SEARCH

SEARCH BY CITATION

Keywords:

  • chylomicronaemia syndrome;
  • GPIHBP1;
  • lipoprotein lipase;
  • mutations

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflict of interest statement
  9. References

Abstract.  Coca-Prieto I, Kroupa O, Gonzalez-Santos P, Magne J, Olivecrona G, Ehrenborg E, Valdivielso P (Hospital Virgen de la Victoria, Malaga University, Malaga, Spain; Umea University, Umea; and Karolinska Institutet, Stockholm; Sweden). Childhood-onset chylomicronaemia with reduced plasma lipoprotein lipase activity and mass: identification of a novel GPIHBP1 mutation. J Intern Med 2011; 270: 224–228.

Objectives.  Deficiency in the catabolism of triglyceride-rich lipoproteins is the main cause of childhood-onset chylomicronaemia syndrome. Missense mutations in lipoprotein lipase (LPL) or in proteins influencing LPL activity or stability have been shown to be critical determinants of chylomicronaemia syndrome. The main objective of this study was to assess the primary deficiency in five cases of childhood-onset chylomicronaemia syndrome.

Setting.  Lipid clinic at a university hospital,

Subjects.  Subjects presenting with severe hypertriglyceridaemia and chylomicronaemia syndrome in which reduced LPL activity and mass were observed.

Interventions.  Analysis of LPL and GPIHBP1 genes.

Results.  Amongst the five patients, one novel homozygous missense mutation (p.C68Y) in exon 3 of GPIHBP1 was identified. The other four patients were homozygous for the common LPL mutation p.G188E.

Conclusion.  These findings provide further evidence that GPIHBP1 is involved in the catabolism of triglyceride-rich lipoproteins and plays a role in childhood-onset chylomicronaemia.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflict of interest statement
  9. References

Chylomicronaemia syndrome is a rare disorder that usually presents in childhood. It is characterized by severe hypertriglyceridaemia (plasma triglyceride levels exceeding 1000 mg dL−1) that is accompanied by one or more of the following symptoms: eruptive xanthoma, lipaemia retinalis, hepatosplenomegaly (occasionally) and most often abdominal pain and/or acute pancreatitis.

In adults, chylomicronaemia syndrome is primarily caused by familial hyperlipoproteinaemia; however, excessive alcohol intake, uncontrolled type 1 or 2 diabetes mellitus, pregnancy or a number of medications such as oestrogens and retinoids can also trigger acute hypertriglyceridaemic pancreatitis [1, 2]. In children, chylomicronaemia syndrome is mainly caused by mutations in proteins involved in the catabolism of triglyceride-rich lipoproteins, with most patients having mutations in lipoprotein lipase (LPL). In these patients, the severe hypertriglyceridaemia is accompanied by very low or a lack of LPL activity. Chylomicronaemia syndrome is also caused by mutations in proteins involved in modulation of LPL activity, such as apolipoprotein (apo) C-II [3] and apo A-V [4, 5]. Very recently, deficiency of glycosylphosphatidylinositol-anchored high-density lipoprotein-binding protein 1 (GPIHBP1), a small glycoprotein essential for transport of LPL into capillaries [6], has been associated with chylomicronaemia syndrome [7–10]. To date, five mutations in GPIHBP1 associated with severe hypertriglyceridaemia have been reported [7–10].

Here, we report the genetic analysis of LPL and GPIHBP1 in five patients with chylomicronaemia syndrome with reduced LPL activity and mass.

Material and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflict of interest statement
  9. References

Patients

Lipoprotein lipase activity and levels of apo C-II in pre- and postheparin plasma were analysed in 55 patients attending our lipid clinic with severe hypertriglyceridaemia, with or without hypertriglyceridaemic pancreatitis [11]. Of these subjects, five with chylomicronaemia syndrome with reduced LPL activity and mass were selected to undergo genetic analysis for mutations in LPL and GPIHBP1.

