A comparison of methods used to extract bacterial DNA from raw milk and raw milk cheese

Authors


Paul D. Cotter, Teagasc Food Research Centre, Moorepark, Fermoy, Co. Cork, Ireland. E-mail paul.cotter@teagasc.ie

Abstract

Aims:  In this study, we compare seven different methods which have been designed or modified to extract total DNA from raw milk and raw milk cheese with a view to its subsequent use for the PCR of bacterial DNA.

Materials and Results:  Seven extraction methods were employed to extract total DNA from these foods, and their relative success with respect to the yield and purity of the DNA isolated, and its quality as a template for downstream PCR, was compared. Although all of the methods were successful with respect to the extraction of DNA naturally present in cheese, they varied in their relative ability to extract DNA from milk. However, when milk was spiked with a representative Gram-positive (Listeria monocytogenes EGDe) or Gram-negative (Salmonella enterica serovar Typhimurium LT2) bacterium, it was established that all methods successfully extracted DNA which was suitable for subsequent detection by PCR.

Conclusions:  Of the seven approaches, the PowerFood™ Microbial DNA Isolation kit (MoBio Laboratories Inc.) was found to most consistently extract highly concentrated and pure DNA with a view to its subsequent use for PCR-based amplification and also facilitated accurate detection by real-time quantitative PCR.

Significance and Impact of the Study:  Accurately assessing the bacterial composition of milk and cheese is of great importance to the dairy industry. Increasingly, DNA-based technologies are being employed to provide an accurate assessment of this microbiota. However, these approaches are dependent on our ability to extract DNA of sufficient yield and purity. This study compares a number of different options and highlights the relative success of these approaches. We also highlight the success of one method to extract DNA from different microbial populations as well as DNA which is suitable for real-time PCR of microbes of interest, a challenge often encountered by the food industry.

Introduction

Until recently, our understanding of the composition of microbial ecosystems has been limited by a reliance on culture-based techniques (Hugenholtz et al. 1998). However, in the last decade, DNA-based methods have been developed which have provided an alternate, culture-independent, means of analysing such communities (Nocker et al. 2007). It has been established that DNA PCR-based methods are highly specific, reproducible and sensitive and are characterized by high discriminatory power, rapid processing time and low costs and thus have been employed to investigate the microbial composition of foods (Di Pinto et al. 2007). Unfortunately, food samples frequently contain PCR inhibitors such as fats, proteins and calcium that can compromise the amplification of DNA (Wilson 1997). It has been reported that obtaining DNA extracts from dairy products which are nondegradable, inhibitor-free and suitable for PCR amplification is a common problem (Pirondini et al. 2010). For these reasons, extracting DNA of sufficient concentration and purity is of crucial importance. The methods used to extract and purify DNA from foods frequently consist of four key steps, that is, mechanical homogenization, treatment with buffers, detergents and/or enzymes, the application of mechanical lysis steps and the organic extraction of DNA (Jany and Barbier 2008). With respect to mechanical homogenization, there are a number of existing procedures which employ a stomacher, Pulsifier® (Fung et al. 1998), blender (Parayre et al. 2007) or similar such piece of equipment. These, in the presence of salt-based buffers such as tri-sodium citrate, NaOH-based media or detergent-based buffers, macerate the food sample thereby releasing micro-organisms into suspension (Callon et al. 2006). Once the released cells have been retrieved, they may be treated with buffers containing chaotrophic agents, for example, guanidine thiocyanate and/or detergents such as SDS, which disorder the structure of DNA, helping to burst open the cells and release DNA (Duthoit et al. 2003; Giannino et al. 2009). Such buffers also contribute to a reduction in the concentration of inhibitory substances. Enzymes, such as proteinase K, lysozyme and mutanolysin (Cocolin et al. 2007; Parayre et al. 2007), may also be used as these degrade the cell walls of more resilient micro-organisms including many Gram-positive species. Mechanical cell lysis, which breaks open the bacterial cell wall by vibrating bacteria with microbeads at high speeds, has also been found to improve detection limits (Odumeru et al. 2001). DNA can then be extracted using organic solvents, such as phenol-chloroform, which aid in removing proteins and other cell remnants, before DNA purification and concentration, generally using an ethanol precipitation step (Odumeru et al. 2001). However, more recently, commercial kits (Abriouel et al. 2006; Pirondini et al. 2010) relying on DNA-binding matrices or magnetic solid-phase supports have circumvented the need for dangerous chemicals such as phenol. The former generally use a column-based system which works on the basis of affinity chromatography, that is, the DNA adsorbs to the membrane (e.g. silica-based), and all impurities are washed through with the DNA then being eluted from the membrane using a low-salt buffer (e.g. TE (Tris/EDTA) buffer). Magnetic-based approaches rely on the reversible binding of DNA, nonspecifically to magnetic microparticles which have a DNA-binding functional group attached (Di Pinto et al. 2007; Abriouel et al. 2008).

