SEARCH

SEARCH BY CITATION

Keywords:

  • DAB gene;
  • gene expression;
  • grass carp;
  • Ichthyophthirius multifiliis;
  • major histocompability;
  • real-time quantitative PCR

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

The grass carp, Ctenopharyngodon idella (Valenciennes), is one of the most extensively aquacultured freshwater fish in China. However, because of the lack of effective control measures and the high-density culture environment, considerable economic losses are caused by infection of C. idella with the parasitic ciliate, Ichthyophthirius multifiliis. The major histocompatibility (MH) DAB gene belongs to antigen-presented genes in the class II genomic region, which is associated with parasite resistance. To understand the relationship of the DAB gene with I. multifiliis infection in grass carp, the expression profiles of MH II-DAB were studied in tissues using real-time quantitative polymerase chain reaction. The results showed that expression of the MH II-DAB gene was up-regulated in head kidney after I. multifiliis infection, and the expression peak appeared earlier in the study (case) group than in the control group. The obvious up-regulation peak of MH II-DAB gene was found at days 2 and 4 in skin; at 12 h to day 4 in spleen; at 12 h and days 1 and 6 in gill; and at day 10 in blood, whereas the MH II-DAB gene was down-regulated in liver and intestines after I. multifiliis infection. These results have implications for better understanding C. idella resistance to I. multifiliis infection.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Genes of the major histocompatibility complex (MHC) are involved in the primary recognition of foreign pathogens in the acquired immune response and are associated with resistance to a variety of diseases in vertebrate organisms. In tetrapods, including mammals, the MH genes are tightly linked in a single chromosomal region, whereas in teleosts, MH remained unlinked (Stet, Kruiswijk & Dixon 2003). Traditionally, the MH gene family is divided into three classes, namely classes I, II and III. MH class II molecules are dimers, including one α chain and one β chain, which are encoded by separate class II A and B genes, respectively. MH class II genes are highly polymorphic with multiple loci in teleosts. There are two to three loci in the MH class II A gene (Murray et al. 2000; Kruiswijk et al. 2004; Scharsack, Kalbe & Schaschl 2007; Harstad et al. 2008) and two to six loci in the MH class II B gene (Sultmann et al. 1994; Erp, Egberts & Stet 1996; Kruiswijk et al. 2004; Reusch, Schaschl & Wegner 2004; Zhang & Chen 2006; Harstad et al. 2008; Zhang et al. 2010). There were a large number of alleles at each locus in MH II genes (Yang et al. 2006; Michel, Bernatchez & Behrmann-Godel 2009; Xu et al. 2009; Croisetiere, Bernatchez & Belhumeur 2010; Du et al. 2011). In cyprinid fish species, some researchers identified six MH II B loci (Dare-DAB, -DBB, -DCB, -DDB, -DEB and –DFB) in the zebrafish, Danio rerio Hamilton (Ono et al. 1992; Sultmann et al. 1994) and at least five loci in the common carp, Cyprinus carpio L. (Hashimoto, Nakanishi & Kurosawa 1990). Then, Zhang et al. (2010) identified 34 alleles of the DAB gene in the grass carp, Ctenopharyngodon idella (Valenciennes), collected from the Yangtze River, and identified at least five loci in the MH II B gene. In the common carp, four different Cyca-DAB alleles have been described, namely Cyca-DAB1*01 and Cyca-DAB2*01 (denoted here as Cyca-DAB1-like genes) (Ono et al. 1993) as well as Cyca-DAB3*01 and Cyca-DAB4*01 (denoted here as Cyca-DAB3-like genes) (Erp et al. 1996). Some researchers considered that there were at least two paralogous groups of MH class II B genes (DAB1 and DAB3) in cyprinid fish species (Dixon et al. 1996; Ottova et al. 2005; Simkova, Ottova & Morand 2006).