As control subjects, 20 individuals without hyperlipidaemia were recruited. The study was approved by the local ethics committee, and patients and controls gave informed consent.

The clinical features of the five patients with chylomicronaemia are shown in Table 1; four are members of the same family. Indeed, cases A-1 and A-2 are sisters, and B-1 and B-2 are brothers and are also cousins of A-1 and A-2.

Table 1.   Clinical features of patients with chylomicronaemia
CaseAge, yearsGenderSerum triglyceride levels in the follow-up (mg dL−1)Type 1 diabetesAssociated symptomsInpatient management
A-125Male>2000YesAbdominal pain and acute pancreatisLow-fat diet and insulin
A-215Female>2000NoAcute pancreatisLow-fat diet
B-123Male>1000NoAcute pancreatisLow-fat diet
B-220Male>2000NoAbdominal painNone
C30Female>1000NoAcute pancreatisLow-fat diet

Case C is a 30-year-old woman unrelated to families A and B. Twice, at the ages of 6 and 22 years, she was admitted to hospital for acute pancreatitis with lipaemic serum. Her serum triglyceride concentration was always above 1000 mg dL−1. There were no signs of xanthomas, hepatosplenomegaly or lipaemia retinalis. Her parents and sister have normal serum lipids.

Plasma lipid analysis

Blood samples were obtained after a 12-h fast; a second blood sample was obtained from each patient 10 min after the intravenous injection of 100 units kg−1 sodium heparin to measure postheparin plasma LPL activity and mass.

Chylomicrons and VLDL were separated by ultracentrifugation; HDL was separated from LDL by precipitation, as previously reported [11]. Levels of cholesterol and triglycerides were measured in plasma and in each lipoprotein fraction by commercial enzymatic methods (ABX, Montpelier, France). Plasma apo C-II was quantified by immunoturbidimetry (ABX and DAIICHI, Tokyo, Japan).

LPL mass and activity assays

Assay conditions for LPL activity (using an Intralipid 10% emulsion, Fresenius Kabi AB, Uppsala, Sweden) and LPL mass (using an enzyme-linked immunosorbent assay) were the same as those previously described [11].

Genetic analysis

Genomic DNA was extracted using the BioRobot® EZ1 system (QIAGEN, Hilden, Germany). The exons and intron–exon boundaries of LPL and GPIHBP1 were amplified and bidirectionally sequenced using the Sanger method based on dideoxy chain-termination technology. The primer sequences are shown in Table 2.

Table 2.   Amplification and sequencing primers for LPL and GPIHBP1
RegionPrimer sequence
  1. F, forward primer; R, reverse primer.

LPL
 Exon 1F: 5′- TTGCAGCTCCTCCAGAGGGA
R: 5′-TGCAGG TGG TGG GGAGTTTG
 Exon 2F: 5′-CTCCAGTTAACCTCATATCCA
R: 5′-CAATCCACTCTTCCCCAAAGAG
 Exon 3F: 5′-GGTGGGTATTTTAAGAAAGCT
R: 5′-AAAACACTGTTTGGACACATA
 Exon 4F: 5′-TTGGCAGAACTGTAAGCACCT
R: 5′- GAAGAACACCACACATGTGG
 Exon 5F: 5′-TGTTCCTGCTTTTTTCCCTT
R: 5′-TAATTCGCTTCTAAATAATA
 Exon 6F: 5′-TCTGCCGAGATACAATCTTGG
R: 5′-CTCCTTGGTTTCCTTATTTAC
 Exon 7F: 5′-CTGAATTGCCTGACTATTTGG
R: 5′-GGGACTGGTGCCATGATGAC
 Exon 8F: 5′-GCTGATCTCTATAACTAACC
R: 5′-ATACAGCCCCTAGGTCCTGA
 Exon 9F: 5′-TGTTCTACATGGCATATTCAC
R: 5′-TCAGGATGCCCAGTCAGCTT
 Exon 10F: 5′-GACAGGCGGGAATTGTAAAAC
R: 5′-GCCTCAGTCCGAAAGATCCAG
GPIHBP1
 Exon 1F: 5′-TTGAGGGCATTGACTGTGT
F: 5′-CCTTCATCCCACTTACCGCAGC
R: 5′-TACTACCCTACTCACCCTA
R: 5′-GCCAGCTTCCATCCATGCTGC
 Exon 2F: 5′-TAGGGTGAGTAGGGTAGTA
F: 5′-ATGCTTGCCCAGAGCAGGTGTC
R: 5′-CTGCCTGGTGAACTCCTATT
R: 5′-GCCTGCTGGCTTCCATCACAC
 Exon 3F: 5′-AATCCCTTGCCCCCTAAACA
F: 5′-AGGCTAGGCTTTGGGAGCACAG
R: 5′-GTCTCTGAGGTGGCTCTGCAG
 Exon 4F: 5′-CTGCAGAGCCACCTCAGAGAC
R: 5′-CTGCAGAGCCACCTCAGAGAC
R: 5′-ATCGCCCAAGACACTCCAAA