Here, we evaluate seven different methods which have been designed or adapted to facilitate the extraction of DNA from raw milk and raw milk cheese. This involves a comparison of the quality and yield of DNA isolated and an assessment of the success with which bacterial PCR amplicons are generated.

Materials and methods

Food sources

Fresh milk samples were collected, in triplicate, from a milking parlour under aseptic conditions and immediately placed in isothermic conditions and transferred to the laboratory for DNA extraction. A commercial, soft, raw milk cheese manufactured from cows’ milk with starter cultures was sampled, in triplicate, under aseptic conditions.

DNA extraction methods

Seven DNA extraction methods were evaluated to compare their relative efficiency with respect to the extraction of DNA from milk and cheese samples. The characteristics of the DNA extraction methods are summarized in Table 1. Methods 1–3 relied on the QIAamp® DNA stool mini kit (Qiagen Ltd, Crawley, West Sussex, UK), Chemagic Food Basic kit (Chemagen Biopolymer-Technologie AG, Baesweiler, Germany) and Wizard® Magnetic DNA purification system for Food (Promega Corporation, Madison, WI, USA) to extract DNA from 200 mg of cheese or a pellet from 1 ml milk. Extractions were carried out according to the manufacturers’ instructions including a recommended modification to the QIAamp® protocol designed to enhance its ability to extract DNA from food matrices. Methods 4–5 employed the Milk Bacterial DNA Isolation kit (recommended by manufacturer’s for extracting DNA from milk) (Norgen Biotek Corporation, Ontario, Canada), and the PowerFood™ Microbial DNA Isolation kit (MoBio Laboratories Inc., Carlsbad, CA, USA), to extract DNA, again from a pellet obtained from 1 ml of milk or 1 ml of cheese homogenate (prepared by stomaching 1 g cheese with 9 ml tri-sodium citrate), according to manufacturers’ instructions. Method 6 was designated the ‘Lytic’ method and represents a combination of methods used by O’Mahony and Hill (2004), Parayre et al. (2007) and Dolci et al. (2008). Here, DNA was isolated by resuspending the pellet (obtained from 1 ml milk or 1 ml of homogenized cheese) in 500 μl of breaking buffer for enzymatic lysis [20 mmol l−1 Tris HCl (pH8), 2 mmol l−1 EDTA, 2% Triton X100, 50 μg ml−1 lysozyme, 100 U mutanolysin] and incubated at 37°C for 1 h. Protein digestion was then performed by adding 250 μg ml−1 proteinase K and incubating at 55°C for 1 h. The suspension was transferred to a 2-ml tube containing 0·3 g zirconium beads, the tube was shaken for 90 s in a bead beater, twice, and centrifuged at 12 000 g × 10 min. The supernatant was transferred to a fresh tube and combined with an equal volume of phenol : chloroform : isoamylalcohol (25 : 24 : 1) mixed gently and centrifuged at 12 000 g × 2 min. The top aqueous phase was transferred to a clean tube, and one-tenth the volume 3 mol l−1 sodium acetate and 2 volumes of 100% ice-cold ethanol were added. The suspension was mixed gently and stored at −20°C overnight. The sample was centrifuged at 14 000 g × 10 min, the supernatant removed and the pellet was washed with 70% ice-cold ethanol followed by centrifugation at 12 000 g × 5 min and the pellet dried. The pellet was re-suspended in 100 μl TE buffer. Finally, a ‘guanidine thiocyanate’-based method was used, as described by Duthoit et al. 2003.

