CGCGCCAACAAAGTATTACG
TSPE4.C215255E. coli ATCC 25922Clermont et al. (2000)
Sul1-F
Sul1-R
CGGCGTGGGCTACCTGAACG
GCCGATCGCGTGAAGTTCCG
sul143369amr130Kerrn et al. (2002)
Sul2-F
Sul2-R
GCGCTCAAGGCAGATGGCATT
GCGTTTGATACCGGCACCCGT
sul228569amr130Kerrn et al. (2002)
Sul3-F
Sul3-R
GAGCAAGATTTTTGGAATCG
CTAACCTAGGGCTTTGGATAT
sul379053rlo44Hammerum et al. (2006)
blaTEM1-F
blaTEM1-R
TTGGGTGCACGACTGGGT
TAATTGTTGCCGGGAAGC
tem150360SU07Guerra et al. (2003)
blaPSE-F
blaPSE-R
CGCTTCGGGTTAACAAGTAC
CTGGTTCATTTCAGATAGCG
pse141960SU01Guerra et al. (2003)
blaOXA-1-F blaOXA-1-RAGCAGCGCCAGTGCATCA
ATTCGACCCCAAGTTTCC
oxa170860SU05Guerra et al. (2003)
tet(A)-F
tet(A)-R
GCTACATCCTGCTTGCCTTC
CATAGATCGCCGTGAAGAGG
tet(A)21059·5pSL18Ng et al. (2001)
tet(B)-F
tet(B)-R
TTGGTTAGGGGCAAGTTTTG
GTAATGGGCCAATAACACCG
tet(B)65959·5pRT11Ng et al. (2001)
tet(C)-F
tet(C)-R
CTTGAGAGCCTTCAACCCAG
ATGGTCGTCATCTACCTGCC
tet(C)41859·5pBR322Ng et al. (2001)
strA-strB-F
strA-strB-R
TATCTGCGATTGGACCCTCTG
CATTGCTCATCATTTGATCGGCT
strA-strB53860A208*Sunde and Norström (2005)
AadA-F
AadA-R
GCAGCGCAATGACATTCTTG
ATCCTCGGCGCGATTTTG
aadA1 or aadA228260Escherichia coli B221B1Sáenz et al. (2004)
Qac-F
Qac-R
GGCTGGCTTTTTCTTGTTATCG
TGAGCCCCATACCTACAAAGC
qacEΔ128760Escherichia coli B221B1Mazel et al. (2000)
DfrIa-F
DfrIa-R
GTGAAACTATCACTAATGG
TTAACCCTTTTGCCAGATTT
dfrA1, dfrA547455FG111*Navia et al. (2003)
DfrVII-F
DfrVII-R
TTGAAAATTTCATTGATT
TTAGCCTTTTTTCCAAATCT
dfrA7, dfrA1747455FG64*Navia et al. (2003)
DfrXII-F
DfrXII-R
GGTGSGCAGAAGATTTTTCGC
TGGGAAGAAGGCGTCACCCTC
dfrA12, dfrA1331960A208*Navia et al. (2003)
flor-F
flor-R
CACGTTGAGCCTCTATAT
ATGCAGAAGTAGAACGCG
floR86855A208*Sáenz et al. (2004)
cat-F
cat-R
GGTGAGCTGGTGATATGG
GGGATTGGCTGAGACGA
Cat20948Escherichia coli B221B1Orman et al. (2002)

Characterization of integrons

Conserved-segment PCR products were purified using the QiaQuick PCR purification kit (Qiagen) and analysed by restriction fragment length polymorphism (RFLP). Amplicons were digested with two different restriction endonucleases, HpaII and MseI (Invitrogen, Burlington, ON, Canada), and the order and the arrangement of the gene cassettes was considered identical if they showed the same RFLP pattern. One representative of each RFLP type was randomly selected for nucleotide sequencing. Conserved-segment PCR products were extracted and purified from agarose using the MinElute Gel Extraction Kit (Qiagen) according to manufacturer’s instructions. Sequencing was performed by Eurofins MWG Operon (Operon, Huntsville, AL, USA) using a 3730xl DNA Analyzer (Applied Biosystems, Foster City, CA, USA). Amplicons >1000 bp were sequenced by gene walking using an internal primer. DNA sequences were analysed by searching the GenBank database of the NCBI via the Blast network service (http://www.ncbi.nlm.nih.gov).