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflict of interest statement
  9. References

The main analytical and molecular data are shown in Table 3; all five patients had fasting chylomicronaemia (data not shown) and very low levels of postheparin LPL activity and mass. In each of the five cases, hepatic lipase activity was within the normal range (data not shown).

Table 3.   Biochemical and genetic data
 TCTGHDL-CAPO C-IIHL activityLPL massLPL activityMutation in LPLMutation in GPIHBP1
  1. TC, total cholesterol; TG, triglycerides; HDL-C, high-density lipoprotein cholesterol; HL, hepatic lipase; UD, undetectable; ND, not done. TC, TG and HDL-C given as mmol L−1; apo C-II as mg dL−1; LPL mass as ng mL−1; HL and LPL activity as mU mL−1.

A-120.6943.760.2614.06421UD188 Gly-GluND
A-26.1313.320.3913.010559UD188 Gly-GluND
B-16.526.970.5712.0100490.8188 Gly-GluND
B-23.398.410.476.51861010.2188 Gly-GluND
C6.5915.780.3411.581313.7None68Cys>Tyr
Controls n = 205.12 ± 0.721.49 ± 0.351.24 ± 0.265 ± 3150 ± 70254 ± 10856 ± 23NDND

The sequencing of LPL revealed a homozygous C to T transition leading to the substitution of glutamate for glycine at position 188 in exon 5 in patients A1, A2, B1 and B2. As no mutation in LPL was found in the DNA from patient C, GPIHBP1 was sequenced. A novel homozygous transition of G to A at the second base of codon 68 in exon 3 resulting in a conversion of a highly conserved cysteine to tyrosine was identified (Fig. 1).

image

Figure 1. GPIHBP1 sequences showing (a) the normal sequence and (b) the novel homozygous transition of G–A at the second base of codon 68 in exon 3 resulting in a conversion of a highly conserved cysteine to tyrosine.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflict of interest statement
  9. References

Our results show the genetic analysis of five patients with childhood-onset chylomicronaemia syndrome associated with low LPL activity and mass. It is interesting that one of the patients showed a novel missense mutation of GPIHBP1, p.C68Y, associated with lifelong chylomicronaemia whereas the other four patients, who belong to the same family, were homozygous for the common p.G188E mutation in LPL.

Mutations affecting the LPL gene are the most frequent cause of chylomicronaemia syndrome during childhood; failure to thrive, recurrent abdominal pain with or without acute pancreatitis, eruptive xanthomata and lipaemia retinalis are the main clinical symptoms [3]. LPL deficiency is inherited in an autosomal recessive pattern. Nearly 100 mutations in the LPL gene have been reported so far, and most of them are located in exons 5 and 6 [12]. The G188E mutation accounts for approximately 25% of the LPL mutations reported [3].