Table 1.   Brief description of the principal of each extraction methods
MethodExtraction TypeSourcePrincipal
Modified QIAamp® DNA stool mini kit (Qiagen Ltd.)Solid-phase/column extractionCommercialCell lyses using chaotrophic agents, detergents, proteinase K and heating, uses an exclusive adsorption resin to remove impurities. DNA purification uses a silica-gel membrane.
Chemagic Food Basic kit (Chemagen Biopolymer-Technologie)Mobile solid-phase/magnetic bead extractionCommercialCell lyses using chaotrophic agents and RNAse A. Magnetic beads as solid-phase for binding target DNA.
Wizard® Magnetic DNA Isolation kit (Promega Inc.)Mobile solid-phase/magnetic bead extractionCommercialCell lyses using chaotrophic agents and RNAse A. DNA bound and purified using magnetic beads as solid-phase support.
Milk Bacterial DNA Isolation kit (Norgen Biotek Corp.)Solid-phase/column extractionCommercialCell lyses using chaotrophic agents and enzymes. DNA binding and purification using unique resin separation matrix and spin column chromatography.
PowerFood™ Microbial DNA Isolation kit (MoBio Laboratories Inc.)Solid-phase/column extractionCommercialCell lyses based on chaotrophic agents, mechanical lyses and inhibitor removal technology. DNA binding is based on silica membrane spin column.
Lytic method (In-house developed)Liquid–liquid extractionNoncommercialCell lyses using chaotrophic agents, enzymes and mechanical lyses. DNA extraction using phenol-chloroform and ethanol purification
Guanidine Thiocyanate method (Duthoit et al. 2003)Liquid–liquid extractionNoncommercialCell lyses using detergents, chaotrophic agents, mechanical lysis plus heat. DNA extraction using phenol-chloroform and ethanol purification

DNA Quantification measurement

The quantity of DNA extracted by the different methods was assessed using the Quant-It™ Picogreen® dsDNA reagent (Invitrogen Corporation, Carlsbad, CA, USA) used in accordance with the manufacturer’s instructions and a Nanodrop™ 3300 Fluorospectrometer (Thermo Fisher Scientific Inc, Waltham, MA, USA). The ND3300 excites in the presence of dsDNA bound with Picogreen® at 470 nm and monitors emission at 525 nm. DNA purity was assessed on the basis of absorbance at 260–280 nm using the NanoDrop 1000 (Thermo Fisher Scientific Inc). An A260/280 ratio of 1·8–2·0 is indicative of high purity (Pirondini et al. 2010).

PCR amplification of the bacterial community 16S rRNA gene

The DNA extracts were used as a template for PCR amplification of 16S rRNA tags (V4 region; 239 nt long) using universal 16S primers predicted to bind to 94·6% of all 16S genes, that is, the forward primer F1 (5′-AYTGGGYDTAAAGNG) and a combination of four reverse primers R1 (5′-TACCRGGGTHTCTAATCC), R2 (5′-TACCAGAGTATCTAATTC), R3 (5′-CTACDSRGGTMTCTAATC) and R4 (5′-TACNVGGGTATCTAATC) (RDP’s Pyrosequencing Pipeline: http://pyro.cme.msu.edu/pyro/help.jsp). The PCR contained 25 μl GoTaq Green Master Mix (Promega), 1 μl of each primer (10 pmol), 5 μl DNA template and H2O to give a final reaction volume of 50 μl. PCR amplification was performed using a G-Storm thermal cycler (G-Storm Ltd, Surrey, UK). The amplification programme consisted of an initial denaturation step at 94°C for 2 min, followed by 40 cycles; denaturation at 94°C for 1 min, annealing at 52°C for 1 min and extension at 72°C for 1 min. A final elongation step at 72°C for 2 min was also included. The PCR product was purified using the High Pure PCR Cleanup Micro Kit (Roche Diagnostics Ltd, Burgess Hill, West Sussex, UK) and quantified again using the Quant-It™ Picogreen® dsDNA reagent and the Nanodrop™ 3300. Quality and quantity was also assessed visually following agarose gel electrophoresis.