Pulsed-field gel electrophoresis (PFGE)

The genetic relationship among integron-carrying isolates was determined by PFGE. Isolates were subtyped via XbaI-digested genomic DNA in accordance with the 1-day standardized laboratory protocol for molecular subtyping of E. coli (Centre for Disease Control and Prevention, PulseNet, Atlanta, GA, USA) and as described by Sharma et al. (2008). Electrophoresis was carried out with a Chef DR II electrophoresis unit (Bio-Rad Laboratories, Mississauga, ON, Canada). Gels were documented using an AlphaImager imaging system (Alpha Innotech, San Leandro, CA, USA). Salmonella enterica serotype Braenderup H9812 was used as a marker and included on each gel. Comparison of digested profiles between isolates was performed using BioNumerics software version 5.1 (Applied Maths, Austin, TX, USA), with the Dice coefficient evaluated by the unweighted pair group method. A 1% tolerance was used to account for gel differences. Electrophoresis patterns from isolates exhibiting a similarity of 90% or higher were assigned to the same PFGE type as previously described (Sharma et al. 2008).

Characterization of resistance determinants

Resistance genes were screened by PCR analysis using the conditions described above and the primers and annealing temperatures listed in Table 1, with the exception that 0·4 μmol l−1 of each primer was used in each reaction. Isolates displaying tetracycline, streptomycin, ampicillin, sulfisoxazole, chloramphenicol and trimethoprim phenotypes were screened for the resistance determinants tetracycline [tet(A), tet(B) and tet(C)], streptomycin (strA-strB and aadA), ampicillin (blaTEM1, blaPSE and blaOXA-1), sulfisoxazole (sul1, sul2 and sul3), chloramphenicol (cmlA, cat and floR) and trimethoprim (dfrA1, dfrA5, dfrA12 and dfrA17), respectively. Genes encoding tetracycline (Ng et al. 2001), ampicillin (Guerra et al. 2003) and sulfisoxazole (Kerrn et al. 2002) resistance were detected by multiplex PCR using the primers listed in Table 1. The other antimicrobial resistance genes were identified using singleplex PCR. The dfrA1, dfrA5, dfrA12 and dfrA17 genes were identified using RFLP analysis of PCR amplicons according to Navia et al. (2003). The presence of qacEΔ1 gene was also determined by PCR among the integron-carrying isolates.

Statistical analysis

All statistical analyses were performed with the SAS-PC-System ver. 9.1 for Windows (SAS Institute Inc., Cary, NC, USA). The χ2 or Fisher’s exact tests were used to compare categorical variables. Comparisons of the associations between resistance genes were performed using the Pearson’s χ2 exact test. A P-value of <0·05 was considered to be statistically significant.

Results

Antimicrobial resistance phenotypes

As expected, all isolates were resistant to tetracycline as they were isolated on tetracycline selective plates (Table 2). After tetracycline, the most prevalent resistance phenotype was streptomycin (63%), followed by ampicillin (50%), sulfisoxazole (39%), chloramphenicol (19%), cephalothin (15%) and trimethoprim/sulfamethoxazole (7%). Less than 5% of isolates were resistant to amoxicillin/clavulanic acid (3%), ciprofloxacin (2%), ceftazidime (1%) or gentamicin (1%). Overall, the frequencies of resistance to various antimicrobial agents were higher in TetrE. coli isolates from A44 and AS700 steers, as compared to control steers.

