Bacteriocinogenic and virulence potential of Enterococcus isolates obtained from raw milk and cheese

Authors

Errata

This article is corrected by:

  1. Errata: Corrigendum Volume 113, Issue 6, 1564, Article first published online: 16 November 2012

  • This research was developed in the laboratories of the Veterinary Department, Viçosa Federal University, and in the Pharmaceutical Sciences Faculty, São Paulo University.

Correspondence

Luís Augusto Nero, Departamento de Veterinária, Universidade Federal de Viçosa, 36570-000 Viçosa, MG, Brazil. E-mail: nero@ufv.br

Abstract

Aims

To provide molecular and phenotypical characterization of Enterococcus isolates obtained from raw milk and cheese, regarding their bacteriocinogenic and virulence activity.

Methods and Results

Forty-three bacteriocinogenic enterococci isolates were identified by 16s rDNA, fingerprinted by RAPD-PCR analysis and tested by PCR for the presence of genes for lantibiotics (lanM, lanB and lanC) and enterocins (entA, entB, entP, entL50AB and entAS48) and by phenotypical methods for bacteriocin production and inhibitory spectrum. Also, the virulence of the isolates was evaluated by PCR for genes gelE, hyl, asa1, esp, cylA, efaA, ace, vanA, vanB, hdc1, hdc2, tdc and odc and by phenotypical tests for gelatinase, lipase, DNAse and α- and β-haemolysis. Most isolates (93·0%) harboured at least one lantibiotic or enterocin gene and were positive for several tested virulence genes, mainly asa1 (100%), gelE (93·0%) and efaA (83·7%). 53·5% of the isolates presented β-haemolysis.

Conclusions

Enterococcus spp. isolates presented an interesting potential application for food preservation because of bacteriocin production; however, virulence-related genes were identified in all RAPD profiles.

Significance and Impact of the Study

The study demonstrated the contradictory characteristics of the tested Enterococcus isolates: they presented a good potential for application in food biopreservation but contained several virulence factors.

Introduction

Enterococcus spp. are lactic acid bacteria (LAB) that are commensally present in the animal gastrointestinal system. They differ from other Gram-positive and catalase-negative cocci in several phenotypic traits, such as capability to survive and grow in moderately restrictive conditions: (i) between 10 and 45°C (ii) in hypersaline solutions (iii) at pH 9·6 and (iv) in 4·0% bile. In addition, they retain their viability after heated to 60°C for 30 min (Franz and Holzapfel 2004; Ogier and Serror 2008). These micro-organisms are frequently associated with many foods from animal (dairy and meat products) and vegetable origins (Franz et al. 2003; Giraffa 2003; Todorov and Dicks 2005; Dal Bello et al. 2010).

Owing to their tolerance to salts and acids, Enterococcus spp. are highly adapted to several food systems. They are often found in high numbers and are believed to contribute to cheese ripening and to the development of aroma, especially in cheese products made in the Mediterranean area (Giraffa 2002; Foulquié-Moreno et al. 2006), because of proteolysis and lipolysis and production of diacetyl (Giraffa 2003).

Some enterococci strains, especially from Ent. faecalis, Ent. faecium and Ent. mundtii species, are able to produce bacteriocins, active against relevant spoilage and pathogenic micro-organisms in foods, such as Listeria monocytogenes (Khan et al. 2010; Kumar and Srivastava 2010; Bayoub et al. 2011; Javed et al. 2011). Most bacteriocins produced by enterococci belong to class II (Franz et al. 2007). Examples of well-characterized bacteriocins produced by enterococci are enterocins A, P, CRL35, 1071A and B, and L50A and B, mundticins KS, ST4V and ST15, bacteriocin 31, RC714, T8, and enterolisin A (Cintas et al. 1998; de Kwaadsteniet et al. 2005; Todorov et al. 2005; Franz et al. 2007).

Some enterococci have been investigated with regard to their potential as probiotics (Franz et al. 2003; Foulquié-Moreno et al. 2006; Todorov and Dicks 2008). However, their role as probiotics is still controversial because of their increased association with nosocomial infections and harbourage of multiple antibiotic-resistant genes, transmissible by conjugation to nonpathogenic micro-organisms (Franz et al. 2011; Montalban-Lopez et al. 2011). In addition, several putative virulence factors have been described in enterococci, such as aggregation substance protein, gelatinase, cytolysin, enterococcal surface proteins, hyaluronidase, accessory colonization factors and endocarditis antigens (Vankerckhoven et al. 2004; Martin-Platero et al. 2009).