Purification and amplification of DNA from pathogen-spiked milk

Raw milk was artificially contaminated with Listeria monocytogenes EGDe (DPC6554) and Salmonella enterica serovar Typhimurium LT2 (Salmonella typhimurium) (DPC6048) at a level of 107, 105, 103 and 101 CFU ml−1. DNA was extracted from 1 ml sample of contaminated milk using the seven DNA extraction methods described above. The DNA extracts were used as a template for PCR amplification using species-specific primers (Table 2). The PCR contained 25 μl GoTaq Green Master Mix, 1 μl of each primer (10 pmol), 5 μl DNA template and H2O to give a final reaction volume of 50 μl. PCR amplification was performed using a G-Storm thermal cycler. The amplification programme consisted of an initial denaturation step at 94°C for 2 min, followed by 40 cycles, denaturation at 94°C for 30 s, annealing at 60°C for 1 min or 55°C for 30 s for L. monocytogenes and Salm. typhimurium, respectively, and extension at 72°C for 45 s. A final elongation step at 72°C for 2 min was also included. Success of the extraction protocol to extract Gram-positive and Gram-negative bacteria was determined by visual examination following gel electrophoresis.

Table 2.   Details of species-specific primers used for the amplification of Gram-negative and Gram-positive bacterial DNA extracts from spiked milk study
StrainTargetPrimerSequence (5′–3′)Annealing temperatureSize (bp)Reference
Listeria monocytogenes EDGeListeriolysin O genehlyA ForwardTGCAAGTCCTAAGACGCCA60°C113(Nogva et al. 2000)
hlyA ReverseCACTGCATCTCCGTGGTACTAA   
Salmonella typhimurium LT2Invasion geneinvA ForwardTCGTCATTCCATTACCTACC55°C119(Nam et al. 2005)
invA ReverseAAACGTTGAAAAACTGAGGA   

The suitability of extracted DNA for subsequent amplification by real-time PCR was assessed using species-specific primers and a SYBR Green 1 Master Mix (Roche) on the LightCycler® 480 platform (Roche). All PCRs were performed in triplicate. Amplicons were generated using species-specific primers (Table 2), targeting the single copy genes of L. monocytogenes and Salm. typhimurium, hlyA and invA, respectively. These amplicons were series diluted to generate a standard curve construct from 101 to 108 gene copies. Real-time PCR was subsequently carried out on DNA generated from the spiked milk samples. The PCR contained 10 μl SYBR Green 1 Master mix, 1 μl 10 pmol forward and reverse species-specific primers, 3 μl of nuclease-free water and 5 μl of DNA template. The cycling conditions were as follows: L. monocytogenes, 95°C for 5 min, 40 cycles of 95°C for 20 s, 60°C for 20 s and 72°C for 20 s; and Salm. typhimurium, 95°C for 5 min, 40 cycles of 95°C for 15 s, 55°C for 15 s and 72°C for 20 s. At the end of the cycle, the instrument showed the melting temperature (Tm) of the produced amplicons. The Tm of the amplicons were compared with the Tm of standard curve constructs. When the Tm corresponded with the Tm from the positive standards, we considered the reaction successful.

Results

Comparison of the yield and purity of DNA extracted from raw milk and a raw milk cheese using a variety of extraction methods

Seven methods, five solid-phase extraction and two liquid–liquid phase extraction (Table 1), were tested to compare their relative efficiency with respect to extracting DNA, on the basis of yield and purity, from raw milk and a soft, raw cow’s milk cheese. The yield and purity of genomic DNA varied with each method (and are summarized in Table 3). With respect to DNA yield from milk, the PowerFood™ Microbial DNA Isolation kit, Milk Bacterial DNA Isolation kit and ‘Lytic’ method were most successful. The ‘guanidine thiocyanate’ method provided the lowest yield (Table 3). The corresponding purity values revealed that while the ‘guanidine thiocyanate’ yield was low, the quality of this DNA was very high, that is, A260/280 ratio of 1·92. The PowerFood™ Microbial DNA Isolation kit and the QIAamp® DNA stool mini kit both also provided very pure DNA. Although the Milk Bacterial Isolation kit provided very good yields, the purity of this DNA was less impressive, and the purity of DNA extracted by the Chemagic Food Basic kit, Wizard® Magnetic DNA Isolation kit and the ‘Lytic’ method were somewhat lower.

Table 3.   Comparison of seven extraction methods assessed
SampleExtraction MethodDNA Yield ng ml−1 or g−1*DNA Purity (A260/280 nm)PCR Yield ng per rxn
  1. Results represent the mean ± standard error calculated from triplicate assessment in each case. Numbers 1–7 indicate the relative success of each method (i.e. 1 = best, 7 = worst) for each of the three assessment criteria.