Table 2.   Number and percentages of resistance for the different antimicrobial agents in relation to the origin of the TetrEscherichia coli isolates included in this study
Antimicrobial agentsNo. (%) of isolates within treatment* groupsTotal (= 204) [n (%)]
Control (= 111)AS700 (= 53)A44 (= 40)
  1. *The treatments: control, no antimicrobial agents added to the diet; AS700, chlortetracycline and sulfamethazine (each at 44 ppm) added to the diet; A44, chlortetracycline (44 ppm) added to the diet.

Amoxicillin/clavulanic acid5 (5)0 (0)1 (3)6 (3)
Ampicillin37 (33)32 (60)33 (83)102 (50)
Ceftazidime1 (1)0 (0)0 (0)1 (1)
Cephalothin14 (13)3 (6)14 (35)31 (15)
Chloramphenicol11 (10)13 (25)15 (38)39 (19)
Ciprofloxacin1 (1)1 (2)1 (3)3 (2)
Gentamicin0 (0)1 (2)0 (0)1 (1)
Streptomycin58 (52)37 (70)34 (85)129 (63)
Sulfisoxazole40 (36)21 (40)19 (48)80 (39)
Tetracycline111 (100)53 (100)40 (100)204 (100)
Trimethoprim/sulfamethoxazole10 (9)1 (2)4 (10)15 (7)

Sixty-four percent of the isolates showed resistance to three or more antimicrobials, with resistance to ampicillin, streptomycin and tetracycline being most frequent (20%) followed by resistance to streptomycin, sulfisoxazole and tetracycline (13%). Only 10% of isolates were resistance to five antimicrobials, including ampicillin, chloramphenicol, streptomycin, sulfisoxazole and tetracycline.

Integron carriage, phylogenetic groups and characterization of gene cassettes

Of the 204 TetrE. coli isolates tested, 36 (18%) were positive for the class 1 integrase gene (intI1). The intI1 gene was identified in 7% (8/111) of isolates from control steers and was more frequent (< 0·001) in isolates derived from A44 (33%; 13/40) and AS700 (28%; 15/53) steers (Table 3). The variable regions were amplified in 31 of the 36 class 1 integrons. No CS-PCR products were generated with DNA template from the remaining 5 intI1-positive isolates. Three of these latter isolates lacked the qacEΔ1-sul1 genes, and one lacked the sul1 gene. The remaining isolate possessed both intI1 and qacEΔ1-sul1 genes, but no amplicons were generated after repeated PCR attempts, a result that may reflect a lack of conservation in the 3′ region or could also suggest that these were integrons without any gene cassettes inserted at the attI site as previously reported (Collis et al. 2002). Gene cassettes that might have been present within integrons from these five isolates were not further characterized (Table 3).

Table 3.   Gene cassettes and phylogenetic groups detected among TetrEscherichia coli isolates from steers fed antimicrobial agents*
Type†Cassette arrayNo. (%) of isolates carrying gene cassetteOverallPhylogenetic group
Control (= 111)AS700 (= 53)A44 (= 40)AB1B2D
  1. *Control, no antimicrobial agents added to the diet; the AS700 and A44 antimicrobial feeding treatments are defined in Materials and Methods.

  2. †Variable region not amplifiable using conserved-segment PCR.

  3. ‡Integron designation defined by the RFLP patterns.