Previous studies have shown that bacteriocinogenic LAB, including Enterococcus spp., are common in Brazilian dairy products (Gomes et al. 2008; Frazzon et al. 2010; Moraes et al. 2010; Ortolani et al. 2010). In this study, selected Enterococcus spp. isolates obtained from raw milk and cheese were better characterized for their bacteriocinogenic potential and tested for their virulence features, using genotypic and phenotypic tests for both evaluations.

Materials and methods

Micro-organisms

The study was carried out with forty-three Enterococcus spp. isolates (named En01 to En43) selected among a LAB culture collection previously obtained from raw milk and cheese in Minas Gerais state, Brazil (Moraes et al. 2010; Ortolani et al. 2010), and capable of producing antimicrobial substances (Moraes et al. 2010). All isolates were submitted to identification based on 16S rDNA sequencing, according Sterr et al. (2009), to confirm the genus identification. Other bacteria used in this study are listed in Table 1. Enterococci strains were stored at −80°C in MRS broth (Oxoid Ltd, Basingstoke, UK) supplemented with 25% (v/v) glycerol. Listeria spp. and Staphylococcus spp. strains were stored at −80°C in tryptic soy broth supplemented with 0·6% (w/v) yeast extract (TSB-YE) (Oxoid).

Table 1. Bacterial strains used in the study
Groups or generaDescriptionaObservationsReferences
  1. a

    ATCC: American Type Culture Collection, Manassas, VA, USA.

Lactic acid bacteria43 Enterococcus spp. isolates (named En01 to En43)Obtained from raw milk and soft cheeseOrtolani et al. 2010; Moraes et al. 2010.
Ent. faecalis FAIR-E179, Ent. faecalis FAIR-E77, Ent. faecium FAIR-E178, Ent. faecium BFE1072Bacteriocinogenic strains used as positive controls for identification and enterocin PCRsProvided by Prof. Charles Franz
Lactococcus lactis subsp. lactis DPC3147, Lact. lactis subsp. lactis DY13Bacteriocinogenic strains used as positive controls for lantibiotic biosynthesis PCRsProvided by Dr. Philip Wescombe
Lactobacillus sakei (ATCC 15521), Lact. lactis subsp. lactis (ATCC 7962, ATCC 11007), Lact. plantarum (ATCC 8014), Enterococcus faecalis (ATCC 19433), Lact. delbrueckii subsp. bulgaricus (ATCC 11842)Reference strains used as target in antagonism tests
Enterococcus spp. (4 isolates), Lact. plantarum (2 isolates)Wild isolates obtained from raw milk and cheese and used as target in antagonism testsOrtolani et al. 2010;
Lact. sakei subsp. sakei 2aIsolated from pork sausage, utilized as positive control in antagonism testsde Martinis and Franco 1998;
Listeria spp.Listeria inoccua (ATCC 33090), L. ivanovii subsp. ivanovii (ATCC 19119), L. monocytogenes (ATCC 15313, ATCC 19112, ATCC 19117, ATCC 7644)Reference strains used as target in antagonism tests
L. monocytogenes (3 isolates), L. seeligeri (1 isolate), L. inoccua (1 isolate), L. welshimeri (1 isolate)Wild isolates obtained from beef and used as target in antagonism testsBarros et al. 2007;
Staphylococcus spp.Staphylococcus aureus (ATCC 14458, ATCC 12598, ATCC 8095, ATCC 29213, ATTC 12600, ATCC 23235)Reference strains used as target in antagonism tests
Staph. aureus (6 isolates)Wild isolates obtained from raw milk and cheese and used as target in antagonism testsViçosa et al. 2010