  2. *Samples are standardized as DNA yield per ml of milk or per g of cheese.

  3. PCR yield is standardized according to PCR template volume of 5 μl.

  4. The high purity ratio indicates an excess of reagents from the extraction method which may interfere with downstream application of DNA.

MilkQIAamp® DNA stool mini kit382·34 ± 54·861·783947·22 ± 11·555
Chemagic Food Basic kit425·61 ± 73·351·275247·31 ± 2·996
Wizard® Magnetic DNA Purification System for Food676·42 ± 91·1141·236974·48 ± 11·974
Milk Bacterial Isolation kit835·96 ± 57·2921·5642518·03 ± 188·563
PowerFood™ Microbial DNA Isolation kit909·53 ± 6·011·8525132·86 ± 77·472
Lytic method776·42 ± 25·531·2365143·43 ± 62·971
Guanidine Thiocyanate method132·28 ± 24·3971·92169·82 ± 1·347
CheeseQIAamp® DNA stool mini kit2155·69 ± 55·8941·3967060·53 ± 50·714
Chemagic Food Basic kit1624·05 ± 95·152·301‡3648·06 ± 35·955
Wizard® Magnetic DNA Purification System for Food1308·91 ± 32·8261·0173092·16 ± 54·767
Milk Bacterial Isolation kit5283·10 ± 47·4231·5157068·13 ± 36·663
PowerFood™ Microbial DNA Isolation kit6756·14 ± 16·4721·9227303·86 ± 103·862
Lytic method7147·04 ± 10·8511·6348866·3 ± 50·71
Guanidine Thiocyanate method 336·54 ± 80·6871·8533642·23 ± 257·956

When the same methods were employed to extract DNA from a raw milk cheese, the highest yields were provided by the ‘Lytic’ method and the PowerFood™ Microbial DNA Isolation kit; here, the ‘guanidine thiocyanate’ method also provided the lowest DNA yield. It was established that purity of the DNA generated by the PowerFood™ Microbial DNA Isolation kit and ‘guanidine thiocyanate’ methods was highest but that generated using the Wizard® Magnetic DNA Isolation kit was very low. In addition, the DNA extracted using the Chemagic Food Basic kit provided an excessively high A260/280 ratio of 2·3 (Table 3), which is indicative of the inefficient removal of organic contaminants (Viltrop et al. 2010). As with low purity values, high A260/280 ratios indicate the likelihood of downstream difficulties when utilizing the extracted DNA.

Amplification of DNA extracted from raw milk and raw milk cheese

To further investigate the relative success of the seven extraction methods, the extracted DNA was used as a template for the amplification of bacterial 16S rRNA genes using universal PCR primers. Following their purification, the concentration of the PCR products generated was determined, again using the Quant-It™ Picogreen® dsDNA reagent/Nanodrop™ 3300 Fluorospectrometer. The concentration of the PCR products generated using DNA template extracted from milk varied considerably (Table 3), and for example, DNA generated using the ‘guanidine thiocyanate’ method was not successfully amplified. However, all seven methods extracted DNA from cheese that was efficiently amplified subsequently (Table 3).

Recovery of Gram-negative and Gram-positive bacteria as assessed by conventional PCR

While the approach described above highlights the relative abilities of the different approaches with respect to the extraction of total microbial DNA, of unknown origin, with a view to its subsequent amplification, many of the pathogenic microbes which are of greatest concern with respect to raw milk and raw milk cheese are from the Gram-negative Proteobacteria and the low G-C Gram-positive Firmicutes. Therefore, it was deemed important to determine the relative ability of the various kits to extract DNA to facilitate the PCR-based detection of representatives of these phyla in milk. To facilitate this, L. monocytogenes (a Firmicutes) and Salm. typhimurium (a Proteobacteria) were, respectively, introduced into raw milk at a range of levels between 107 and 101 CFU ml−1. DNA was extracted using the seven extraction methods, and the success of species-specific PCR assays (designed to amplify from hlyA and invA, respectively) was assessed. Visual examination of gel electrophoresis images revealed that PCR band intensity was greatest when template DNA was extracted using the Milk Bacterial Isolation kit, the PowerFood™ Microbial DNA Isolation kit and the ‘Lytic’ method (Fig. 1). The Qiagen DNA stool mini kit, Chemagic Food Basic kit, Wizard® Magnetic DNA purification system and the guanidine thiocyanate method led to the efficient extraction and amplification of Salm. typhimurium DNA at all concentrations but were less successful when milk was spiked with L. monocytogenes at low concentrations.