CaadA113 (25)9 (23)22 (61)211
DdfrA12-orfF-aadA24 (4)1 (3)5 (14)14
EdfrA17-aadA53 (8)3 (8)3
FdfrA1-catB3-aadA41 (1)1 (3)1
 Undetermined‡3 (3)2 (4)5 (14)311
 Total8 (7)15 (28)13 (33)3613122

Analysis of the CS-PCR products by RFLP and DNA sequencing revealed four different gene cassette arrays with distinct variable regions ranging in size from 1009 to 2340 bp. Eight genes that encoded resistance to streptomycin/spectinomycin (aadA1, aadA2, aadA4 and aadA5), trimethoprim (dfrA1, dfrA12 and dfrA17) and chloramphenicol (catB3) were detected in the four different integrons. Three different types of class 1 integrons were observed in isolates from A44 steers, two from control and one from AS700 steers as defined by different RFLP patterns (Table 3). The single gene cassette array of aadA1 (1009 bp) was most prevalent (61%; 22/36) and only found in isolates from both A44 and AS700 steers. The dfrA12-orfF-aadA2 array, with a length of 1912 bp, was observed in isolates from both control and A44 steers. The dfrA17-aadA5 (1664 bp) array was only found in isolates from A44 steers, and the dfrA1-catB3-aadA4 (2340 bp) array was only detected in one isolate from control steers.

The use of PCR to determine phylogenetic groups of all 204 E. coli isolates revealed that 42%, 46%, 3% and 9% of the isolates belonged to phylogenetic groups A, B1, B2 and D, respectively. Phylogenetic analysis among the integron-carrying isolates showed that class 1 integrons were present in isolates belonging to all four phylogenetic groups and were particularly prevalent in group B1 where 86% (31/36) of the isolates carried integrons (Table 3).

PFGE analysis of E. coli isolates carrying integrons

To determine whether the dissemination of class 1 integron in TetrE. coli occurred through horizontal or vertical transfer, the 36 integron-positive isolates from faecal grab, faecal pats and abattoir origin samples were typed using PFGE. Results identified 21 clusters of related profiles, based on >90% genetic similarity (Fig. 1). Of the 11 type C (as shown in Table 3 and Fig. 1) integron-carrying isolates from rectal faecal samples, 4 PFGE profiles were found (Fig. 1). Similarly, 6 PFGE profiles were detected among 10 type C isolates from faecal pat samples. Of the four type D integron-carrying isolates from abattoir samples, three PFGE profiles were found. Type E integron-carrying isolates from faecal grab samples all belonged to the same PFGE profile. Analysis indicated that both clonal spread and horizontal transfer could play a role in the dissemination of class 1 integrons.

Figure 1.

 Dendrogram showing the similarity between Escherichia coli (= 36) carrying class 1 integrons based on their pulsed-field gel electrophoresis patterns. Letters preceding numbers in the strains code denote the source of E. coli: A, abattoir; FD, faecal deposits; FG, faecal grab. Letters following the numbers indicate the type (as shown in Table 3; N = not determined) of class 1 integrons carried by the respective isolates. Control, no antimicrobial agents added to the diet; AS700, chlortetracycline and sulfamethazine (each at 44 ppm) added to the diet; A44, chlortetracycline (44 ppm) added to the diet.

Antimicrobial susceptibility of class 1 integron-positive/negative isolates

Isolates that contained a class 1 integron had a higher frequency (< 0·01) of resistance to ampicillin, chloramphenicol, streptomycin, sulfisoxazole, trimethoprim/sulfamethoxazole and cephalothin (Table 4). Notably, integron-carrying isolates had more resistance not only to antimicrobial agents in which resistance was encoded in the integron (i.e. streptomycin, trimethoprim and chloramphenicol) but also to other classes of antimicrobials. Moreover, integron-carrying isolates were more likely to be multidrug resistant (< 0·001) as shown in Table 4.

Table 4.   Prevalence of antimicrobial resistance profiles among TetrEscherichia coli isolates as affected by carriage of integrons
AntimicrobialNo. (%) of isolates resistantP-value
Integron-negative isolates (= 168)Integron-positive isolates (= 36)
  1. *Resistance to three or more different classes of antimicrobials.