The role of GPIHBP1 in lipolysis was highlighted by the fact that knockout mice for this protein fed a standard mouse chow diet had milky plasma and plasma triglyceride levels of 2500–5000 mg dL−1, which is very similar to the levels found in adult mice that are completely deficient in LPL [13]. Wang and Hegele [7] reported the case of two siblings with severe type V hyperlipidaemia associated with a very rare missense mutation G56R in GPIHBP1. Interestingly, in vitro cell culture experiments in Chinese hamster ovary cells demonstrated that the G56R mutation had no effect on the appearance of the GPIHBP1 protein on cell surfaces and that the mutated protein retained the ability to bind chylomicrons, apo A-V or LPL. Furthermore, the patient who was homozygous for this mutation had normal LPL activity in postheparin plasma [14], suggesting that this mutation may affect the function of GPIHBP1 in a different way compared with other mutations found more recently, or it may be a nonfunctional mutation.

In the present study, we identified one patient who was homozygous for a novel missense mutation p.C68Y in GPIHBP1. It is interesting that this mutation in GPIHBP1 is associated with a markedly reduced postheparin LPL mass and activity, whereas the relatives of this patient did not have hypertriglyceridaemia. Our findings are in accordance with those of three reports that were published whilst this study was underway. Beigneux et al. identified a 33-year-old man with lifelong chylomicronaemia who was homozygous for a missense mutation in GPIHBP1 (p.Q115P). The patient had reduced LPL mass and activity in plasma associated with a lack of ability of GPIHBP1-Q115P to bind LPL or chylomicrons in cell culture experiments [8]. Olivecrona et al. reported the cases of three siblings with congenital chylomicronaemia in whom pre- and postheparin LPL activity and mass were low. These patients were compound heterozygotes for missense mutations in GPIHBP1 (p.C65S and p.C68G) that abolished the ability of the protein to bind LPL in cell culture experiments [9] Of note, LPL mass and activity were found to be normal in adipose tissue biopsies and even in breast milk from the affected female sibling. This finding is in accordance with recently published data showing the crucial role of GPIHBP1 in shuttling LPL from the interstitial spaces between adipocytes to the luminal surface of capillaries [6]. Recently, Franssen et al. [10] reported a homozygous missense mutation in GPIHBP1 (p.C65Y) in a child with severe chylomicronaemia. To date, including the novel mutation identified here, six different mutations have been found in GPIHBP1 of which five are located in the lymphocyte antigen 6 (Ly6) domain. The Ly6 motif is a three-fingered domain specified by 10 cysteines that encompasses amino acids 65–136 in humans. This region is highly conserved amongst different species and has been shown in in vitro experiments to be pivotal for the binding of LPL [15] but not of other lipases, such as hepatic or endothelial lipases [16]. The mutations provide further evidence that GPIHBP1 is involved in the catabolism of chylomicrons and is responsible for chylomicronaemia in humans. Taken together, these recent results clearly demonstrate that GPIHBP1 could be considered an essential determinant of chylomicronaemia syndrome.

In summary, functional mutations in GPIHBP1 should be suspected in patients with type I hyperlipidaemia beginning during childhood in which a clear reduction in LPL mass and activity is observed and LPL gene mutations have been ruled out.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflict of interest statement
  9. References

