SEARCH

SEARCH BY CITATION

Keywords:

  • mimicry;
  • Heliconius;
  • Lepidoptera;
  • adaptation;
  • alternative splicing

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. Conflicts of interest
  10. References
  11. Supporting Information

The mimetic wing patterns of Heliconius butterflies are an excellent example of both adaptive radiation and convergent evolution. Alleles at the HmYb and HmSb loci control the presence/absence of hindwing bar and hindwing margin phenotypes respectively between divergent races of Heliconius melpomene, and also between sister species. Here, we used fine-scale linkage mapping to identify and sequence a BAC tilepath across the HmYb/Sb loci. We also generated transcriptome sequence data for two wing pattern forms of H. melpomene that differed in HmYb/Sb alleles using 454 sequencing technology. Custom scripts were used to process the sequence traces and generate transcriptome assemblies. Genomic sequence for the HmYb/Sb candidate region was annotated both using the MAKER pipeline and manually using transcriptome sequence reads. In total, 28 genes were identified in the HmYb/Sb candidate region, six of which have alternative splice forms. None of these are orthologues of genes previously identified as being expressed in butterfly wing pattern development, implying previously undescribed molecular mechanisms of pattern determination on Heliconius wings. The use of next-generation sequencing has therefore facilitated DNA annotation of a poorly characterized genome, and generated hypotheses regarding the identity of wing pattern at the HmYb/Sb loci.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. Conflicts of interest
  10. References
  11. Supporting Information

The genetic basis of adaptive novelty is a major concern of contemporary evolutionary biology. Whilst it was traditionally believed that a large number of genes would contribute to the generation of adaptive phenotypes and morphological change, it is increasingly being shown that morphological evolution both within and between species can be accounted for by a surprisingly small number of loci. Quantitative Trait Locus analysis of phenotypic variation has often shown that loci of major effect control much of the morphological differentiation between related species and populations (Colosimo et al. 2004; Shapiro et al. 2004; Steiner et al. 2007). Even more strikingly, where the genetic basis of such differences has been analysed functionally, repeated involvement of the same genes has been found. Thus, adaptive pigmentation differences can result from alterations at the same loci, as in the case of MC1R mutations in a range of vertebrates (Mundy et al. 2004; Hoekstra 2006; Nadeau et al. 2007; Steiner et al. 2007), and yellow gene expression within the genus Drosophila (Wittkopp et al. 2002; Prud’homme et al. 2006).

The great phenotypic diversity of butterfly wing patterns offers an opportunity to study adaptive morphological evolution. Previous work on the developmental basis of wing patterning in Bicyclus anynana has shown that highly conserved developmental pathways such as wingless, transforming growth factor-β (TGF-β), hedgehog and Notch, and transcription factors such as engrailed (Caroll et al. 1994; Monteiro et al. 2006; Keys et al. 1999; Brunetti et al. 2001; Reed & Gilbert 2004) are re-deployed in generating eyespot patterns. There is also some evidence that population level variation in eyespot size might be controlled by differences in expression of the Distalless homeobox gene (Beldade et al. 2002). These results lend support to the view that co-option of conserved signalling pathways through cis-regulatory evolution has played a key role in morphological innovation during evolution (Carroll 2008).

In contrast to the serially repeated eyespot patterns of species such as B. anynana, the broad bands of colour seen in Heliconius wing patterns suggest a different developmental basis to wing patterning (Reed & Gilbert 2004; Joron et al. 2006a; but see Nijhout 1991). The presence or absence of Heliconius wing pattern elements is under simple Mendelian control (Sheppard et al. 1985; Mallet 1989; Joron et al. 2006a), but thus far a candidate gene approach has not yielded information on the identity of these loci (Joron et al., 2006c). Here, we develop previous work in which we have described markers closely linked to the locus controlling presence of a hindwing bar in Heliconius melpomene, and shown homology in the genomic location of similar genes for polymorphism in Heliconius erato and Heliconius numata (Jiggins et al. 2005; Joron et al. 2006a; Joron et al., 2006c).

Heliconius show a continuum of genetic divergence from freely hybridizing colour pattern races through incipient species with partial reproductive barriers to completely reproductively isolated species, offering the opportunity to study multiple stages of speciation (Mallet et al. 2007). Heliconius melpomene, for example, includes 29 distinct geographic races with bright, simple wing patterns of red, orange, yellow, white and black. Most of the phenotypic variation can be explained by gene complexes located on two linkage groups: HmYb/HmSb/HmN (linkage group 15) which controls white and yellow pattern elements, and HmB/HmD (linkage group 18) which controls red pattern elements (Gilbert 2003; Naisbit et al. 2003; Joron et al., 2006c; Kronforst et al. 2006). More recently, molecular markers have demonstrated that these patterning loci are also shared with more distantly related species. Most notably, the Yb locus of H. melpomene is orthologous to Cr in the distantly related and mimetic H. erato, and in both species controls the yellow hindwing bar phenotype, but also maps to the same genomic location as the P locus of H. numata which controls phenotypically divergent whole-wing polymorphism of mottled ‘tiger’ type wing patterns (Joron et al., 2006c).

One of the major challenges in characterizing functionally important variation in taxa with poorly characterized genomes is sequence annotation. The protein sequences in public databases are highly taxonomically biased towards the traditional model organisms, meaning that many genes in organisms such as butterflies show no similarity to published sequence databases. Furthermore, automated gene-finding methods are not optimized for poorly characterized genomes (Korf 2004). To overcome these difficulties, next-generation sequencing technologies offer a method for rapidly characterizing the transcriptomes of novel genomes at relatively low cost (Hudson 2008; Vera et al. 2008). The high sequence coverage that can potentially be achieved allows for error correction and the detection of rare transcripts or alternative splicing (Weber et al. 2007). Here, we identify and fully sequence a genomic region controlling two major phenotypic changes in the mimetic butterfly, H. melpomene. We further develop a transcriptomic sequence library from developing wing tissue and use this to annotate and characterize the genomic sequence. We therefore provide a detailed description of genomic regions at two patterning loci, and demonstrate how high-throughput sequencing technologies can be used for annotation of genomic sequence in an evolutionary model system.

Methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. Conflicts of interest
  10. References
  11. Supporting Information

Bacterial artificial chromosome (BAC) tilepath construction

A single clone (AEHM-41c10) was previously identified from an Heliconius melpomene BAC library as tightly linked to the HmYb locus (Joron et al., 2006c). The BAC library provides approximately 7.9× coverage of the H. melpomene genome (Joron et al. 2006b) and has been fingerprinted using HindIII restriction digest. A total of 17 494 successfully fingerprinted clones were assembled into 2086 contigs (with average 6.2 clones) plus 4484 singletons (Baxter et al., 2008b). Fingerprint contigs provide a physical genomic map, and, within each contig, a BAC tilepath showing the extent of clone overlap and approximate length of each clone. We also end-sequenced 18 816 clones from the BAC library by Sanger di-deoxy sequencing, generating 32 528 sequence reads (NCBI trace archive, Accession nos 14332939241433326451).

To extend the HmYb genomic walk from the AEHM-41c10 clone (i) primers were designed from the BAC sequence/end sequence of the current clone, (ii) a product was amplified from H. melpomene genomic DNA, (iii) the product was used to probe the BAC library as described previously (Baxter et al. 2008a). Next (iv) primers were designed from BAC-end sequence of positive clones, (v) their genomic location was confirmed using linkage mapping and (vi) polymerase chain reaction (PCR) amplification between clones and in silico alignment of end sequences with the existing tilepath were used to confirm relative clone positions. Finally, the best clones for sequencing were chosen based on the clone length and extent of overlap as predicted from the fingerprint database.

Target amplicon size for probe design was 500 bp, and where possible primers were designed in coding sequence. It was not possible to identify a clone following 21B20 from either probing the BAC library or the fingerprint database. Therefore, using synteny with the Bombyx mori genome, the Bombyx parn gene was identified and used to search the 454 transcriptome library (see below) for H. melpomene sequence. Primers were designed and a product was amplified for probing the library (Table S2, Supporting information). This library screen identified a single large fingerprint contig (Contig 105, Table S1, Fig. S1, Supporting information), from which four clones were chosen for sequencing. Therefore, the BAC fingerprint, clone end sequences, Bombyx-Heliconius synteny and wing transcriptome sequence were all essential tools in constructing the tilepath.

Clones were sequenced, assembled and finished by the Wellcome Trust Sanger Institute to HTG phase 3 (Joron et al., 2006c). Part of this BAC walk was used to develop markers for probing the Heliconius erato genome and has been published in a previous comparative analysis (Papa et al. 2008). Here, we present the first complete description of the candidate genomic region for HmYb, and extend the walk significantly to additionally cover the HmSb locus.

Linkage mapping

Linkage mapping was carried out using molecular markers developed from genomic sequences, including noncoding regions, putative genes and microsatellites which were identified using the automated ‘Microsatellite repeat finder’ available on ButterflyBase (Papanicolaou et al. 2005). In total, several hundred pairs of primers were designed from which those in Table S2 (Supporting information) were chosen based on reliability, amplification across the four broods of the mapping family, unambiguous genotypes and informative variation. Markers in coding sequence generally performed better than microsatellites or other noncoding markers. Primers were designed using Primer3 (Rozen & Skaletsky 2000) to span an intron where possible and with a target amplicon size of 600 bp.

There is no meiotic crossing-over in female Lepidoptera (Turner & Sheppard 1975), so paternal alleles were used to generate a linkage map of the candidate region. In total, 371 individuals from four mapping families were used for linkage mapping (Fig. 1). Grandparents were wild-caught H. melpomene melpomene (individuals 10 064 and 8233 from French Guiana) and H. melpomene cythera (8237 and 8292 from Mindo, Ecuador). HmYb genotypes were scored as homozygous dominant (no bar, Yb/Yb), homozygous recessive (bar, YbcYbc) and heterozygous (Yb/Ybc). Heterozygous individuals have a ‘shadow’ bar as described previously (Joron et al., 2006c). The HmSbc allele is recessive and was scored as margin present (SbcSbc), or absent (SbSb, SbSbc). The complete genotype could therefore be inferred only for those individuals carrying a maternal chromosome with the recessive allele, which gave a total of 175 Sb informative individuals. The pigmentation (yellow/white) of the hindwing margin is controlled by an unlinked locus, K that is not considered further here (Jiggins et al. 2005).

image

Figure 1.  Mapping families segregating for HmYb and HmSb. All four mapping broods (33, 36, 43 and 55) originated from two single pair matings between Heliconius melpomene melpomene and Heliconius melpomene cythera. The F2 progeny segregated for Yb and Sb phenotypes under expected Mendelian ratios. An additional unlinked locus, K, is also segregating in this cross and controls the colour of the hindwing margin, with yellow (y) recessive to white (w). Data from the four broods were combined for mapping of HmYb and HmSb.

Download figure to PowerPoint

DNA was extracted from the mapping broods using a DNeasy kit (Qiagen). For the parents of each brood, each marker was amplified using PCR and products analysed for visible length variation on a 1.5% agarose gel stained with ethidium bromide. Where variation was apparent, DNA from the brood progeny was amplified and genotyped directly by scoring size variation on agarose. When length variation was not visible, the parental PCR products were cleaned using ethanol precipitation and sequenced directly. Sequence traces were searched using CodonCode Aligner software (CodonCode Corporation) for informative restriction digest sites that would yield different sized bands on agarose. Where such sites were identified, all progeny from each brood were then amplified for the marker, digested and the genotypes scored on agarose as above. All progeny were scored for markers at both ends of the BAC tilepath so that all recombinant individuals were identified. If a variable site in parental sequence could not be cleaved by restriction digest, only those progeny known to be recombinants were amplified and sequenced, and the informative site scored from sequence traces. Although indels were common in noncoding sequence, the markers chosen had sufficient ‘clean’ sequence to carry out genotyping. The type of assay used for each marker is given in Table S2 (Supporting information). In most cases, sequence identity was confirmed using blast, and fine-scale linkage mapping of markers to the predicted location in the tilepath additionally confirmed identity of amplicons. Microsatellite length variation was either scored directly on an agarose gel or by amplifying the loci using fluorescently labelled primers, in which case products were run on an ABI 3730 capillary sequencer (Applied Biosystems) and fragments analysed using Genemapper v. 3.7 (Applied Biosystems).