High polymorphism in the DAB genes was suitable for studies of association with disease resistance. Several studies reported that Cyca-DAB1-like genes were associated with increased immune responsiveness in common carp after infection with cyprinid herpesvirus-3 (CyHV-3), the bacterium Aeromonas hydrophila, the ectoparasite Argulus japonicus and the blood parasite Trypanoplasma borreli (Rakus et al. 2009a; Rakus et al. 2009b). Analysis of carp challenged with A. hydrophila indicated that the lowest cumulative mortality was observed in the group of fish carrying both a heterozygous Cyca-DAB1 gene and a homozygous Cyca-DAB2 gene (Rakus et al. 2008).

The grass carp is among the most extensively aquacultured freshwater fish in China. However, infection of grass carp with the parasitic ciliate Ichthyophthirius multifiliis has caused significant economic losses. The association of the MH II-DAB gene with I. multifiliis infection of grass carp has yet to be elucidated. In this study, we examined the expression of the MH II-DAB gene in seven major immuno-competent tissues of grass carp, in a period of 10 days after infection with I. multifiliis by real-time quantitative polymerase chain reaction (RT-PCR).

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

Fish

About 300 grass carp of 10 g body weight were reared under pathogen-free conditions and maintained in aerated tap water at 20 °C in aquaria with Eheim biofilters until use.

Parasites

Ichthyophthirius multifiliis was obtained from a fish farm in Guangzhou, Guangdong Province, China, and was cultured in our laboratory at 20 °C by serial passage in grass carp.

Experimental infection and sampling procedures

Ichthyophthirius multifiliis was harvested from the skin of grass carp, as described by Sigh, Lindenstrom & Buchmann (2004). In the case group, a total of 100 grass carp were transferred to a 100-L aquarium with a concentration of 10 000 parasites per fish. A similar aquarium with 50 fish was submitted to a sham infection with aerated tap water instead of theronts. After infection for 3 h, 12 h, 24 h, 48 h, 4 days, 6 days and 10 days, six fish were gently transferred to a small plastic aquarium containing a mild anaesthetic (MS 222; 20 mg L−1). The fish were killed quickly using an overdose of MS 222 (20 mg L−1) and the head kidney, spleen, gill, skin, liver, intestines and blood were aseptically dissected and subsequently snap-frozen in liquid nitrogen. Control samples were taken from another six uninfected fish.

RNA isolation and cDNA generation

Total RNA from frozen tissue samples was prepared using an RNAiso Plus (TaKaRa), according to the manufacturer's instructions. Tissues were disrupted with sonication on ice (Sonicator Ultrasonic Liquid Processor Model XL 2020, Misonx). The concentration and quality of total RNA of each sample were determined by calculating the absorbance ratio at 260 nm/280 nm (Eppendorf BioPhotometer plus). Integrity of the RNA was confirmed by running samples on a 1% agarose gel. For complementary DNA (cDNA) synthesis, 1 mg of total RNA was used. All of the total RNA samples in water had an A260/A280 ratio of 1.9–2.0. A reverse transcription kit (TaKaRa) was used for cDNA synthesis according to the manufacturer's recommendations.

To ensure the elimination of genomic DNA (gDNA) from total RNA, samples were treated with DNase for 2 min at 42 °C in 5 × gDNA Eraser Buffer and gDNA Eraser (TaKaRa). cDNA was then generated using a master mix prepared from the PrimeScript Buffer, PrimeScript RT Enzyme Mix and RT Primer Mix (TaKaRa). The reaction mixture was placed at 37 °C for 15 min and inactivated at 85 °C for 5 s. All of the cDNA samples were diluted with distilled water to a final volume of 100 μL.

Real-time quantitative PCR

Real-time PCR was performed in a total volume of 20 μL on an ABI Prism 7500 detection system (Applied Biosystems) with SYBR Green as the fluorescent dye, according to the manufacturer's protocol (TaKaRa). The master mix consisted of 6 μL of water, 0.4 μL of ROX Reference Dye II, 2 μL of cDNA from a 1/20 dilution of the RT reaction, 0.8 μL of each primer (10 μm) and 10 μL of SYBR Green II mix. Cycling conditions were 95 °C for 30 s, followed by 40 cycles of 94 °C for 5 s, 56 °C for 20 s and 72 °C for 34 s. The target gene, primer sequences were designed according to the C. carpio DAB gene (GenBank accession no.: Z49064) and the grass carp β2m gene (GenBank accession no.: AB190816) with Oligo 6 Demo and Prime 5.0 (Table 1). The target genes, primer sequences and expected sizes of amplicons are shown in Table 1. All samples were analysed in triplicate, and the relative expression levels of the target genes were based on the inner reference gene of β2m in each sample using the 2(-Delta Delta C (T)) method (Livak & Schmittgen 2001). Cycle threshold values were calculated by the SDS software (Applied Biosystems).