Beta-lactams
 Amoxicillin/clavulanic acid3 (2)3 (8)0·052
 Ampicillin68 (40)34 (94)<0·001
Cephalosporins
 Cephalothin21 (13)10 (28)0·009
Phenicols
 Chloramphenicol9 (5)30 (83)<0·001
Quinolones
 Ciprofloxacin2 (1)1 (3)0·312
Aminoglycosides
 Streptomycin94 (56)35 (97)<0·001
Sulfonamides
 Sulfisoxazole47 (28)33 (92)<0·001
Trimethoprim
 Trimethoprim/sulfamethoxazole4 (2)11 (31)<0·001
Multidrug resistance*95 (57)36 (100)<0·001

Distribution of antimicrobial resistance genes

The resistance genes screened for were selected on the basis of their high rate of occurrence in AR E. coli isolates (Table 1).

  • i Tetracyclines. Of the 204 Tetr isolates examined, 91% carried one or more of the tet(A), tet(B) and tet(C) genes. The most prevalent Tetr gene was tet(B) (50%), followed by tet(A) (37%), tet(C) (4%) and the combination of tet(A) and tet(C) (2%) or tet(A) and tet(B) (1%). Higher frequency of tet(A), tet(B) and tet(C) determinants was detected in isolates from AS700 (45%), A44 (73%) and control (8%) steers, respectively (Table 5).
  • ii Aminoglycosides. Among the 129 streptomycin-resistant isolates detected, 70% possessed one or more of the strA-strB, aadA1 and aadA2 determinants (Table 5). Resistance to streptomycin was mainly mediated by the strA-strB genes (50%), followed by aadA1 gene cassette (16%), aadA2 (4%) and the combination of strA-strB and aadA2 (4%) or strA-strB and aadA1 (1%). Higher frequency of strA-strB genes, aadA1 and aadA2 genes was found in isolates from A44 (50%), AS700 (25%) and control (4%) steers, respectively. The aadA1 gene was more prevalent (< 0·001) in isolates from AS700 and A44 steers compared to those from control.
  • iii Beta-lactams. Of the three ampicillin resistance genes screened for, blaTEM1 (87%) was most common followed by blaPSE (4%), whereas blaOXA-1 was not detected in any of the isolates (Table 5). A higher (< 0·001) frequency of blaTEM1 gene was found in isolates from A44 (78%) and AS700 (57%) steers as compared to control steers (25%).
  • iv Sulfonamides. Of the 80 sulfisoxazole-resistant isolates, 82% carried sul1 and sul2 alone or in combination whereas sul3 was not detected (Table 5). Determinants sul1 and sul2 were detected separately in 29% and 53% of the sulfisoxazole-resistant isolates, respectively, and together in 11% of the isolates. Of the sulfisoxazole-resistant isolates from A44 and AS700 steers, 30% and 28% carried sul1 gene, respectively, an outcome that was more frequent (< 0·001) than in isolates collected from control steers (5%).
  • v Phenicols. Of the three chloramphenicol resistance genes detected, cat (54%) was most frequent, followed by floR (44%). The resistance gene cmlA was not detected among the isolates examined. Only one isolate from A44 steers harboured both cat and floR genes. A higher frequency (< 0·001) of cat and floR determinants was found in isolates from steers fed AS700 (25%) and A44 (20%) as compared to control steers.
  • vi Trimethoprim. Resistance to trimethoprim was mainly mediated by gene cassette within class 1 integrons (dfrA1, dfrA12 and dfrA17) in the trimethoprim-resistant isolates except dfrA5 that was only found in two integron-negative isolates from control steers.
Table 5.   Resistance genes detected in TetrEscherichia coli isolates in relation to its specific resistance phenotype
PhenotypeGeneNo. (%) of isolatesNo. of isolates within treatment*group
Control (= 111)AS700 (= 53)A44 (= 40)
  1. *Control, no antimicrobial agents added to the diet; the AS700 and A44 antimicrobial feeding treatments are defined in Materials and Methods.