Generation of H. melpomene transcriptome sequence

Heliconius melpomene colonies were established from pupae ordered from Stratford Butterfly Farm, UK. Two pools of normalized wing cDNA were generated from mixed RNA extracted from wing tissue of the races H. melpomene cythera and H. melpomene malleti and sequenced using 454 FLX technology. Whole fore- and hindwings were dissected from larval and pupal stages of both H. m. cythera (17 individuals of unknown sex) and H. m. malleti (six individuals of unknown sex) and total RNA was extracted using the Trizol Reagent (Invitrogen) followed by messenger RNA isolation using the NucleoTrap mRNA kit (Nigel Machery). mRNA was pooled by race according to the following proportions: 40% mid-fifth instar larvae, 20% late fifth instar (crawler), 20% early pupae and 20% pre-ommochrome pupae (See Ferguson & Jiggins 2009 for staging). First strand cDNA was synthesized using the Creator SMART cDNA Library Construction Kit (Clontech). Double stranded cDNA synthesized from the first strand cDNA (product of reverse transcription) was normalized using the Trimmer-Direct Kit (Evrogen, Cat# NK002). Briefly, DNA template was denatured and allowed to re-anneal at 68 °C in the presence of duplex-specific nuclease (DSN) solution, which preferentially degrades double stranded nucleic acids (made up mostly of highly abundant transcripts). The reaction was terminated after 20 min of DSN treatment and the resulting equalized single stranded cDNA was re-amplified using adapter (introduced during previous reverse transcription) specific primers. The optimal cycle number for each sample was empirically determined by subjecting the same template to a range of PCR cycles and the products checked on a 1.5% agarose gel. Samples with signs of over cycling, characterized by an intense, uniform, high-molecular weight smear, were discarded. To evaluate the quality of the normalization, we included no-DSN controls in the above procedures, whose products were run along side with the tested samples. The no-DSN controls typically displayed a number of strong bands against a cDNA smear whereas the normalized samples showed a smooth cDNA smear (most intense between 1–2 kb) with no obvious bands. Our second validation was to prepare a plasmid library for each sample. An aliquot of normalized cDNA was digested with Sfi-1 and the purified products were ligated to the pDNR-lib vector (Clontech). Plasmids were transformed into electrocompetent DH10B cells by electroporation. A total of 101 colonies (58 cythera and 43 aglaope) were sequenced and we obtained 99 unique gene objects (2 contigs and 97 singletons). The low redundancy of these expressed sequence tags (ESTs) indicated that the cDNA was successfully normalized. Ds-cDNA was then purified and concentrated using the DNA Clean and Concentrator kit (Zymogen). Approximately 10 μg of the normalized ds-cDNA per strain was sequenced using the 454 FLX system (454 Life Sciences).

Raw 454 Roche pyrosequencing data were obtained in the form of Standard Flowgram Format files (.sff). The sequences in these files were preprocessed using a Perl script to remove the poly-T primer and the Smart-IV linkers before assembly using the Newbler assembler. Preprocessing involved trimming the sequence reads to remove the adapter or linker if present and removing all bases downstream of a poly-A tail or upstream of a poly-T sequence. The trimming steps, in order, were: (i) if a poly-A sequence was found that matched the pattern ‘five or more As, followed by up to two other nucleotides, followed by five or more As’, then the first such poly-A sequence and all bases downstream of it were removed from the read. (ii) Conversely, if a poly-T sequence was found that matched the pattern ‘five or more Ts, followed by up to two other nucleotides, followed by five or more Ts’, then the last such poly-T sequence and all the bases upstream of it were removed from the read. (iii) If any part of the read matched the two known adapters (poly_T_primer: AAGCAGTGGTATCAACGCAGAGTGGCCGAGGCGGCCTGTTTTGTTTTTTTTTCTTTTTTTTTTVN and smart-IV: AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG), then the matching parts were discarded. The match was established by using blastn with e-value cutoff of 0.1) and ‘-F f’ (do not filter query sequence). (v) If the sequence CGGCCGGG was seen within 10 bases of the start in the remaining sequence, it and all bases upstream were removed. Conversely, if the sequence CCCGGCCG was seen within 10 bases of the end, it and all bases downstream were removed. This pattern, although present in step 3, was sometimes not found by the blastn algorithm and had to be looked for explicitly. (v) If, in the remaining bases, any Ns were present, the whole read was discarded because the N indicates a low-quality read (Huse et al. 2007). The trimmed reads were resaved as a .sff file and the Newbler assembler (Roche, v 1.1.03.24) was used with default settings to assemble the reads into as few contigs as possible. For comparison, the reads were also assembled using MIRA (v2.9.26x3) (Chevreux et al. 2004).

Transcriptome annotation

The resulting assembly was annotated using known proteins (uniref100) from the UniProt Consortium (http://www.uniprot.org). For comparison with B. mori, we first concatenated the Genome Consortium version 2.0 protein predictions with UniProt and RefSeq (Pruitt et al. 2007) manually curated protein sets and then made this database nonredundant at the 100% level using the cd-hit software (Li & Godzik 2006). To compare with existing butterfly transcriptomes, we generated MIRA assemblies from the public EST data available for Bicyclus anynana and Melitaea cinxia. Using the tblastx algorithm and custom Perl scripts, we calculated the number of contigs matching a butterfly or known eukaryotic protein. To identify the proportion of coding vs. noncoding, we parsed the blast report to calculate the number of individual bases of our assembly matching a protein. All databases were downloaded on 15 May 2009. blast similarity searches against these databases were performed using e-value and bit-score cut-offs of 1e-5 and 80 bits respectively. For insect repeats, we concatenated B. mori predicted repeats provided by Dr Chris Smith (University of San Franscisco) with the Insecta class from Repbase (Jurka et al. 2005) and made nonredundant at the 95% level. To characterize H. melpomene genomic sequence repeats, BAC-end sequences were screened with the ReRep pipeline, which is optimized for identification of repetitive structures in a Genome Survey Sequence data set (Otto et al. 2008). Repeat databases for Insecta, Bombyx and Heliconius were then concatenated for BAC sequence annotation.

Annotation of the HmYb/Sb region

We used both automated and manual annotation to generate gene models for the candidate region. The motivation was to develop automated gene prediction methods for H. melpomene, but also investigate the extent to which such methods could be improved by manual inspection of gene models and comparison with raw sequence reads.

The Heliconius BAC sequences for the HmYb locus were individually annotated with the repeat database and the clustered EST contigs (see above) using the annotation pipeline MAKER (Cantarel et al. 2008). This identifies repeats, aligns ESTs and proteins to a DNA sequence, produces ab initio gene predictions, and automatically synthesizes the data into gene annotations with evidence-based quality indices. blast searches were performed against our database of B. mori proteins. Gene predictions were generated by the Semi-HMM-based Nucleic Acid Parser (Korf 2004) using a Hidden Markov Model optimized to the B. mori genome. The resulting gff files (those describing genes and other features associated with DNA) from the MAKER pipeline were analyzed and viewed with the Apollo Genome Annotation Curation Tool version 1.9.6 (Lewis et al. 2002).