Fingerprinting of Enterococcus spp. by RAPD-PCR

After checking the purity of isolates by streaking them on MRS agar (Oxoid) at 35°C for 24 h, isolates colonies were transferred to MRS broth and incubated at 35°C for 24 h. The obtained cultures were then diluted in MRS broth (Oxoid) until MacFarland 1 turbidity, correspondent to approximately 3 × 108 colony-forming units per millilitre (CFU ml−1). The cultures were centrifuged at 14 000 g for 2 min, and DNA was extracted using ZR Fungal/Bacterial DNA kit (Zymo Research, Irvine, CA, USA). The DNA concentration in the extract was determined in a NanoDrop2000 (Thermo Scientific Inc., Waltham, MA, USA). PCR was performed using primers OPL-01 and OPL-02 (Kit L of the RAPD® 10mer kits, Operon Biotechnologies, Cologne, Germany), and amplification was performed according to Todorov and Dicks (2009). The 25 μl reaction contained 5 μl of primers, 2·5 μl of 10× rTaq Buffer (Takara Bio Inc., Shiga, Japan), 10 μl of 5 m l−1 MgCl2 (Roche Group, Basel, Switzerland), 4 μl of 2·5 m l−1 dNTPs (Takara Bio) and 0·5 μl of rTaq DNA polymerase (Takara Bio). Amplification was performed using a DNA thermal cycler (GeneSystem® PCR System 7900, AB Applied Biosystems, Carlsbad, CA, USA) with the following programme: 45 cycles at 94°C for 1 min, 36°C for 1 min and 72°C for 2 min followed by an extension of the amplified product at 72°C for 5 min. The amplified products were separated by electrophoresis on 1·4% (w/v) agarose gels in 1× TAE buffer at 100 V for 1 h. Gels were stained with TAE buffer containing 0·5 μg ml−1 ethidium bromide (Sigma-Aldrich Co., St Louis, MO, USA). Banding patterns were analysed using Gel Compare software (ver. 4·1; Applied Maths, Kortrijk, Belgium).

Characterization of bacteriocinogenic potential

Sensitivity to proteolytic enzymes

All Enterococcus spp. isolates were tested to verify the enzymatic sensitivity of their antimicrobial substance production (Lewus et al. 1991). Aliquots of 1 μl of each culture were spotted on the surface of plates containing MRS agar prepared with 0·5% (w/v) dextrose (modified MRS, mMRS), and the plates were incubated at 25°C for 24 h under anaerobiosis (Anaerobac, Probac do Brasil, São Paulo, SP, Ltda.). After incubation, 3-mm-diameter wells were cut adjacent to the colonies and filled with 20 μl of a solution containing α-chymotrypsin, proteinase K, trypsin TPCK, α-amylase type XII-A, papain, Streptomyces griseus protease, lysozyme or catalase (20 mg ml−1). All enzymes were from Sigma-Aldrich. After 30 min at room temperature, the plates were overlaid with 8 ml of brain-heart infusion (BHI, Oxoid) containing 0·8% (w/v) agar and a culture of L. monocytogenes ATCC 7644 (105 CFU ml−1) and incubated at 35°C for 24 h. Absence of inhibition halos around the spotted enzymatic solutions indicated the proteinaceous nature of the antimicrobial substance produced by the tested isolate. A culture of Lactobacillus sakei 2a (de Martinis and Franco 1998) and sterile Milli-Q water were used as positive and negative controls, respectively.

Spectrum of activity

All isolates were tested for their inhibitory activity against 36 target pathogenic micro-organisms and LAB listed in Table 1, according to Lewus et al. (1991). Aliquots of 1 μl of the cultures of each isolate in MRS were spotted on the surface of mMRS agar plates and incubated at 25°C for 24 h, under anaerobiosis (Anaerobac, Probac do Brasil Ltda.). The plates were overlaid with 8 ml of TSB-YE or mMRS containing 0·8% (w/v) agar and a culture of the target bacteria (105 CFU ml−1) and incubated at 35°C for 24 h. The presence of an inhibition halo of at least 5 mm diameter around the spotted Enterococcus cultures indicated inhibitory activity against the target strain.