Table 1. Primer sequences for RT-PCR amplification
Target geneProduct length (bp)GenBank accession no.Primer sequences
DesignationSequence (5′-3′)
MH II-DAB 150 Z49064 MH II-DAB -FCGGCTTAACTAAACCCATC
MH II-DAB -RCTCCCTGATGATTTCTTCTTGT
β 2 m 150 AB190816 β2m-FGGCTGGCAGTTTCACCTCAC
β2m-RCCACCCTTTGTCTGGCTTTG

Statistical analysis of results was performed by analysis of variance (ANOVA) in SPSS 17.0 (SPSS). Data were expressed as the arithmetic mean ± standard deviation (SD), and P values less than 0.05 were considered as statistically significant.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

MH II-DAB gene expression in the head kidney

Compared with the control group (0 h), a significant increase in expression of the MH II-DAB gene was observed from 3 h to 1 day (Fig. 1a). At 3 h after infection, a significant 1.3-fold increase was observed, which increased further to 2.1-fold at 12 h and reached the maximum of 3.6-fold at 1 day. Thereafter, expression of the MH II-DAB gene was down-regulated from days 2 to 6 in comparison with the control group. In addition, a significant down-regulation was also observed at days 4 (1.5-fold decrease) and 6 (4.3-fold decrease). The expression level of the MH II-DAB gene returned to the initial level at day 10.

image

Figure 1. Real-time quantitative polymerase chain reaction (PCR) of MH II-DAB gene expression in the head kidney (a), spleen (b), gill (c), skin (d), liver (e), intestines (f) and blood (g) of the grass carp after infection with Ichthyophthirius multifiliis. The data were presented relative to β2m. Bars represent mean value (+ standard deviation) of four fish at each time point. *Significantly elevated expression (< 0.05). §Significant down-regulation (< 0.05).

Download figure to PowerPoint

MH II-DAB gene expression in the spleen

The expression pattern of the MH II-DAB gene in spleen samples differed from that in kidney (Fig. 1b). Expression of the MH II-DAB gene in spleen showed a significant 1.3-fold down-regulation at 3 h after infection, whereas it reached a significant 2.2-fold higher level of expression at day 1. Thereafter, there was a significant elevation at day 4 (2.1-fold) and a depression at day 6 and day 10.

MH II-DAB gene expression in the gill

Expression of the MH II-DAB gene in gill showed high variation at different time points after infection (Fig. 1c). A very early increase in expression of 1.5-fold at 12 h was observed, followed by a 1.6-fold increase at day 1 and a 1.3-fold increase at day 6. However, at 3 h, day 2, day 4 and day 10, the expression levels of the MH II-DAB gene were significantly down-regulated compared with those of the control group.

MH II-DAB gene expression in the skin

Significant variation in expression of the MH II-DAB gene was observed in the skin of the infected fish (Fig. 1d). A progressing significant increase was observed from 3 h to day 2. A 1.5-fold increase was observed at day 2; then, the transcription level of the MH II-DAB gene decreased by 1.2-fold at day 4. A further decrease in expression, of 2.7- and 7.3-fold, was observed at day 6 and day 10, respectively.

MH II-DAB gene expression in the liver

Expression of the MH II-DAB gene in the liver was lower in the case group than in the control group at each study time point. It was notable that the expression levels of the gene were significantly down-regulated by 1.9-fold at day 2 and by 2.5-fold at day 6 in the case group compared with the control group (Fig. 1e).

MH II-DAB gene expression in the intestines

Similarly to the liver samples, expression of the MH II-DAB gene in intestines at all study time points was significantly down-regulated after infection with I. multifiliis (Fig. 1f). A 3.3-fold decrease in the transcripts of the MH II-DAB gene was observed at 12 h, followed by a 6.2-fold decrease at day 6.