The starting point for manual annotation was gene predictions as generated above and from the automated Bombyx gene prediction tool ‘Kaikogaas’ (http://kaikogaas.dna.affrc.go.jp/). Kaikogaas is an online tool for genome annotation based on parameters determined from the B. mori genome. Predicted genes from the two methods were concatenated into a single Artemis file (Rutherford et al. 2000; Carver et al. 2008), and the new models were used to search NCBI nucleotide, protein and EST sequence databases using tblastx or tblastn (cutoff e−5) as well as local databases of all the unassembled 454 sequence reads from H. m. cythera and H. m. malleti (blastn, cutoff e = 0.001). All significant Heliconius hits were assembled against BAC sequence with an alignment cutoff of 90% (H. melpomene 454/EST sequence) or 75% (other Heliconius EST sequence) nucleotide identity. All alignments were manually checked, and Artemis models were modified where necessary. Significant hits for other species were translated, and the most closely related species aligned with the translated H. melpomene gene models using ClustalW (Larkin et al. 2007). Where H. melpomene models diverged from other species, translated sequence from distantly related insects (e.g. Apis, Tribolium, Drosophila) was aligned, highly conserved regions were identified, and H. melpomene BAC sequence was searched for these regions as a starting point for gene model modification in Artemis. In addition to searches using the MAKER/Kaikogaas predicted gene set, 2 kb sections of BAC sequence that overlapped by 500 bp from the 7g12, 11j7 and 29b7 BACs were used in blastn searches against the H. m. cythera raw 454 sequence reads (cutoff e = 0.001). This analysis recovered expressed noncoding sequence, and generated additional gene models. The final number of 454 reads in each gene model is given in Table 1.

Table 1.   Annotated genes at the HmYb locus with putative homologues from Bombyx mori and Drosophila melanogaster
Heliconius melpomene genePutative gene nameNo. H. melpomenel454-EST readsBest B. moriblastp hit% IDBest D. melanogasterblastp hit% IDIdentified in butterflies
cyMaBic.Me.
  1. Putative gene names are based on blastp homology with a bitscore cut-off of 200. *One combination of exons at HM00023 shows homology with a Bombyx mori predicted gene which encodes a putative ATP binding protein. There are, however, many noncoding splice variants at this locus with no homology to other insect sequences. †The Heliconius melpomene HM00033 predicted protein is approximately four and a half times longer than Drosophila melanogaster ror (3061 amino acids vs. 685), but the length is conserved with B. mori BGIBMGA005561 (2841 amino acids). Four genes (HM00013/unkempt; HM00041/ penguin, HM00053/ Lethal (2) giant larvae, HM00054/ Zn finger protein) have putative D. melanogaster homologues with wing mutant phenotypes. Presence of putative homologues in Bicyclus anynana (Bic.) and Melitaea cinxia (Me.) at a blastn bitscore cut-off of 80 is also shown. cy, H. m. cythera; ma, H. m. malleti; NS, nonsignificant sequence identity at a blastp bitscore cut-off of 80; EST, expressed sequence tags.

HM00001Acylpeptide hydrolase01BGIBMGA00566746NS   
HM00002Acylpeptide hydrolase34BGIBMGA00566854NS   
HM00003HM0000300BGIBMGA00554766CG1094926  
HM00004 [HmYb]Trehalase-1B53BGIBMGA00566568CG936440XX
HM00006 [HmYb]Trehalase-1A35BGIBMGA00566458CG936440XX
HM00007 [HmYb]B9 protein00BGIBMGA00566367CG1487037  
HM00008 [HmYb]HM0000800BGIBMGA00554881CG509822  
HM00010 [HmYb]WD40 repeat domain 85274BGIBMGA00566260CG318440  
HM00011 [HmYb]CG1829211BGIBMGA00566191CG1829262  
HM00012 [HmYb]CG251900BGIBMGA00554954CG251941  
HM00013 [HmYb]Unkempt00BGIBMGA00566074Unkempt52  
HM00014 [HmYb]Histone H35538BGIBMGA005550100His3.3A89X 
HM00015 [HmYb]HM000152512BGIBMGA00565952CG3037333XX
HM00016 [HmYb]HM0001610BGIBMGA00555158CG528026  
HM00017 [HmYb]RecQ Helicase159BGIBMGA00566669mus30932XX
HM00018 [HmYb]HM0001835BGIBMGA00555380NS   
HM00019 [HmYb]BmSuc200BGIBMGA00555555NS  X
HM00020 [HmYb]CG57966761BGIBMGA00555669CG597648 X
HM00021 [HmYb]HM000217237BGIBMGA00565728NS   
HM00022 [HmYb]Enoyl-CoA hydratase9458BGIBMGA00565680CG654357 X
HM00023 [HmYb]ATP binding protein*xxBGIBMGA00555750CG1058132 X
HM00024 [HmYb]HM000244225BGIBMGA00565542Sur-819XX
HM00025 [HmYb]HM000253461BGIBMGA00565257cort15XX
HM00026 [HmSb]Poly(A)-specific ribonuclease (parn)2722BGIBMGA00565060NS   
HM00027 [HmSb]CG313203723BGIBMGA00564967CG3132020  
HM00028 [HmSb]ARP-like6023BGIBMGA00555984ARP-like72XX
HM00029 [HmSb]CG46923728BGIBMGA00564887CG469285XX
HM00030 [HmSb]Proteasome 26S non ATPase subunit 47142BGIBMGA00556093Pros5465XX
HM00031 [HmSb]HM0003155NS NS   
HM00032 [HmSb]Zinc phosphodiesterase10459BGIBMGA00564665jhI-142 X
HM00033 [HmSb]Serine/threonine-protein kinase (LMTK1)310BGIBMGA00556145ror†   
HM00034WD repeat domain 13 (Wdr13)43BGIBMGA00564581NS   
HM00035Tyrosine phosphatase (truncated)37BGIBMGA00564250Dome18XX
HM00036WAS protein family homologue 100BGIBMGA00564362Wash27  
HM00037Tyrosine phosphatase (full length)3832BGIBMGA00564259Dome18XX
HM00038Lethal (2) k05819 CG305410BGIBMGA00556272Lethal (2) k0581940 X
HM00039Mitogen-activated protein kinase (MAPKK)7044BGIBMGA00564189Licorne64XX
HM00040DNA excision repair protein ERCC-62619BGIBMGA00564064Hel89B20XX
HM00041Penguin13777BGIBMGA00563770Penguin31XX
BGIBMGA00563866
HM00042Thymidylate kinase00NS-CG575748 X
HM00043Caspase-activated DNase10BGIBMGA00563971Rep434  
HM00044Regulator of ribosome biosynthesis161102BGIBMGA00556480CG3240957XX
HM00045CG1265986BGIBMGA00556582CG1265940X 
HM00046CG335054217BGIBMGA00563677CG3350547 X
HM00047Sr protein8343BGIBMGA00563562SC3572  
HM00048HM0004800NS CG543527  
HM00049HM0004921BGIBMGA00556629NS   
HM00050Shuttle craft21BGIBMGA00563458Shuttle craft35  
HM00051HM0005100BGIBMGA00556744NS   
HM00052HM0005200BGIBMGA00563348NS X 
HM00053Lethal (2) giant larvae20BGIBMGA00557080Lethal (2) giant larvae45  
HM00054Zn finger protein6335BGIBMGA00557145Crooked legs18XX
HM00055Cohesion subunit10BGIBMGA00563271CG4126521  
HM00056Tetratricopeptide repeat protein00BGIBMGA00557283CG452548  
HM00057Ecdysone oxidase00BGIBMGA00571140CG951230XX
HM00058Cuticle protein (Cpr64Ac)8125BGIBMGA00563159Cuticular protein 64Ac40XX
HM00059CG673420BGIBMGA00562962CG673436  
HM00060Uridine 5′-monophosphate synthase8721BGIBMGA00562871Rudimentary-like52XX
HM00061HM0006131BGIBMGA00562624CG736822XX