Tests for the presence of genes for known bacteriocins producted by enterococci

Aliquots of 1 ml of the Enterococcus spp. cultures were centrifuged at 14 000 g for 2 min, and the cell pellets were submitted to DNA extraction using DNA Purification Kit Wizard Genomic (Promega Corp., Madison, WI, USA). The obtained total DNA was then mixed with 20× GelRed stain (Biotium Inc., Hayward, CA, USA) at a 5 : 1 proportion and submitted to electrophoresis in 1% agarose gel in 0·5× TBE, to check the integrity of the material for molecular analysis. The extracted DNA was submitted to PCR for amplification of genes lanB, lanC and lanM, responsible for lantibiotics synthesis, according to Wirawan et al. (2006) and Hyink et al. (2005). For each primer pair, the reaction was composed by 12·5 μl of PCR kit GoTaq Green Master Mix 2× (Promega), 1·0 μl of each primer (100 pMol μl−1), 0·3 μl of extracted DNA and ultra-pure PCR water for a final volume of 25 μl. The PCR conditions consisted of initial denaturation at 95°C for 2 min, followed by 30 cycles at 95°C for 30 s, 40°C for 30 s and 65°C for 30 s, and the final extension step at 65°C for 10 min. The amplification products were then mixed with 20× GelRed stain (Biotium) at a 5 : 1 proportion and submitted to electrophoresis in 1% agarose gel in 0·5× TBE. The same DNAs were submitted to PCR for the detection of genes responsible for the synthesis of enterocins A, P, B, AS-48 and L50AB (Du Toit et al. 2000). PCR was performed using primers at 10 pMol μl−1 and initial denaturation at 94°C for 5 min, followed by 30 cycles at 94°C for 1 min, specific annealing temperature for 1 min and 72°C for 1 min, and the final extension step at 72°C for 10 min. The PCR products were analysed as described for lantibiotic biosynthesis genes. The PCR conditions are summarized in Table 2.

Table 2. Primers sequences utilized in the investigation of positive results for genes for lantibiotics, enterocins, virulence factors, vancomycin resistance and biogenic amine production
TargetGenesaPrimersAnnealing temperatureFragment size (bp)References
  1. a

    lanM, lanB, lanC (lantibiotics biosynthesis), gelE (gelatinase), hyl (hyaluronidase), asa1 (aggregation substance), esp (enterococcal surface protein), cylA (cytolisin), efaA (endocarditis antigen), ace (adhesion of collagen), vanA and vanB (vancomycin resistance), hdc1 and hdc2 (histidine decarboxylase), tdc (tyrosine decarboxylase) and odc (ornithine decarboxylase).