MH II-DAB gene expression in the blood

Blood samples had their own unique expression pattern of the MH II-DAB gene compared with other organs during I. multifiliis infection (Fig. 1g). Only low levels of the MH II-DAB gene were detected at different time points after infection from 3 h to day 6. However, a significant peak in expression, which was 1.8-fold higher in the case group, was found compared with the control group at day 10.

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

The fish immune factors contributing to protection have been intensively studied, including both specific and non-specific humoral and cellular factors (Louise et al. 2008, 2011; Olsen et al. 2011). The non-specific humoral and cellular factors play an important role in the acute-phase response in fish infected with I. multifiliis. Gonzalez, Buchmann & Nielsen (2007a) investigated the expression of complement molecules in common carp during infection with I. multifiliis; the results indicated that infection with the parasite I. multifiliis in carp to a large extent stimulates the expression of complement molecules. Moreover, the genes encoding the acute-phase reactant, serum amyloid A (SAA), and a C-type lectin molecule (CL), the chemokines CXCa and CXCb, the chemokine receptors CXCR1 and CXCR2, the pro-inflammatory cytokines interleukin 1β (IL-1β), tumour necrosis factor α (TNF-α) and the enzymes inducible nitric oxide synthase (iNOS) and arginase 2 played a major role in the acute-phase response in fish infected with I. multifiliis (Gonzalez, Buchmann & Nielsen 2007b,c). In addition, macrophages (Mehta & Woo 2002), polymorphonuclear leucocytes (PMNs) (Cross & Matthews 1993) and non-specific cytotoxic cells (NCCs) (Graves, Evans & Dawe 1985) were involved in the initiation of the inflammatory process in fish in relation to an ectoparasite infection. In the present study, the expression of the MH II-DAB gene was in general evaluated in grass carp after infection with I. multifiliis.

In this study, the strongest up-regulation of MH II-DAB gene expression in the skin of grass carp was observed at day 2 and day 4 after I. multifiliis infection, and the same expression pattern was also found in the gill at 12 h, day 1 and day 6. Skin and gill are the essential protective barriers in aquatic organisms and act as the first line of defence against the external environment and infectious pathogens (Powell, Speare & Wright 1994; Caipang et al. 2011). Ichthyophthirius multifiliis invades the epidermis of the fish to feed on mucus and tissue and causes localized lymphocytic infiltration and varying degrees of epithelial proliferation (Pakk, Hussar & Paaver 2011). The observed up-regulation of expression of the MH II-DAB gene could also be related to the release of host signals after disruption of epithelial cells by the parasite, indicating that the MH II-DAB gene also contributed to the immune reactions against I. multifiliis.

Head kidney and spleen are important immune organs in fish, and the immune function of these organs generate a large number of immune cells, such as various lymphocytes and macrophages, to participate in the immune response. After infection with I. multifiliis expression of the MH II-DAB gene peaked earlier in the case group than in the control group in head kidney, and up-regulated expression of the MH II-DAB gene was also found in the spleen from 12 h to day 4. Expression levels of MH II were found to be significantly elevated in the head kidney from day 4 and onwards in rainbow trout, Oncorhynchus mykiss Walbaum, after infection with I. multifiliis, but the depression of gene expression was seen in the spleen at 48 h (Sigh et al. 2004). However, in this study, down-regulation of the expression of the MH II-DAB gene was found in the liver and intestines of grass carp during the infection. The same pattern was also found in the liver and intestines of the gilthead sea bream, Sparus aurata L.; the transcript levels of MH IIA genes were down-regulated during the first infection with A. hydrophila (Reyes- Becerril et al. 2011). It was interesting that the expression of MH class II genes was up-regulated in the intestine of the gilthead sea bream, which were not infected with the myxosporean parasite, Enteromyxum leei, possibly indicating that an active immune response at the local level was important to avoid infection with, or proliferation of, the parasite (Davey et al. 2011).