Genes for which splice variants were identified from 454 transcriptome sequence (see Results) were verified for H. m. cythera and H. m. malleti by reverse transcription–PCR (RT–PCR) amplification and sequencing, using the same cDNA used to generate the 454 libraries as a template. Full details of these spliced gene models will be published elsewhere (G. Wu, personal communication). 5′ and 3′ rapid amplification of CDNA ends (RACE) (Clontech) primers were also designed to amplify longer transcripts than could be obtained from 454-EST sequence reads for HM00023/HM00024. In the case of HM00023 both 3′- and 5′-RACE primers were designed in each of the exons (coding and noncoding) identified from both H. m. cythera and H. m. malleti. Those which amplified clear products are given in Table S2 (Supporting information). The cDNA used for 454 sequencing was again used as a template. Thus, the final H. melpomene gene prediction set is based on automated gene prediction with support and modification based on H. melpomene transcript sequence, amino acid homology with other insects, and in some cases, additional RT–PCR.

To assess synteny around the HmYb locus, the genomic location of B. mori homologues was recorded from SilkDB (Xia et al. 2004), and H. melpomene genomic location defined as the number of nucleotides from the start of the AEHM-46 m10 BAC, with continual numbering over the entire BAC tilepath. The relative locations of B. mori and H. melpomene genes were plotted by taking the mid-point of each gene.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. Conflicts of interest
  10. References
  11. Supporting Information

Linkage mapping of HmYb and HmSb

The HmYb locus controls the presence or absence of a yellow bar on the hindwing of Heliconius melpomene, whilst the tightly linked locus HmSb similarly controls a white margin on the hindwing. We have used molecular markers to define the genomic location of these loci. A total of 371 individuals from four broods were scored for the segregation of the hindwing bar, and, because of genetic dominance, 175 of these were also scored for the hindwing margin (Fig. 1). From the 175 individuals scored for both pattern elements, two individuals were identified with recombinant phenotypes between HmYb and HmSb. These individuals were confirmed as genetic recombinants using molecular markers, offering the first molecular confirmation of recombination between tightly linked pattern loci in Heliconius (Fig. 3b). Assuming a genome-wide recombination rate of 180 kb/cM (Jiggins et al. 2005), the two recombinants indicate that HmYb and HmSb are 150 kb apart, although this is an approximate estimate given the variation in recombination rate known to occur across the genome (e.g. see Fig. 3).

image

Figure 3.  The HmYb/Sb loci. (a) The BAC clone tilepath spanning the HmYb/Sb loci showing markers used for mapping. (b) Fine-scale linkage mapping shows the number of recombinants between molecular markers and the two pattern loci in 371 individuals (HmYb) and 175 individuals (HmSb) respectively. (c) The BAC clones containing HmYb locus genes (AEHM-7g12, AEHM-11j7, AEHM-29b7) are shown in detail. BAC AEHM-21b20 is not predicted to contain any genes and is therefore shown as a dotted line not to scale. The HM000 prefix is not shown on gene numbers for clarity. Genes with splice variants are indicated by *; see Results and Fig. S3 (Supporting information) for details. Untranslated regions (UTRs) are shown in turquoise. HM00010 has alternative 5′-UTRs, one shared with HM00011 (-1) and one unique (-2). (d) Presence or absence of gene objects in transcriptome data sets from two Heliconius melpomene pattern races shows that the majority of genes in the region are expressed in developing wings of both H. m. cythera and H. m. malleti.

Download figure to PowerPoint

We constructed a BAC tilepath across the HmYb/Sb loci, and carried out fine-scale linkage mapping of markers developed from both coding and noncoding DNA. The BAC tilepath consisted of eleven clones, 1.42 Mb in total length, representing 1.15 Mb of nonredundant sequence. All clones have been sequenced by the Wellcome Trust Sanger Institute to HTG phase 3 quality (Fig. 3a). Linkage mapping of 32 markers across the region (Fig. 3b) demonstrated that the HmYb phenotype was completely linked to molecular markers across a 323 kb region, encompassing a portion of the AEHM-7g12 BAC, and all of the clones AEHM-11j7, 29b7 and 21b20. This inclusive region for the HmYb pattern locus was defined by recombination events at a gene in the AEHM-7g12 BAC (HM00004/Trehalase 1B, see below) and a noncoding BAC-end marker in AEHM-21b20 (21b20-T7, Fig. 3b). The HmSb phenotype was completely linked to markers across an overlapping region of approximately 271 kb and included part of AEHM-21b20, all of AEHM-22A15 and AEHM-24o2, and one end of AEHM-31B4. The HmSb pattern locus was defined by recombination events at the BAC-end markers 36a11-SP6 and 31b4-SP6.

Characterizing the H. melpomene transcriptome

Expression libraries were created from developing wing discs of two phenotypically distinct H. melpomene strains. The first, H. m. cythera, displayed the HmB red forewing band, yellow hindwing bar (HmYb) and hindwing margin (HmSb), whilst the second, H. m. malleti, displayed the red-rayed HmD hindwing phenotype, but was somewhat polymorphic for the shape of the forewing yellow band phenotype. Each DNA pool was normalized to reduce the transcript level of highly expressed genes and increase the rate of gene discovery. After trimming a total of 195 159 sequence reads were obtained for H. m. malleti representing 48 Mb from one run of 454 FLX sequencing, and 482 027 reads, representing 103 Mb, for H. m. cythera from 1.5 runs (Accession no. SRA008857). The average read length after trimming was 214 bp.