Lantibiotics biosynthesislanM

ATGCWAGWYWTGCWCATGG

CCTAATGAACCRTRRYAYCA

40°C200–300Hyink et al. 2005
lanB

TATGATCGAGAARYAKAWAGATATGG

TTATTAIRCAIATGIAYDAWACT

40°C400–500Wirawan et al. 2006
lanC

TAATTTAGGATWISYIMAYGG

ACCWGKIIIICCRTRRCACCA

40°C200–300Wirawan et al. 2006
EnterocinsA

CATCATCCATAACTATATTTG

AAATATTATGGAAATGGAGTGTAT

56°C126Du Toit et al. 2000
B

GAAAATGATCACAGAATGCCTA

GTTGCATTTAGAGTATACATTTG

58°C162Du Toit et al. 2000
P

TATGGTAATGGTGTTTATTGTAAT

ATGTCCCATACCTGCCAAAC

58°C120Du Toit et al. 2000
L50AB

STGGGAGCAATCGCAAAATTAG

ATTGCCCATCCTTCTCCAAT

56°C98Du Toit et al. 2000
AS48

GAGGAGTITCATGATTTAAAGA

CATATTGTTAAATTACCAAGCAA

56°C340Du Toit et al. 2000
VirulencegelE

TATGACAATGCTTTTTGGGAT

AGATGCACCCGAAATAATATA

47°C213Vankerckhoven et al. 2004
hyl

ACAGAAGAGCTGCAGGAAATG

GACTGACGTCCAAGTTTCCAA

53°C276Vankerckhoven et al. 2004
asa1

GCACGCTATTACGAACTATGA

TAAGAAAGAACATCACCACGA

50°C375Vankerckhoven et al. 2004
esp

AGATTTCATCTTTGATTCTTG

AATTGATTCTTTAGCATCTGG

47°C510Vankerckhoven et al. 2004
cylA

ACTCGGGGATTGATAGGC

GCTGCTAAAGCTGCGCTT

52°C688Vankerckhoven et al. 2004
Antibiotic resistanceefaA

GCCAATTGGGACAGACCCTC

CGCCTTCTGTTCCTTCTTTGGC

57°C688Martin-Platero et al. 2009
ace

GAATTGAGCAAAAGTTCAATCG

GTCTGTCTTTTCACTTGTTTC

48°C1008Martin-Platero et al. 2009
vanA

TCTGCAATAGAGATAGCCGC

GGAGTAGCTATCCCAGCATT

52°C377Martin-Platero et al. 2009
vanB

GCTCCGCAGCCTGCATGGACA

ACGATGCCGCCATCCTCCTGC

60°C529Martin-Platero et al. 2009
Biogenic amineshdc1

AGATGGTATTGTTTCTTATG

AGACCATACACCATAACCTT

46°C367Rivas et al. 2005
hdc2

AAYTCNTTYGAYTTYGARAARGARG

ATNGGNGANCCDATCATYTTRTGNCC

50°C534Rivas et al. 2005
tdc

GAYATNATNGGNATNGGNYTNGAYCARG

CCRTARTCNGGNATAGCRAARTCNGTRTG

55°C924Rivas et al. 2005
odc

GTNTTYAAYGCNGAYAARCANTAYTTYGT

ATNGARTTNAGTTCRCAYTTYTCNGG

54°C1446Rivas et al. 2005

Characterization of virulence potential

Genotypic tests

The Enterococcus spp. isolates were tested for virulence genes gelE (gelatinase), hyl (hyaluronidase), asa1 (aggregation substance), esp (enterococcal surface protein), cylA (cytolisin), efaA (endocarditis antigen), ace (adhesion of collagen), vanA and vanB (both related to vancomycin resistance) and genes for amino acid decarboxylases hdc1 and hdc2 (both related to histidine decarboxylase), tdc (tyrosine decarboxylase) and odc (ornithine decarboxylase), using PCR protocols of Martin-Platero et al. (2009), Rivas et al. (2005) and Vankerckhoven et al. (2004). The amplified products were separated by electrophoresis on 0·8–2·0% (w/v) agarose gels in 1× TAE buffer. Gels were stained in TAE buffer containing 0·5 μg ml−1 ethidium bromide (Sigma-Aldrich). Primers, annealing temperatures and fragment sizes are detailed in Table 2.

Phenotypic tests

Enterococcus spp. isolates were tested for haemolytic activity and production of gelatinase, lipase and DNAse according to Barbosa et al. (2010). For haemolytic activity, 1 μl aliquots of the cultures were spotted onto plates containing TSA (Oxoid) added to 5% (v/v) defibrinated horse blood and incubated at 37°C for 48 h. Clear halos around the colonies indicated total or α-haemolysis, and green halos around the colonies indicated partial or β-haemolysis. Absence of halos around the colonies was interpreted as no haemolytic activity (γ-haemolysis). For gelatinase production, 1 μl aliquots of isolates cultures were spotted on plates containing Luria–Bertani agar (LB, Becton, Dickinson & Co.; Franklin Lakes, NJ, USA) supplemented with 3% (w/v) gelatine and incubated at 37°C for 48 h, followed by incubation at 4°C for 4 h. Opaque halos around the colonies were recorded as positive results. For lipase production, 1 μl aliquots of isolates cultures were spotted onto plates containing LB agar (BD) supplemented with 0·2% (w/v) CaCl2 and 0·1% (w/v) Tween 80 (Sigma-Aldrich) and incubated at 37°C for 48 h. Opaque halos around the colonies were recorded as positive results. For DNAse production, 1 μl aliquots of the isolate cultures were spotted onto plates containing DNAse methyl green agar plates (BD) and incubated at 37°C for 48 h. Clear halos around the colonies were recorded as positive results. All tests were conducted in triplicate.

Results

On the basis of 16s rDNA sequencing, all isolates were confirmed as Enterococcus. The RAPD profiles of the isolates are presented in Table 3. The 43 isolates belonged to 20 distinct RAPD profiles, and III and IV grouped the largest number of isolates: 9 and 6, respectively.

Table 3. Distribution of the Enterococcus spp isolates obtained from raw milk and cheese grouped according to the RAPD profile
RAPD profilenIsolates
  1. n, number of isolates.

I5En01, En02, En04, En14, En15
II2En02, En27
III9En05, En09, En11, En12, En32, En36, En37, En39, En42
IV6En06, En08, En22, En28, En35, En38
V1En07
VI1En10
VII2En13, En17
VIII3En16, En18, En19
IX1En20
X1En21
XI1En23
XII1En24
XIII1En25
XIV1En28
XV1En29
XVI1En30
XVII1En31
XVIII2En33, En34
XIX2En40, En43
XX1En41

The antimicrobial substances produced by most isolates were sensitive to α-chymotrypsin, proteinase K and trypsin, indicating their proteinaceous nature. The inhibitory spectrum of activity of the Enterococcus isolates is shown in Table 4. Lantibiotic and enterocin genes were present in the majority of Enterococcus groups (Table 5). Lantibiotic biosynthesis genes were present in distinct associations, and enterocin P gene was the most frequent (isolates of 11 profiles). Enterocin L50AB gene was not detected in any of the isolates. Several profiles presented isolates with more than one enterocin gene, and the most frequent association was for enterocins A and P genes.