Tetracycline (= 204)tet(A)80 (37)47 (42)24 (45)9 (23)
tet(B)103 (50)47 (42)27 (51)29 (73)
tet(C)12 (4)9 (8)2 (4)1 (3)
No gene detected13 (6)10 (9)1 (2)2 (5)
Streptomycin (= 129)strA-strB65 (50)33 (30)12 (23)20 (50)
aadA121 (16)0 (0)13 (25)8 (20)
aadA25 (4)4 (4)0 (0)1 (3)
No gene detected44 (34)25 (23)12 (23)7 (18)
Ampicillin (= 102)blaTEM189 (87)28 (25)30 (57)31 (78)
blaPSE4 (4)3 (3)0 (0)1 (3)
No gene detected9 (9)6 (5)2 (4)1 (3)
Sulfisoxazole (= 80)sul132 (29)5 (5)15 (28)12 (30)
sul251 (53)31 (24)8 (15)12 (30)
No gene detected8 (10)8 (7)0 (0)0 (0)
Chloramphenicol (= 39)cat21 (54)0 (0)13 (25)8 (20)
floR17 (44)9 (8)0 (0)8 (20)
No gene detected2 (5)2 (2)0 (0)0 (0)
Trimethoprim/sulfamethoxazole (= 15)dfrA11 (7)1 (1)0 (0)0 (0)
dfrA52 (13)2 (2)0 (0)0 (0)
dfrA125 (33)4 (4)0 (0)1 (3)
dfrA173 (20)0 (0)0 (0)3 (8)
No gene detected4 (27)3 (3)1 (2)0 (0)

Association between resistance genes and class 1 integrons

Several gene determinants were associated with class 1 integrons (intI1 and sul1) and gene cassette (aadA1). Positive, but relatively weak association between tet(A) and the genetic elements sul1 (= 0·44), cat (= 0. 58), aadA1 (= 0·61) and intI1 (= 0·37) were observed (Table 6). A positive association was also found between tet(B), strA-strB and sul2 gene. In addition, positive associations were found between the floR gene and both the strA-strB and the sul2 genes as well as between blaTEM1 and aadA1, cat, sul1 and intI1 genes.

Table 6.   Association between antimicrobial resistance genes and class 1 integrons†
Resistance markerAssociation of antimicrobial resistance gene and class 1 integron
tet(A)tet(B)tet(C)strA-strBaadA1catfloRsul1sul2blaTEM1
  1. *< 0·05.

  2. †Comparisons of the associations between resistance genes were performed using the Pearson’s χ2 exact test.

tet(B)−0·31*         
tet(C)−0·16−0·37*        
strA-strB−0·060·40*−0·22       
aadA10·61*−0·47*−0·07−0·09      
cat0·58*−0·46*−0·07−0·090·99*     
floR0·050·06−0·070·41*−0·02−0·02    
sul10·44*−0·16−0·16−0·080·41*0·37*−0·22   
sul20·100·34*−0·210·58*−0·08−0·110·54*−0·12  
blaTEM1−0·050·07−0·170·170·59*0·62*−0·140·46*0·10 
intI10·37*−0·18−0·17−0·160·46*0·46*−0·270·90*−0·110·44*

Discussion

Class 1 integrons have been associated with tetracycline resistance genes (Boerlin et al. 2005; Sunde and Norström 2006) and have been shown to be selected and maintained by antimicrobial pressure (Díaz-Mejía et al. 2008). In the present study, the prevalence of class 1 integrons was significantly higher in TetrE. coli isolates from A44 and AS700 steers than from control steers. Class 1 integrons are located frequently on plasmids that can be transferred by conjugation (Girlich et al. 2001), and high in vitro transfer frequencies (10−2) of class 1 integrons in E. coli have been reported (Leverstein-van Hall et al. 2002). Díaz-Mejía et al. (2008)proposed that the codon usage (Medrano-Soto et al. 2004) selected by the pressure of antimicrobials on E. coli might be involved in the retention of horizontally transferred genetic elements and the acquisition and/or maintenance of integrons. Similarly, Levy (1997) also theorized that gene transfer has no consequence unless antimicrobial selection is present. Therefore, we inferred that the higher prevalence of class 1 integrons in TetrE. coli from A44 and AS700 steers was because of selective antimicrobial pressure.