Blood is essential for the immune system to function properly because of its role in leucocyte transportation from the lymphopoietic and immune organs to the site of inflammation. The mobilization of leucocytes into the blood must be fast to mount an efficient response against pathogens. However, an increase in the transcription levels of MH II-DAB was found in the blood only at day 10. Witeska, Kondera & Lugowska (2010) found that the metabolic activity of phagocytes was significantly reduced and also noted a significant decrease in the white blood cell count accompanied by lymphopenia, in the parasite-infested fish compared with the control group. The decrease in the leucocyte count and phagocyte activity explained the low expression levels of the MH II-DAB gene in the case group.

In conclusion, the results of the present study suggest that the MH II-DAB gene may play an important role in the immune response of C. idella to I. multifiliis infection. These results also support the long-established opinion that antibody production is involved in anti-I. multifiliis responses. It seemed that this production occurred at both local and systemic levels and that the head kidney, spleen and gill responses were of importance in the immune response to I. multifiliis. Moreover, a significant depression in the expression of the MH II-DAB gene in some tissues of grass carp was observed during the early phases of I. multifiliis infection. This might be caused by the fast migration of Mh-producing cells, macrophages, observed during inflammatory processes in carp (Richmond et al. 2009). More research is needed to study whether these molecules are determinant for fish resistance against I. multifiliis.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References