The antimicrobial substances produced by most isolates were sensitive to α-chymotrypsin, proteinase K and trypsin, indicating their proteinaceous nature. The inhibitory spectrum of activity of the Enterococcus isolates is shown in Table 4. Lantibiotic and enterocin genes were present in the majority of Enterococcus groups (Table 5). Lantibiotic biosynthesis genes were present in distinct associations, and enterocin P gene was the most frequent (isolates of 11 profiles). Enterocin L50AB gene was not detected in any of the isolates. Several profiles presented isolates with more than one enterocin gene, and the most frequent association was for enterocins A and P genes.

Table 4. Inhibitory activity of Enterococcus isolates according to the RAPD profile and the number of tested target micro-organisms
RAPD profileTarget bacteria (number of tested strains)
Staphylococcus aureus (12)Listeria monocytogenes (7)L. innocua (2)L. ivanovii subsp. ivanovii(1)L. seeligeri (1)L. welshimeri (1)Enterococcus faecalis (4)Enterococcus spp. (1)Lactobacillus plantarum (3)Lact. lactis lactis (2)Lact. delbrueckii subsp. bulgaricus (1)Lact. sakei (1)
  1. a

    Variability of the number of strains inhibited by Enterococcus spp isolates belonging to the same RAPD profile (Table 3).

I1–10a1–60–20–10–10–12–310–1000–1
II5–75–620–111310–1001
III1–113–71–20–10–113–410–30–20–11
IV2–105–70–20–10–112–40–11–30–20–11
V1252111310001
VI472111413201
VII2–30–300001–20–100–10–11
VIII1–83–6201131000–11
IX472111310000
X241011310001
XI862111411101
XII1072221103101
XIII1062220113112
XIV031110002000
XV1172221113100
XVI1061111112100
XVII172220114022
XVIII6–126222111412–32
XIX5–75–71–21–21–21112–310–20–2
XX842221114012
Table 5. Positive results (+) for genes for lantibiotics biosynthesis and enterocins in Enterococcus spp isolates belonging to 20 RAPD profiles
RAPD profileLantibiotic genesEnterocins genes
lanBlanClanML50ABAS48PAB
I++++
II++
III+++++
IV+++++
V++
VI++
VII+++
VIII++++
IX+
X+
XI
XII+
XIII
XIV+
XV+
XVI+
XVII++
XVIII++
XIX++
XX

With regard to evaluation of the virulence potential of the Enterococcus isolates, results varied in an RAPD profile–dependent format (Table 6). All profiles harboured isolates that contained the gene for aggregation substance production (asa1), and only isolates from profile VIII were negative for gelatinase gene (gelE). For amino acid decarboxylase, the gene for tyrosine descarboxylase (tdc) was more common, detected in the majority of profiles. Concerning vancomycin resistance genes, two profiles (V and XVI) presented vanA, and one (XVII) presented vanB. The isolates presented also variable results in the phenotypical testing for virulence (Table 7), and most of the profiles presented β-haemolysis.

Table 6. Positive results (+) for genes for virulence and biogenic amines in Enterococcus spp isolates belonging to 20 RAPD profiles
RAPD profileVirulence genesaAntibiotic resistance genesBiogenic amines genesa
gelEhylasa1espcylAefaAacevanAvanBhdc1hdc2tdcodc
  1. a

    gelE (gelatinase), hyl (hyaluronidase), asa1 (aggregation substance), esp (enterococcal surface protein), cylA (cytolisin), efaA (endocarditis antigen), ace (adhesion of collagen), vanA and vanB (vancomycin resistance), hdc1 and hdc2 (histidine decarboxylase), tdc (tyrosine decarboxylase) and odc (ornithine decarboxylase).