Figure 1.

 The ability of the seven DNA extraction methods to extract DNA from Gram positive Listeria monocytogenes EDGe and Gram negative Salmonella typhimurium LT2, suitable for downstream PCR application, as revealed by gel electrophoresis imaging.

Improvement of DNA yield and PCR efficiency

Of the seven extraction methods, the PowerFood™ Microbial DNA Isolation kit and the ‘Lytic’ methods provided the most impressive results. Of these, the former has the advantage of being more rapid and does not require the use of harmful chemicals such as phenol and, thus, became the focus of further attention. More specifically, investigations were carried out to determine whether additional ‘troubleshooting’ steps provided within the manufacturer’s instructions can further increase DNA yield and quality. Briefly, the respective success of four supplemental steps was assessed. These involved an additional heat treatment of samples at (i) 65°C or (ii) 70°C for 10 min prior to step 5 of the extraction process as described by the manufacturers, (iii) a 65°C heat treatment followed by the exclusion of the two subsequent steps of the process or (iv) the further concentration of DNA at the end of the process through ethanol precipitation. The success of a fifth modification, whereby the enzymatic treatment employed by the ‘Lytic’ method was introduced prior to step 5, was also assessed. In all cases, the inclusion of additional steps did not further enhance the yield of DNA from cheese (Table 4). Indeed, in the case of the additional ethanol precipitation step, the final yield was greatly reduced from 9062 to 4673 ng ml−1. Although ethanol precipitation also impacted negatively on the yield of DNA from milk (439 ng ml−1), each of the other steps brought about a major increase in DNA yields (Table 4). However, a heat treatment at 70°C for 10 min followed by 10 min of vortexing was most successful in that a yield increase from 896 to 3471 ng ml−1 resulted. The purity of the DNA extracted with these supplementary steps was measured. Again the results showed the ability of the PowerFood™ Microbial DNA Isolation kit to extract high-quality, pure DNA with A260/280 readings ranging between 1·72 and 2·0 from both milk and cheese extracts.

Table 4.   Results for attempts at improving the yield of DNA extracted using the PowerFood™ Microbial DNA Isolation kit
SampleMethodDNA YieldA ng ml−1 or g−1DNA Purity (A260/280 nm)PCR YieldB ng per rxn
  1. Results represent the mean ± standard error calculated from triplicate assessment in each case.

  2. C: control, that is, kit without additional steps: 1, heating sample to 65°C for 10 min; 2, heating samples to 65°C for 10 min with occasional vortexing; 3, heating samples to 75°C for 10 min; 4, ethanol precipitation on eluted DNA; 5, incorporation of enzymes with solution PF1, that is, 50 μg ml−1 lysozyme and 100 U mutanolysin incubated at 37°C for 1hr followed by 250 μg ml−1 proteinase K for 1 h at 55°C.

  3. Numbers 1–6 indicate the relative success of each method (i.e. 1 = best, 6 = worst) for each of the three assessment criteria. A: Samples are standardized as DNA yield per ml of milk or per g of cheese; B: PCR yield is standardized according to PCR template volume of 5 μl.

  4. *A statistical significance was observed between the control sample and the additional steps to improve DNA extraction < 0·05.