To choose the best de novo assembly method for our data, we assembled sequence reads using both the Roche Newbler pipeline and the open source MIRA assembler (Chevreux et al. 2004; Margulies et al. 2006). The results are illustrated by alignment of two reference genes to the AEHM-11j7 BAC clone (Fig. 2). Both assemblers performed well on the relatively simple Histone H3 gene. However, the MIRA assembler significantly under-assembled the data for the Enoyl Co-A Hydratase gene, and was more prone to indel errors (Fig. 2). The Newbler pipeline produced two contigs for this gene as compared with the six generated by MIRA. Addition of the published Sanger ESTs led to a further improvement in the assembly, such that the two Newbler contigs were joined into a single contig. On the basis of this comparison, we used the Newbler assembly to generate a reference contig set for further analysis. In combination with the 4971 Sanger EST sequences available on dbEST (September 2008) for H. melpomene, an assembly of all the H. melpomene data generated 25 585 contigs, representing 13 Mb, and 56 404 singletons. Of these, there were 8546 ‘large’ contigs with an average contig length of 1130 bp representing 9.7 Mb. This provides an excellent resource for annotation of genomic sequence and future expression profiling experiments.

image

Figure 2.  Performance of sequence assembly strategies at the exon level. TOP: Two regions of the BAC clone AEHM-11j7 (GenBank identifier: 160950684) were analyzed, indicated by dashed lines. LEFT: A 411-base open reading frame (ORF1) homologous to Histone H3 was compared. MIRA and Newbler assemblies performed equally well, as both had 100% coverage of ORF1, and predicted similar untranslated regions. RIGHT: A 894-base ORF (ORF2) homologous to enoyl-CoA hydratase was found containing six exons spanning a total of 4948 bases. Six MIRA contigs match this region, covering 11–100% of ORF2; two nonoverlapping Newbler contigs account for 99.2% of the ORF; when Sanger expressed sequence tags (EST) were included in the Newbler assembly (i.e. 454 + EST), 100% coverage was attained. All contigs are free of insertion/deletion (indel) polymorphisms within the coding regions except for Mira4 and 5, which have six (five single base insertions and one deletion) and one indels, respectively.

Download figure to PowerPoint

Our coverage of the transcriptome was assessed by similarity searches of the joint 454 + EST assembly (c. 82 000 contigs and singletons) with reference proteomes. Overall, our transcriptome assembly contains 11% of the Uniref100 database with 8370 H. melpomene proteins identified and 9107 (55%) of the Bombyx mori reference proteome (with 10 075 H. melpomene proteins identified). To identify proteins yet to be curated, we searched with tblastx the assemblies of two butterflies with substantial public EST data: Bicyclus anynana and Melitaea cinxia. The H. melpomene assembly identified 6019 and 6346 of these proteins respectively. It is expected that as more butterfly transcriptomes are becoming available, we will be able to accurately identify a higher number of butterfly proteins.

A customized set of 347 H. melpomene repeat sequences (available upon request) was combined with a database of insect repeats (see Methods) for BAC sequence annotation. One putative H. melpomene repeat showed high similarity to a zinc-finger transcription factor (blastx, e-value 3e-29) and this sequence was removed from the database for subsequent analysis. RepeatMasker (v. open-3.2.6) (A.F.A. Smit, R. Hubly, P. Green, unpublished data. v. open 3.2.6.) was then used to mask repeats within BAC clones prior to automated gene annotation. In total, the masked sequence represented between 16.5% (AEHM-11j7) and 34.9% (AEHM-41c10) of the total BAC clone sequence.

Annotation of the HmYb region

To identify putative functional sites in both coding and noncoding sequence, we carried out a detailed annotation of the BAC sequences linked to HmYb/Sb. Building on a previous study, where eight putative genes were identified in three H. melpomene BAC sequences linked to HmYb (AEHM-41c10, 7g12 and 11j7) (Papa et al. 2008), we here annotate the entire HmYb/Sb candidate region. In total 59 gene objects were found in the BAC tilepath spanning the clones AEHM-7g12- 31j7, 45 of which had clear homologues in other insect species (Table 1). Linkage mapping narrowed the HmYb locus to a region containing 20 genes (HM00004HM00025), and the HmSb locus to eight gene objects (HM00026HM00033).

Across the annotated tilepath region, there were three instances of gene duplication: Acylpeptide hydrolases HM00001 and HM00002; Trehalases HM00004 and HM00006 (HmYb region); and tyrosine phosphatases HM00035 and HM00037. The Trehalase duplication has been noted previously (Papa et al. 2008), although the copy numbers should be referred to as Trehalase-1A (HM00006) and Trehalase-1B (HM00004) to reflect direction of transcription and probable orthology to B. mori Trehalase genes (Fig. S2, Supporting information). H. melpomene HM00004 has a premature stop codon at amino acid position 137. A single H. m. cythera 454 sequence read covering the region also encoded the stop codon, confirming that this was unlikely to be a sequencing error. Tyrosine phosphatases HM00035 and HM00037 had 87% amino acid identity, but HM00035 was truncated by approximately 600 amino acids at the C terminus.

Ten additional genes showed alternative splicing; HM00010, HM00011, HM00023 and HM00025 in the HmYb region, HM00026, HM00032 in the HmSb region, and HM00039, HM00040, HM00047 and HM00054 outside the candidate regions. Two of these, HM00023 and HM00054 had a large number of apparently noncoding RNA transcripts. At one of these, HM00023, RT–PCR was used to confirm gene models, which demonstrated a large number of splice variants for this gene (Fig. S3, Supporting information). In total, 18 putative exons were identified from transcriptome sequence, and these were joined in many combinations. One exon combination (as annotated in Fig. 3c) had homology to a B. mori gene in the corresponding chromosomal location with predicted ATP binding activity, but the H. melpomene protein product was truncated at both ends relative to B. mori (Table 1, Fig. S3, Supporting information). Other transcripts contained further premature termination codons, and typically did not encode an open reading frame longer than a single exon because of insertions/deletions at intron/exon boundaries. Annotation of HM00025 (a putative cort/fizzy family homologue) also revealed a number of transcript variants. The most common transcript had nine exons, encoding a protein product of 365 amino acids (Fig. 3). RT–PCR confirmed an alternative transcript that lacked exon 5, and identified a number of alternative 5′-untranslated regions (UTRs).