Identical integrons were found in both genetically related and unrelated strains of E. coli. Additionally, clones of E. coli encoding the same integron were isolated from different sample sources. These results suggest that the prevalence of a particular type of class 1 integron in different sample sources may be associated with both clonal spread of integron-carrying strains and horizontal transfer of conjugative plasmids. As the animals on the same treatment were housed together in pens and came from the same feedlot, it is possible that the clonal spread may have occurred as a result of contact among animals within the feedlot. Similarly, one study reported a higher prevalence of integrons in E. coli from cattle fed in confinement as compared to those grazing grass pastures, and this was attributed to the vertical spread of integron-carrying E. coli among cattle in close contact (Barlow et al. 2009). In addition, isolates in our study originated from the rectal faeces, faecal pats and abattoir samples and most E. coli harbouring integrons grouped together based on sample source, perhaps suggesting that environmental selection can play a role in the types of TetrE. coli that predominate.

The most commonly detected gene cassettes in the examined integrons belonged to the aad and dfr gene families encoding resistance to streptomycin and trimethoprim, respectively. These gene cassette arrays have been reported in other studies (Kang et al. 2005; Sunde 2005; Kadlec and Schwarz 2008) with dfrA12-orfF-aadA2 and dfrA17-aadA5, being common in E. coli from cattle (Barlow et al. 2009). Four of 36 class 1 integrons lacked the common 3′-region (qacEΔ1 and sul1 genes), a phenomenon previously observed in E. coli (Sunde et al. 2008; Soufi et al. 2009; Sáenz et al. 2010). The negative CS-PCRs for these strains could reflect a lack of a hybridization site for the 3′-CS primer.

Regarding phylogenetic groups, others have reported that E. coli strains belonging to B2 group are usually more susceptible to antimicrobials (Picard et al. 1999; Cocchi et al. 2007) and tend to carry fewer integrons than groups A, B1 and D (Skurnik et al. 2005). We found higher prevalence of integron-carrying isolates among B1 (86%) than among B2 groups (6%), supporting this hypothesis. Similarly, Ho et al. (2009) reported that more integron-carrying E. coli strains belonged to groups A and B1 than to B2 and D.

Most of the resistance genes screened for were detected at high frequencies, indicating that they play major roles in mediating resistance among the isolates tested. In the present study, the majority of TetrE. coli possessed the tet(B) gene, followed less frequently by tet(A) and tet(C). Our results agree with data reported by Walk et al. (2007), who reported that 64·8%, 28·1% and 4·6% of TetrE. coli from conventional and organic dairies harboured tet(B), tet(A) and tet(C) determinants. In our and other studies (Schwaiger et al. 2010), streptomycin resistance was mostly mediated by strA-strB genes in TetrE. coli. The beta-lactam resistance in E. coli in this study was mainly because of the blaTEM1 gene. This determinant is one of the more prevalent beta-lactamases (Li et al. 2007) and has been previously detected as a predominant gene encoding beta-lactam resistance in TetrE. coli from dairy cattle (Walk et al. 2007). Sulfonamide resistance in E. coli is generally attributed to the presence of sul1, sul2 and/or sul3 genes (Perreten and Boerlin 2003). We found higher prevalence of sul2 than sul1 in TetrE. coli, which is consistent with the findings of a study by Schwaiger et al. (2010). In previous reports, floR gene was the most dominant determinant encoding the chloramphenicol resistance in TetrE. coli (Diarra et al. 2007). In contrast with that same study, we observed a similar prevalence of cat (54%) and floR (44%) genes among chloramphenicol-resistant E. coli isolates. Regarding trimethoprim resistance, the dfrA1, dfrA12 and dfrA17 genes were all found among integron-positive isolates, with exception of dfrA5 that was found in only two integron-negative isolates.