MilkC896·65 ± 52·7051·7254997·06 ± 53·425
1*2713·96 ± 40·7731·8335403·7 ± 69·824
2*3255·1 ± 20·321·7946568·6 ± 144·392
3*3471·53 ± 119·1512·0016934·13 ± 27·281
4*439·56 ± 32·0161·841776·6 ± 33·086
5*2316·36 ± 38·9441·8415596·3 ± 92·73
CheeseC9062 ± 110·9521·97111224·87 ± 25·722
18162·83 ± 234·2351·8049606·33 ± 90·745
28492·53 ± 208·2341·7959899·26 ± 46·044
39079·2 ± 63·1311·79510139·33 ± 79·683
4*4673 ± 89·9261·83310009·4 ± 35·111
58893·76 ± 172·4531·8929467·13 ± 126·386

Subsequent 16S rRNA gene amplification determined the suitability of DNA from the additional steps for PCR amplification. After purification of the resultant amplicons, its concentration was determined (Table 4). The concentration of the PCR products generated, using DNA template extracted from milk, was considerable except in cases where ethanol precipitation was employed. More specifically, it was revealed that all other treatments led to enhanced amplicon yield relative to the control and were greatest when method 3 was employed, that is, the method incorporating a heat treatment at 70°C and 10 min. In contrast, amplicon concentrations from DNA extracted from cheese were greatest when the unaltered, standard method was employed.

Given that real-time PCR provides a more rapid means of detecting pathogens in food, the success with which DNA extracted using the PowerFood™ Microbial DNA could be amplified by real-time was assessed. To facilitate this, standard curves were constructed using a range of different concentrations, between 101 and 108 gene copies per microlitre of hlyA and invA from L. monocytogenes and Salm. typhimurium, respectively (Fig. 2a,c). The efficiency of the constructs was 1·94 and 1·81, respectively. This is a critical parameter in validating the standard curve construct; it was determined by preparing a minimum five-log dilution series. These values provide good confidence in the accuracy and sensitivity of the method (Larionov et al. 2005). A single product peak at approx. 77°C for the hlyA product and approx. 79°C for the invA product was observed representing the specific melting temperature (Tm) (Fig. 2b,d, respectively). Real-time PCR of DNA extracts from spiked milk accurately detected and quantified the pathogens when present at concentrations of 107, 105, 103 and 101 CFU ml−1. (Fig. 2e,f) thereby establishing that DNA extract from milk using the PowerFood™ Microbial DNA Isolation kit can also be successfully employed for subsequent real-time PCR amplification.

Figure 2.

 Real-time PCR standard curve construction, (a) Standard curve of Listeria monocytogenes hlyA gene, efficiency of 1·94; (B) melting curve analysis of standard curve product of hlyA gene; (c) standard curve of Salmonella typhimurium invA gene, efficiency of 1·81; (d) melting curve analysis of standard curve product of invA gene. Melting curve of real-time PCR analysis of DNA extracted, by PowerFood™ Microbial DNA Isolation kit, from raw milk spiked with 107, 105, 103, 101 CFU ml−1 of (e) L. monocytogenes EDGe and (f) Salm. typhimurium LT2.

Discussion

DNA-based molecular analysis of an environment requires the efficient extraction of DNA from that environment. Here, seven methods were assessed to compare their relative success with respect to the extraction of DNA from raw milk and raw milk cheese, as well as their ability to extract DNA from both Gram-positive and Gram-negative micro-organisms. More specifically, these were examined to assess their relative ability to extract DNA at a high concentration and facilitate subsequent PCRs, with the latter depending on the successful removal of inhibitors. While all of the methods were highly successful with respect to the extraction of DNA from cheese, the extraction of DNA from milk varied more dramatically from one approach to another.

The QIAamp® DNA stool mini kit, designed for efficient extraction of DNA from faecal samples (Li et al. 2003), on one previous occasion provided poor DNA yields from fresh whole milk and a cow’s milk cheese as well as butter, cream and yoghurt (Pirondini et al. 2010). Here, we tested this kit with an additional modification, suggested to improve its use in food products, yielding efficient nucleic acid extraction from cheese. However, the yield from milk was poor resulting in poor PCR amplification, thus suggesting the modification is not suitable for all food matrices. Similarly, the Chemagic Food Basic kit and the Wizard® Magnetic DNA Purification System for Food both recovered DNA from cheese that was readily amplified; the DNA extracted by these kits from raw milk was not sufficient. It was previously noted that the use of the Chemagic Food Basic kit to extract DNA from fermented cereals also resulted in a poor yield and a low number of bands from subsequent molecular fingerprinting (Abriouel et al. 2008) and that the Wizard® Magnetic DNA Purification System for Food is not ideally suited to the extraction of DNA from pasteurized milk but was more efficient when used for extractions from vegetable matrices rich in polysaccharides and polyphenolics (Di Pinto et al. 2007). Both the Chemagic Food Basic kit and the Wizard® Magnetic DNA Purification System for Food are based on mobile solid-phase, magnetic bead DNA separation. The inefficient extraction of DNA by these kits suggests that this technology is not as efficient as other solid-phase extraction methods. The ‘guanidine thiocyanate’ method, although previously employed in studies where the extraction of DNA from milk was successful (Callon et al. 2007; Delbes et al. 2007), was not among the more efficient methods employed here as DNA yields were quite low. Here, we also determined that although these four approaches led to successful detection of pathogens spiked into milk, they were less efficient when pathogen levels were low.