This work was supported by the National Natural Science Foundation of China (Grant Nos. 31072205 and 30972251). MJX and XQZ are supported by the Open Funds of the State Key Laboratory of Veterinary Etiological Biology, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences (Grant Nos. SKLVEB2011KFKT004, SKLVEB2011KFKT011, SKLVEB2010KFKT009 and SKLVEB2011KFKT010) and the Program for Outstanding Scientists in Agricultural Research.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. References
  • Caipang C.M.A., Lazado C.C., Brinchmann M.F., Rombout J.H.W.M. & Kiron V. (2011) Differential expression of immune and stress genes in the skin of Atlantic cod (Gadus morhua). Comparative Biochemistry and Physiology Part D: Genomics and Proteomics 6, 158162.
  • Croisetiere S., Bernatchez L. & Belhumeur P. (2010) Temperature and length-dependent modulation of the MH class II gene expression in brook charr (Salvelinus fontinalis) by a cis-acting minisatellite. Molecular immunology 47, 18171829.
  • Cross M. & Matthews R. (1993) Localized leucocyte response to Ichthyophthirius multifiliis establishment in immune carp Cyprinus carpio L. Veterinary immunology and immunopathology 38, 341358.
  • Davey G.C., Calduch-Ginerb J.A., Houeixa B., Talbota A., Sitja-Bobadillac A., Prunetd P., Perez-Sanchezb J. & Cairns M.T. (2011) Molecular profiling of the gilthead sea bream (Sparus aurata L.) response to chronic exposure to the myxosporean parasite Enteromyxum leei. Molecular immunology 48, 21022112.
  • Dixon B., Nagelkerke L.A.J., Sibbing F.A., Egberts E. & Stet R.J.M. (1996) Evolution of MHC class II β chain-encoding genes in the Lake Tana barbel species flock (Barbus intermedius complex). Immunogenetics 44, 419431.
  • Du M., Chen S., Liu Y. & Yang J. (2011) MHC polymorphism and disease resistance to vibrio anguillarum in 8 families of half-smooth tongue sole (Cynoglossus semilaevis). BMC Genetics 12, 78.
  • Erp S.H.M.V., Egberts E. & Stet R.J.M. (1996) Characterization of class IIA and B genes in a gynogenetic carp clone. Immunogenetics 44, 192202.
  • Gonzalez S.F., Buchmann K. & Nielsen M.E. (2007a) Complement expression in common carp (Cyprinus carpio L.) during infection with Ichthyophthirius multifiliis. Developmental & Comparative Immunology 31, 576586.
  • Gonzalez S.F., Buchmann K. & Nielsen M.E. (2007b) Ichthyophthirius multifiliis infection induces massive up-regulation of serum amyloid A in carp (Cyprinus carpio). Veterinary immunology and immunopathology 115, 172178.
  • Gonzalez S.F., Buchmann K. & Nielsen M.E. (2007c) Real-time gene expression analysis in carp (Cyprinus carpio L.) skin: inflammatory responses caused by the ectoparasite Ichthyophthirius multifiliis. Fish & Shellfish Immunology 22, 641650.
  • Graves S.S., Evans D.L. & Dawe D.L. (1985) Mobilization and activation of nonspecific cytotoxic cells (NCC) in the channel catfish (Ictalurus punctatus) infected with Ichthyophthirius multifiliis. Comparative immunology, microbiology and infectious diseases 8, 4351.
  • Harstad H., Lukacs M., Bakke H. & Grimholt U. (2008) Multiple expressed MHC class II loci in salmonids; details of one non-classical region in Atlantic salmon (Salmo salar). BMC genomics 9, 14712164.
  • Hashimoto K., Nakanishi T. & Kurosawa Y. (1990) Isolation of carp genes encoding major histocompatibility complex antigens. Proceedings of the National Academy of Sciences 87, 6863.
  • Kruiswijk C.P., Hermsen T., Fujiki K., Dixon B., Savelkoul H.F.J. & Stet R.J.M. (2004) Analysis of genomic and expressed major histocompatibility class Ia and class II genes in a hexaploid Lake Tana African ‘large'barb individual (Barbus intermedius). Immunogenetics 55, 770781.
  • Livak K.J. & Schmittgen T.D. (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2-[Delta][Delta] CT method. Methods 25, 402408.
  • Louise V.G.J., Egemen N., Rasmus D.H., Martin K.R. & Kurt B. (2008) Immune-relevant genes expressed in rainbow trout following immunisation with a live vaccine against Ichthyophthirius multifiliis. Diseases of aquatic organisms 80, 189197.
  • Louise V.G.J., Egemen N., Rasmus D.H., Martin K.R. & Kurt B. (2011) Experimental evidence for direct in situ binding of IgM and IgT to early trophonts of Ichthyophthirius multifiliis (Fouquet) in the gills of rainbow trout, Oncorhynchus mykiss (Walbaum). Journal of Fish Diseases 34, 749755.
  • Mehta M. & Woo P.T. (2002) Acquired cell-mediated protection in rainbow trout, Oncorhynchus mykiss, against the haemoflagellate, Cryptobia salmositica. Parasitology Research 88, 956962.
  • Michel C., Bernatchez L. & Behrmann-Godel J. (2009) Diversity and evolution of MHII [beta] genes in a non-model percid species–The Eurasian perch (Perca fluviatilis L.). Molecular Immunology 46, 33993410.
  • Murray B.W., Shintani S., Sultmann H. & Klein J. (2000) Major histocompatibility complex class II A genes in cichlid fishes: identification, expression, linkage relationships, and haplotype variation. Immunogenetics 51, 576586.