Overall, two groups of associations seem to emerge from our analyses. Distinct associations were observed between tet(A), sul1, aadA1, cat and intI1 determinants that are often associated with integrons (Fluit and Schmitz 2004), and the tet(B), sul2 and strA-strB, with sul2 and strA-strB are known to be plasmid mediated as in plasmids RSF1010 and pBP1 (Sundin and Bender 1996). The strong association between tet(A), sul1 and intI1 suggests that tet(A) is also linked to class 1 integrons, a finding that has also been reported by others (Boerlin et al. 2005; Sunde and Norström 2006). In addition, we found associations between blaTEM1, sul1 and intI, but no association was observed between blaTEM1 and tet(A). In contrast to our study, others have reported negative associations between blaTEM1, sul1 and intI1 (Maynard et al. 2004; Sunde and Norström 2006). Resistance to tetracycline, ampicillin, sulfonamide and streptomycin has been reported to be mediated by plasmid-borne tet(A) and blaTEM1, along with a class 1 integron carrying sul1 and aadA2 in Salmonella enterica (Guerra et al. 2001). In another study, tet(A) gene and a class 1 integron were found on the same plasmid (pAPEC-O2-R) from an avian E. coli (Johnson et al. 2005). Therefore, we inferred that tet(A), blaTEM1 and class 1 integron perhaps frequently coincide on a large transferable plasmid or other genetic element in E. coli.

It is worthy to note that 64% of the Tetr isolates exhibited a multiresistance phenotype and co-resistance to streptomycin, ampicillin, sulfisoxazole or chloramphenicol. Similar to our results, higher rates of resistance to some antimicrobial agents such as streptomycin, ampicillin, trimethoprim, sulfamethoxazole and chloramphenicol were observed among integron-positive as compared to integron-negative E. coli isolates (Vinuéet al. 2008). However, the occurrence of gene cassettes found in integrons could not account for resistance to some antimicrobial agents such as ampicillin and chloramphenicol in integron-carrying isolates. Taken together, a possible explanation for this observation may reflect that the antimicrobial resistance genes and integron are both associated with a mobile genetic element such as a plasmid or transposon with high transfer efficiency. Under such a scenario, exposure to a single antimicrobial agent could lead to the co-selection of multiple antimicrobial resistance genes (Leverstein-van Hall et al. 2003). While the AS700 included sulfamethazine in addition to chlortetracycline, there were no clear differences in resistance phenotype or genotype in isolates from AS700- or A44-fed cattle. This would suggest that sulfamethazine had limited additional effects on the Tetr population in this study.

In conclusion, our hypothesis was supported as feeding chlortetracycline-based AGP to feedlot cattle promoted the presence and maintenance of class 1 integrons in bovine TetrE. coli isolates. The clonal spread of integron-carrying strains and horizontal transfer of conjugative plasmids seem to be responsible for the dissemination of a particular type of class 1 integron within different sample sources, but this study does not differentiate if this occurs inside or outside of the feedlot environment. Further research examining integron persistence over time and determining whether class 1 integrons are located in conjugative plasmids to assess the efficiency of integron transfer would improve our understanding of how integron may move among strains. The associations between tet(A) and sul1 as well as intI1 genes were positive, supporting that isolates with sul1 and tet(A) genes are more likely to harbour class 1 integrons.

Acknowledgements

The authors are grateful to Lorna Selinger, Shaun Cook and Linda Kremenik for their excellent technical assistance. We thank Toby Entz for his statistical guidance. This research was supported by funding from Agriculture and Agri-Food Canada to Ranjana Sharma, and an IMAU-AAFC (MOE) scholarship to Rui-Bing Wu is also gratefully acknowledged.

Ancillary