In addition to this splicing in coding regons, in one case a single 5′-UTR was associated with two genes (HM00010, HM00011, HmYb region) (Fig. 3c). Annotation of HM00010, a gene characterized by WD40 repeat domains, revealed two alternative 5′-UTR regions: one shared with HM00011 (-1), and one adjacent to the first coding exon (-2, Fig. 3c). The expression of both isoforms was confirmed using RT–PCR. No similar alternative splicing was found in either B. mori or Drosophila melanogaster EST databases, and in D. melanogaster putative HM00011 and HM00010 homologues (Table 1) are separated by ∼4.5 Mb.

Previous studies have shown conserved synteny between moths and butterflies at a chromosomal level (Pringle et al. 2007; Sahara et al. 2007; Beldade et al. 2009). More specifically, the eight HmYb linked genes previously identified also show conserved microsynteny with B. mori (Papa et al. 2008). Here, with more detailed annotation, gene order remains strongly conserved right across the entire HmYb/Sb loci with respect to B. mori (Fig. 4). Despite the considerable evolutionary distance between the species (≈100 million years Pringle et al. 2007) and large difference in estimated genome size (B. mori = 500 Mb Xia et al. 2004; H. melpomene = 292 Mb (Jiggins et al. 2005), chromosomal location, gene order, direction of transcription and relative spacing between genes were all highly conserved (Fig. 4). Seven predicted genes were present in B. mori and not H. melpomene in the HmYb region (BGIBMGA005653, −5654, −5558, 5554, −5552, −5658, −5546), although according to the B. mori genome annotation, only the last three of these had support from EST sequence or blast homology. Overall, there was an almost uniform increase in B. mori intergenic and intronic sequence relative to H. melpomene. As described previously (Papa et al. 2008), a single gene (a putative homologue of RecQ Helicase, HM00017) was found to have been translocated within the sequenced region (Fig. 4), and a small inversion was found outside the candidate regions covering genes HM00041–44. The first and last genes (HM00001, HM00061) were also found in opposite orientations between the species. The truncated duplicate HM00035 was not found in B. mori, and gene HM00057/ecdysone oxidase was not found within the homologous B. mori scaffold contig (nscaf2829), but several putative homologues were found in other genomic regions.

image

Figure 4.  Comparison of microsynteny between Heliconius melpomene and Bombyx mori across the HmYb/Sb tilepath. The chromosomal location, relative order and spacing of putative homologues between B. mori and H. melpomene across BAC clones AEHM-7g12-31j7 is highly conserved. Gene location is given relative to the start of the AEHM-46m10 BAC sequence for H. melpomene, and within genomic scaffold contig nscaf2829 for B. mori. The increase in genome size between B. mori and H. melpomene has occurred at a consistent rate across both coding and noncoding regions. The numbered points are (i) CG2519, (ii) recQ helicase, (iii) the novel Tyrosine phosphatase gene HM00035 and (iv) Lethal (2) giant larvae.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. Conflicts of interest
  10. References
  11. Supporting Information

Genetic loci controlling Heliconius wing patterns are ‘hotspots’ for evolutionary change (Joron et al. 2006a; Papa et al. 2009). The tightly linked HmSb and HmYb loci control the presence of a white wing margin and yellow hindwing bar respectively in Heliconius melpomene. In the co-mimic species, Heliconius erato, this genomic region controls parallel pattern elements, and in both species the loci also have pleiotropic effects on various aspects of wing phenotype (Baxter et al. 2009). The HmYb locus also differentiates closely related species such as Heliconius cydno and Heliconius pachinus and hence contributes to reproductive isolation and speciation (Gilbert 2003; Naisbit et al. 2003). In Heliconius numata, the homologous region is a ‘supergene’ that controls virtually all aspects of pattern variation, and facilitates mimicry of distantly related Melinaea (Ithomiini) species (Joron et al., 2006c). Here, for the first time we have sequenced, mapped and annotated the region responsible for these pattern changes in heliconius. Furthermore, we have characterized the wing transcriptome of H. melpomene using 454 pyrosequencing, facilitating sequence annotation and generating hypotheses for identification of functional variants at HmYb.

Considering that the transcriptome data are derived from a single tissue (wings) isolated over a relatively short period of the lifespan (late larval through pupal stages), the next-generation sequencing approach we employed has obtained a remarkable number of genes, indicating a highly complex wing transcriptome. Comparison with the Bombyx mori proteome suggests that a minimum of 9107 (55%) unique genes have been sampled in our libraries. For comparison, a microarray study of pupal wing development in Drosophila melanogaster showed expression of 9394 genes in total (Ren et al. 2005), suggesting that we may have nearly saturated gene coverage of the butterfly ‘wing’ transcriptome. As in previous studies, the high sequence coverage of many genes allows some correction of the higher error rates encountered in pyrosequencing, by alignment of high sequence depth at each base position (Cheung et al. 2006; Huse et al. 2007; Vera et al. 2008). Nonetheless, alignment shows that the coverage of B. mori amino acid positions in our data is 37%, suggesting that overall sequence coverage of each gene remains incomplete. The transcriptome coverage obtained here is significantly greater than that from another recent survey of a butterfly, Melitaea cinxia, in which around 600 K 454 sequence reads showed similarity to 6289 B. mori proteins (Vera et al. 2008). The increased coverage from Heliconius is surprising given the broader coverage of tissues sampled in Melitaea, but the discrepancy is most probably because of advances in technology, such that the 454FLX technology used here gives significantly longer read lengths (250 bp rather than 110 bp).

A detailed annotation of the candidate HmYb/Sb locus is essential for developing and testing hypotheses regarding the nature of the wing pattern genes (Papa et al. 2008). In addition, alignment of the transcriptome to high-quality genome sequence allows for verification of the assembly methods used and of the coverage obtained in the transcriptomic survey. Thus the combination of a fully-sequenced BAC tilepath and deep coverage of expressed sequence can generate testable hypotheses about the nature of patterning loci. In total, eight putative genes were identified as candidates for HmSb, and 20 for HmYb. In both instances, a high proportion were present in our wing transcriptome data (8/8 and 17/20 respectively, Fig. 3c, d), further suggesting that the overall coverage is relatively complete. Similarly, many of these genes were also present in other butterfly transcriptomes (Table 1). Interestingly, the 24 000 Heliconius EST sequences currently in NCBI’s dbEST were insufficient for even rough genome annotation. Only 4 out of the 20 HmYb genes were represented in published EST sequences (blastn with bitscore cutoff of >500; significant sequence identity for HM000 06, 14, 21 and 22). Hence, the H. melpomene 454 transcriptome libraries we have generated are a powerful tool for annotation of the Heliconius genome, and the deep gene coverage obtained will facilitate identification of the developmental pathways expressed during butterfly wing development.