  • Olsen M.M., Kania P.W., Heinecke R.D., Skjoedt K., Rasmussen K.J. & Buchmann K. (2011) Cellular and humoral factors involved in the response of rainbow trout gills to Ichthyophthirius multifiliis infections: molecular and immunohistochemical studies. Fish & Shellfish Immunology 85, 9869.
  • Ono H., Klein D., Vincek V., Figueroa F., O'huigin C., Tichy H. & Klein J. (1992) Major histocompatibility complex class II genes of zebrafish. Proceedings of the National Academy of Sciences 89, 11886.
  • Ono H., O'huigin C., Vincek V., Stet R.J.M., Figueroa F. & Klein J. (1993) New β chain-encoding Mhc class II genes in the carp. Immunogenetics 38, 146149.
  • Ottova E., Simkova A., Martin J.F., Gouy De Bellocq J., Gelnar M., Allienne J.F. & Morand S. (2005) Evolution and trans-species polymorphism of MHC class II [beta] genes in cyprinid fish. Fish & Shellfish Immunology 18, 199222.
  • Pakk P., Hussar P. & Paaver T. (2011) Alterations of Club Cell Activity in Epidermis of Common Carp, Cyprinus Carpio (Actinopterygii: Cypriniformes: Cyprinidae), due to Infection by Ichthyophthirius Multifiliis (Protista: Ciliophora). Acta Ichthyologica Et Piscatoria 41, 185192.
  • Powell M., Speare D. & Wright G. (1994) Comparative ultrastructural morphology of lamellar epithelial, chloride and mucous cell glycocalyx of the rainbow trout (Oncorhynchus my kiss) gill. Journal of Fish Biology 44, 725730.
  • Rakus K.L., Wiegertjes G.F., Adamek M., Bekh V., Stet R.J.M. & Irnazarow I. (2008) Application of PCR-RF-SSCP to study major histocompatibility class II B polymorphism in common carp (Cyprinus carpio L.). Fish & Shellfish Immunology 24, 734744.
  • Rakus K.L., Irnazarow I., Forlenza M., Stet R.J.M., Savelkoul H.F.J. & Wiegertjes G.F. (2009a) Classical crosses of common carp (Cyprinus carpio L.) show co-segregation of antibody response with major histocompatibility class II B genes. Fish & Shellfish Immunology 26, 352358.
  • Rakus K.L., Wiegertjes G.F., Jurecka P. & Walker P.D. (2009b) Major histocompatibility (MH) class II B gene polymorphism influences disease resistance of common carp (Cyprinus carpio L.). Aquaculture 288, 4450.
  • Reusch T.B.H., Schaschl H. & Wegner K.M. (2004) Recent duplication and inter-locus gene conversion in major histocompatibility class II genes in a teleost, the three-spined stickleback. Immunogenetics 56, 427437.
  • Reyes-Becerril M., Lopez-Medinaa T., Ascencio-Vallea F. & Esteban M.A. (2011) Immune response of gilthead seabream (Sparus aurata) following experimental infection with Aeromonas hydrophila. Fish & Shellfish Immunology 31, 564570.
  • Richmond J.Q., Savage A.E., Zamudio K.R. & Rosenblum E.B. (2009) Toward immunogenetic studies of amphibian chytridiomycosis: linking innate and acquired immunity. BioScience 31, 1320.
  • Scharsack J., Kalbe M. & Schaschl H. (2007) Characterization of antisera raised against stickleback (Gasterosteus aculeatus) MHC class I and class II molecules. Fish & Shellfish Immunology 23, 9911002.
  • Sigh J., Lindenstrom T. & Buchmann K. (2004) The parasitic ciliate Ichthyophthirius multifiliis induces expression of immune relevant genes in rainbow trout, Oncorhynchus mykiss (Walbaum). Journal of Fish Diseases 27, 409417.
  • Simkova A., Ottova E. & Morand S. (2006) MHC variability, life-traits and parasite diversity of European cyprinid fish. Evolutionary Ecology 20, 465477.
  • Stet R., Kruiswijk C.P. & Dixon B. (2003) Major histocompatibility lineages and immune gene function in teleost fishes: the road not taken. Critical Reviews in Immunology 23, 441471.
  • Sultmann H., Mayer W.E., Figueroa F., O'huigin C. & Klein J. (1994) Organization of Mhc class II B genes in the zebrafish (Brachydanio rerio). Genomics 23, 114.
  • Witeska M., Kondera E. & Lugowska K. (2010) The effects of ichthyophthiriasis on some haematological parameters in common carp. Turkish Journal of Veterinary and Animal Sciences 34, 267271.
  • Xu T., Chen S., Ji X. & Sha Z. (2009) Molecular cloning, genomic structure, polymorphism and expression analysis of major histocompatibility complex class IIA and IIB genes of half-smooth tongue sole (Cynoglossus semilaevis). Fish & Shellfish Immunology 27, 192201.
  • Yang T.Y., Hao H.F., Jia Z.H., Chen W.H. & Xia C. (2006) Characterisation of grass carp (Ctenopharyngodon idellus) MHC class I domain lineages. Fish & Shellfish Immunology 21, 583591.
  • Zhang Y.X. & Chen S.L. (2006) Molecular identification, polymorphism, and expression analysis of major histocompatibility complex class IIA and B genes of turbot (Scophthalmus maximus). Marine Biotechnology 8, 611623.
  • Zhang Y., Yao Y., Duan X., Chen D., Zeng L. & Wang D. (2010) Polymorphism and evolution of MHC Class II B grass carp (Ctenopharyngodon idella) populations of Yangtze River. Freshwater Fisheries 40, 1421.