I++++
II++
III++++++
IV++++++
V++++++
VI++++++
VII+++++
VIII+
IX++++
X++++++
XI++++++
XII+++++++
XIII+++
XIV+++
XV++++++
XVI+++++++
XVII+++++++
XVIII+++++
XIX+++++
XX+++++
Table 7. Positive results (+) for virulence factors in Enterococcus spp isolates belonging to 20 RAPD profiles
RAPD profileVirulence factors
GelatinaseLipaseDNAseβ-haemolysisα-haemolysis
I+
II+
III++
IV++
V++
VI++
VII++
VIII++
IX+
X+
XI+
XII+
XIII+
XIV+
XV+
XVI+
XVII
XVIII++
XIX++
XX+

Discussion

Enterococci are relevant as starter cultures in several artisanal foods, being responsible for the production of distinct typical characteristics (Giraffa 2002, 2003; Martin-Platero et al. 2009). They are also present as autochthonous microbiota from distinct foods and are capable of producing bacteriocins (Dal Bello et al. 2010; Khan et al. 2010; Javed et al. 2011). However, the virulence potential of enterococci determines a proper characterization of wild strains, to verify their adequacy to be used as biopreservatives (Foulquié-Moreno et al. 2006; Franz et al. 2011).

The bacteriocinogenic activity of the isolates was confirmed by the enzymatic sensitivity of their produced antimicrobial substances. Testing the sensitivity of bacteriocins to digestive enzymes does not indicate the type of bacteriocin produced by an isolate, but evaluates its potential applicability for food biopreservation, as food preservatives should be destroyed during the passage through the gastrointestinal system (Sharma et al. 2006; de Arauz et al. 2009). The isolates presented antimicrobial activity against most Listeria spp., different species of LAB and Staphylococcus spp. (Table 4); similar results were reported in other Brazilian studies (Moreno et al. 2000; de Martinis et al. 2001; Bromberg et al. 2005; Gomes et al. 2008).

Considering the results for lantibiotic biosynthesis genes (Table 5), lanB was the most frequent gene among the RAPD profiles, present in 12. This gene was also present is association with lanC (four profiles) and lanM (one profile). According to Hyink et al. (2005) and Wirawan et al. (2006), positive result for any of the three tested genes for lantibiotics biosynthesis is enough to indicate the capacity of the isolate to produce these bacteriocins. Despite not being the best characterized and known bacteriocins produced by Enterococcus spp. (de Vuyst et al. 2003), lantibiotics are the main class of bacteriocins produced by LAB and can be applied in several food systems to control foodborne pathogens and spoilage micro-organisms (McAuliffe et al. 2001; Riley and Wertz 2002).

As shown in Table 5, isolates belonging to 11 RAPD profiles contained at least one of the tested enterocin genes. It is possible to verify the distinct association of positive results for enterocin genes among the RAPD profiles and also presence of enterocins genes in four profiles that did not present any of the lantibiotic biosynthesis genes (VI, X, XVI and XVII). Several isolates, from 7 RAPD profiles, presented more than one enterocin gene, and the most frequent association was for enterocins A and P genes. Other authors have also observed that enterococci may contain multiple enterocin genes (de Vuyst et al. 2003; Dal Bello et al. 2010; Javed et al. 2011). Genetic transfer mechanisms, owing to the presence of conjugative transposons and plasmids, can explain the observed variability of multiple enterocin genes in isolates presenting the same RAPD profile (Franz et al. 2007).

The presence of more than one gene does not mean that all will be expressed simultaneously and that an isolate is capable of producing multiple bacteriocins at the same time (Cintas et al. 1998; Javed et al. 2011). Seven isolates (En13, En14, En15, En18, En20, En34 and En35) did not produce antimicrobial substances with sensitivity to at least one of the tested enzymes (data not shown), but belonged to RAPD profiles that contained isolates presenting one or more bacteriocins genes (I, IV, VII, VIII, IX and XVIII), suggesting that these genes were not expressed in those seven isolates.

The virulence potential (Table 6) and activity (Table 7) of the isolates belonging to distinct RAPD profiles were variable and present in distinct associations as well. In general, the frequency of positive results for the studied virulence factors was similar to those reported in other studies on Enterococcus isolated from foods (Semedo et al. 2003; Gomes et al. 2008; Barbosa et al. 2010), but the frequency of positive results was lower when compared to studies with clinical isolates (Eaton and Gasson 2001; Semedo et al. 2003; Barbosa et al. 2010). Despite being less relevant in food isolates, verification of virulence factors in Enterococcus spp. by molecular and phenotypic procedures is important because of the risk of genetic transfer, because these genes are usually located in conjugative plasmids (Eaton and Gasson 2001).