Strikingly, no obvious candidate genes identified from previous studies of butterfly wing patterning are located in the genomic region studied here. The conserved developmental pathways wingless and TGF-β are deployed in pattern specification in other butterflies (Carroll et al. 1994; Monteiro et al. 2006), with transcription factors such as engrailed, hedgehog and distalless expressed in patterns correlated with wing eyespots (Keys et al. 1999; Brunetti et al. 2001; Reed & Gilbert 2004), none of which are represented here. We have previously speculated that polymorphism in Heliconius might similarly be controlled by transcription factor(s) that integrate spatial information and regulate downstream effector genes such as pigmentation pathways (Joron et al., 2006c). We here identify four genes with mutant wing phenotypes in the fruitfly D. melanogaster (unkempt, crooked legs, lethal giant larvae and penguin), the first two of which are also transcription factors. One of these, HM00013/unkempt (Mohler et al. 1992), was located within the candidate region for the two wing patterning loci, and although not recovered from the transcriptome libraries (Table 1), has been shown to be expressed in wings using RT–PCR (Fig. S4, Supporting information). The remaining three genes, crooked legs, lethal giant larvae and penguin (Prout et al. 1997; D’Avino & Thummel 2000), are located outside the candidate regions but are all present in the transcriptome libraries. These genes should not be entirely ruled out as candidates, since pattern switching could result from cis-regulatory control of these genes from within the candidate regions. Once identified, it will be interesting to determine whether the molecular mechanisms of pattern determination are derived in Heliconius, or shared with other butterflies. The recent mapping of the Bigeye mutant in Bicyclus anynana to the same chromosome as the HmYb locus provides an intriguing hint that the latter may be the case (Beldade et al. 2009).

Alternative splicing is an under-studied source of evolutionary and phenotypic diversity, which is likely to have important implications in evolutionary and ecological studies (Marden 2008). Here, we have located nine genes with patterns of alternative splicing including alternate exons and UTRs that might have functional significance in wing development. In one case, HM00025, there were differences between the two colour pattern races in the isoforms present, making this gene a good candidate for further investigation. As described previously for the Melitaea butterfly, alternative splicing is not well characterized in de novo EST assemblies, or by automated gene prediction pipelines (Vera et al. 2008). These alternative splicing patterns would not have been discovered without manual alignment of the transcriptome to the genome.

A striking characteristic of wing patterning loci in H. melpomene is the tight genetic clustering of genes with related phenotypic effects. Notably, HmB and HmD loci both regulate red pattern elements and are grouped on linkage group 18, whilst HmYb, HmSb and HmN all regulate yellow elements and are grouped on linkage group 15. Nonetheless, the evidence that these genetically linked elements are indeed multiple loci is based on rare phenotypic recombinants, which could also be explained by developmental aberration or mutation at unlinked loci (Sheppard et al. 1985; Mallet 1989). Our molecular genotyping provides the first evidence from linked genetic markers that at least two of these loci are indeed distinct elements, with HmYb and HmSb separated on the same chromosome by around 150 kb. Furthermore, recent work has also linked mate preference to colour pattern loci in between the sister species, H. cydno and H. pachinus (Kronforst et al. 2006), and in genetic crosses between H. cydno and H. melpomene (R. Merrill, personal communication). It seems likely therefore that, as in other taxa, multiple traits related to divergence and speciation are tightly linked in the genome (Hawthorne & Via 2001; Noor et al. 2001). Our annotation could therefore form the basis for study of many speciation-related traits.

Conclusion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. Conflicts of interest
  10. References
  11. Supporting Information

Heliconius colour patterns offer an excellent opportunity to study genes involved in both local adaptation and speciation. One of the most intriguing aspects of the HmYb locus is its homology with loci identified in both the phenotypically convergent Heliconius erato and the divergent species Heliconius numata (Joron et al., 2006c). Here, we have mapped this region in detail and sequenced 11 BAC clones representing 1.2 Mb of contiguous high-quality genomic sequence across the HmYb and HmSb loci. The molecular identification of the region described here in Heliconius melpomene has already formed the basis for parallel analysis in both H. erato and H. numata by our collaborators (B. Coulterman, M. Joron, in preparation). Furthermore, we have generated extensive sequence surveys of both genomic and transcriptomic sequence, which have facilitated both identification of repeat sequences and genome annotation. The strength of the approach described here is that a combination of high-quality genome sequence alongside high-throughput transcriptomics allows us to generate detailed gene models for all genes expressed during wing development, identify patterns of alternate splicing and characterize noncoding transcripts that would be otherwise difficult to identify. The mapping of the transcriptome to genomic sequence is obviously routine in organisms with a complete genome sequence (Weber et al. 2007), but is more rarely applied in nonmodel systems. In some ways, we have only scratched the surface of the potential utility of the transcriptomic data, which can also be used for single nucleotide polymorphism identification, comparative genomic mapping, microarray design and quantitative transcriptomic experiments. This highlights the exciting ecological and evolutionary questions that can now be addressed by taking advantage of rapid developments in sequencing technology (Hudson 2008).

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. Conflicts of interest
  10. References
  11. Supporting Information

This work was funded by a NERC studentship to LF, a BBSRC grant to CJ and RffC, a NERC New Investigator Grant to CJ, a Royal Society URF to CJ, and a BBSRC PhD studentship to NC. We thank all the Sanger sequencing operations staff for library construction, DNA sequencing, loading and sequence improvement, and Ian Korf for the Bombyx HMM for gene prediction.

Conflicts of interest

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. Conflicts of interest
  10. References
  11. Supporting Information

The authors have no conflict of interest to declare and note that the sponsors of the issue had no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. Conflicts of interest
  10. References
  11. Supporting Information

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Conclusion
  8. Acknowledgements
  9. Conflicts of interest
  10. References
  11. Supporting Information

Table S1 Extension of the BAC tilepath

Table S2 Primers used to map and characterize the HmYb/Sb loci

Table S3 BAC clone accession numbers

Fig. S1 Example of BAC extension from fingerprint contig 105.

Fig. S2 Neighbour-joining tree of Trehalase gene orthology in insect species.

Fig. S3 Splice variants identified from the HM00023 locus in H. m. malleti and cythera.

Fig. S4 Amplification of unkempt transcripts from Heliconius melpomene races with different HmYb alleles.

Please note: Wiley-Blackwell are not responsible for the content or functionality of any supporting materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article.

FilenameFormatSizeDescription
MEC_4475_sm_SUPPLEMENTARYMATERIAL.doc573KSupporting info item

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.