We thank the patients for participating in the study and Olivera Werngren and Maria Jose Ariza for excellent technical assistance. This work was supported by the Swedish Medical Research Council, the Swedish Heart-Lung Foundation and by grants from Grupos de Investigacion y Desarrollo Tecnologico de la Junta de Andalucia (Grupo consolidado CTS- 159). EE holds a senior researcher position funded by the Swedish Heart-Lung Foundation, and JM is supported by a postdoctoral stipend from the Swedish Heart-Lung Foundation.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Conflict of interest statement
  9. References
  • 1
    Chait A, Brunzell JD. Chylomicronemia syndrome. Adv Intern Med 1992; 37: 24973.
  • 2
    Linares CL, Pelletier AL, Czernichow S et al. Acute pancreatitis in a cohort of 129 patients referred for severe hypertriglyceridemia. Pancreas 2008; 37: 138.
  • 3
    Brunzell JD, Deeb SS. Familial lipoprotein lipase deficiency, apo C-II deficiency and hepatic lipase deficiency. In: Scriver CR, Beaudet BL, Sly WS, Valle D, eds. The Metabolic & Molecular Bases of Inherited Disease. New York: McGraw-Hill, 2001; 2789.
  • 4
    Calandra S, Oliva CP, Tarugi P, Bertolini S. APOA5 and triglyceride metabolism, lesson from human APOA5 deficiency. Curr Opin Lipidol 2006; 17: 1227.
  • 5
    Oliva CP, Pisciotta L, Volti GL et al. Inherited apolipoprotein A-V deficiency in severe hypertriglyceridemia. Arterioscler Thromb Vasc Biol 2005; 25: 4117.
  • 6
    Davies B, Beigneux A, Barnes Rn et al. GPIHBP1 is responsible for the entry of lipoprotein lipase into capillaries. Cell Metab 2010; 12: 4252.
  • 7
    Wang J, Hegele RA. Homozygous missense mutation (G56R) in glycosylphosphatidylinositol-anchored high-density lipoprotein-binding protein 1 (GPI-HBP1) in two siblings with fasting chylomicronemia (MIM 144650). Lipids Health Dis 2007; 6: 23.
  • 8
    Beigneux AP, Franssen R, Bensadoun A et al. Chylomicronemia with a mutant GPIHBP1 (Q115P) that cannot bind lipoprotein lipase. Arterioscler Thromb Vasc Biol 2009; 29: 95662.
  • 9
    Olivecrona G, Ehrenborg E, Semb H et al. Mutation of conserved cysteines in the Ly6 domain of GPIHBP1 in familial chylomicronemia. J Lipid Res 2010; 51: 153545.
  • 10
    Franssen R, Young SG, Peelman F et al. Chylomicronemia with low postheparin lipoprotein lipase levels in the setting of GPIHBP1 defects. Circ Cardiovasc Genet 2010; 3: 16976.
  • 11
    Coca-Prieto I, Valdivielso P, Olivecrona G et al. Lipoprotein lipase activity and mass, apolipoprotein C-II mass and polymorphisms of apolipoproteins E and A5 in subjects with prior acute hypertriglyceridaemic pancreatitis. BMC Gastroenterol 2009; 9: 46.
  • 12
    Rahalkar AR, Giffen F, Har B et al. Novel LPL mutations associated with lipoprotein lipase deficiency: two case reports and a literature review. Can J Physiol Pharmacol 2009; 87: 15160.
  • 13
    Beigneux AP, Davies BS, Gin P et al. Glycosylphosphatidylinositol-anchored high-density lipoprotein-binding protein 1 plays a critical role in the lipolytic processing of chylomicrons. Cell Metab 2007; 5: 27991.
  • 14
    Gin P, Beigneux AP, Davies B et al. Normal binding of lipoprotein lipase, chylomicrons, and apo-AV to GPIHBP1 containing a G56R amino acid substitution. Biochim Biophys Acta 2007; 1771: 14648.
  • 15
    Dallinga-Thie GM, Franssen R, Mooij HL et al. The metabolism of triglyceride-rich lipoproteins revisited: new players, new insight. Atherosclerosis 2010; 211: 18.
  • 16
    Gin P, Beigneux AP, Voss C et al. Binding preferences for glycosylphosphatidylinositol HBP1, a glycosylphosphatidylinositol-anchored protein of capillary endothelial cells. Arterioscler Thromb Vasc Biol 2011; 31: 17682.