Three methods were found to be particularly effective at extracting both total genomic DNA, as well as DNA from the representative Gram-positive and Gram-negative pathogens. These were the Milk Bacterial Isolation kit, PowerFood™ Microbial DNA Isolation kit and the ‘Lytic’ method. The Milk Bacterial Isolation kit, which has been employed successfully on previous occasions to extract bacterial DNA from milk (He et al. 2009; Rouvinen 2010), was found to also facilitate the extraction of high-quality DNA from raw milk. Although designed specifically for milk, we also highlight the efficiency of this kit to extracted DNA from cheese, and thus, it could potentially be applied to other dairy products. The PowerFood™ Microbial DNA Isolation kit provided highly pure and concentrated DNA from milk and cheese, which in return provided very concentrated PCR amplicons. Notably, both of these methods are based on column extraction-based protocols. Finally, the ‘Lytic’ method provided the highest DNA return from cheese and generated the most concentrated amplicons from DNA extracted from either milk or cheese. The inclusion of enzymes has shown previous success in DNA extraction from dairy environments (Parayre et al. 2007; Dolci et al. 2008). Based on the performance of all of the methods with respect to DNA yield, purity and PCR amplification, the PowerFood™ Microbial DNA Isolation kit and ‘Lytic’ method were deemed to be the most successful with regard to the extraction of DNA from raw milk and raw milk cheese. The final decision as to which method should be selected for further optimization was made by considering the duration of the assays and labour intensity required. Notably, with respect to the ‘Lytic’ method, all reagents had to be prepared in advance and a number of incubation periods, including an over-night incubation step, resulted in a completion time of approx. 20 h. The PowerFood™ Microbial DNA Isolation kit, a commercial kit, came in a ready-to-use form and was completed in approx. 1 h. Thus, as a consequence of its rapidity, the PowerFood™ Microbial Isolation kit was deemed the most attractive extraction option and was subjected to further investigation. To determine whether its yields could be further improved upon, a number of modifications were tested. These did not improve yields from cheese, which were already quite high, but milk extractions were significantly improved (P = 0·005). This improvement was most notable after heating of the sample at 70°C for 10 min.

To further assess the suitability of the PowerFood™ Microbial Isolation kit with respect to the detection and quantification of pathogens in milk, milk spiked with L. monocytogenes and Salm. typhimurium was again employed. Notably, these species are recognized worldwide as the leading causes of foodborne illness and are of major concern, not only to the dairy industry, but to the food industry as a whole (Nyachuba 2010). While conventional PCR methods can determine the presence of a bacterium, these protocols are being replaced by more convenient and rapid real-time PCR assays, allowing the detection and accurate quantification of microbes in a matter of hours. However, as with other DNA-based assays, the success of real-time PCR is dependent on the success with which template DNA can be extracted. Here, we have shown the ability of the PowerFood™ Microbial DNA Isolation kit to facilitate the detection of these foodborne pathogens at levels as low as 101 CFU ml−1.

Conclusion

In conclusion, it was determined that of the seven methods, the PowerFood™ Microbial DNA Isolation kit was best suited to the extraction of total DNA from raw milk and raw milk cheese in that it rapidly generated highly concentrated DNA, which was very pure and which served well as a template for subsequent PCR amplifications. We also established that this kit efficiently extracted DNA from representative Gram-positive and Gram-negative pathogens and facilitated subsequent amplification of targets by conventional and real-time PCR. To our knowledge, this is the first report of the PowerFood™ Microbial DNA Isolation kit being used to extract DNA from dairy products.

Acknowlegements

Lisa Quigley is the recipient of a Teagasc Walsh Fellowship.

Ancillary

Advertisement