The investigation of virulence factors in Enterococcus with potential application in food preservation is of foremost importance as enterococci may contain several determinants of pathogenicity. Virulence factors may be either colonization factors, such as those that promote the adhesion of bacteria to the host cells, or invasion factors that promote the invasion of epithelial cells, which disorder the immune system (de Sousa 2003). Several cell wall–anchored surface proteins are implicated in enterococcal pathogenicity, including aggregation substance, enterococcal surface protein, collagen-binding components (Hendrickx et al. 2009). Some secreted products, such as hyaluronidase, may interact with lymphocyte receptors and induce autoimmune diseases (de Sousa 2003). Cytolysin is an exotoxin with bifunctional bacteriocin and haemolytic effects (Haas et al. 2002). Cytolysin causes the invading organism to evade the host immune system (Franz and Holzapfel 2004), and this toxin can lyse human, rabbit and horse erythrocytes (Chow et al. 1993). Enterococcal surface proteins include aggregation substance, Enterococcus surface protein, adhesins and other adhesive molecules, such as Enterococcus endocarditis antigen. Expression of the aggregation substance protein enables close contact between cells for conjugation and subsequent transfer of virulence plasmids (Hendrickx et al. 2009). The aggregation substance protein may have a role in translocation of enterococci into epithelial cells (Franz and Holzapfel 2004). Enterococcus surface protein is a cell wall–anchored protein characterized by its ability to form biofilms and may, therefore, be implicated in enterococcal infections that are associated with biofilm (Hendrickx et al. 2009). Angiotensin-converting enzyme (ACE) proteins facilitate the binding of Enterococcus spp. to collagen and are expressed during human infections (Franz and Holzapfel 2004). The expression of endocarditis antigens produced by Ent. faecalis has been shown to be essential for the growth of this species and to be bound to fibrinogen, collagen, fibronectin and laminin, damaging host cell structure (Franz and Holzapfel 2004).

Gelatinase also plays an important role in pathogenicity as it is a protease involved in the hydrolysis of gelatine, casein, collagen and haemoglobin, and small bioactive proteins, such as Ent. faecalis sex pheromone-related peptides (Archimbaud et al. 2002). Gelatinase production is usually associated with enterococci from clinical samples, but it has also been detected in enterococci isolated from dairy and meat products (Silva Lopes et al. 2006).

The role of hyaluronidase in infections has been reviewed by Girish and Kemparaju (2007). Hyaluronidase facilitates the spread of bacteria and toxins throughout the host tissue by causing tissue damage (Kayaoglu and Orstavik 2004). Microbial hyaluronidase production is linked to enterococcal virulence primarily because the enzyme is linked to pathogenicity through enzymatic degradation of host tissue in other organisms (Franz and Holzapfel 2004).

Enterococci are often the causative agents of infections in hospitalized patients and nosocomial bloodstream infections (Vankerckhoven et al. 2008). In enterococci, six vancomycin resistance types have been phenotypically and genotypically identified, and two of them, VanA and VanB, may be located in transferable plasmids (Courvalin 2006).

Enterococcus spp. isolates, obtained from milk and cheeses in Minas Gerais state, Brazil, presented an interesting potential application for food preservation because of the production of protease-sensitive bacteriocins, with a good inhibitory spectrum of activity. Most isolates harboured genes responsible for synthesis of known lantibiotics (lanM, lanB and lanC) and enterocins (entA, entB, entP, entL50AB and entAS48). However, most isolates presented genes for virulence factors, such as production of aggregation substance (asa1), gelatinase (gelE), endocarditis antigen (efaA) and tyrosine descarboxylase (tdc). Phenotypic tests indicated that a great part of isolates presented partial or β-haemolysis. The present study demonstrated the contradictory characteristics of these Enterococcus isolates.

Acknowledgements

Enterococcus control strains were provided by Prof. Charles Franz (Federal Research Centre for Nutrition and Food, Karlsruhe, Germany), and Lactococcus control strains were provided by Dr Phillip Wescombe (University of Otago, Dunedin, New Zealand). The researchers were supported by CNPq, FAPEMIG and CAPES (Brazil).

Ancillary