The Salmonella genomic island 1 is an integrative mobilizable element

Authors


E-mail cloeckae@tours.inra.fr; Tel. (+33) 247 427 750; Fax (+33) 247 427 774.

Summary

Salmonella genomic island 1 (SGI1) is a genomic island containing an antibiotic resistance gene cluster identified in several Salmonella enterica serovars. The SGI1 antibiotic resistance gene cluster, which is a complex class 1 integron, confers the common multidrug resistance phenotype of epidemic S. enterica Typhimurium DT104. The SGI1 occurrence in S. enterica serovars Typhimurium, Agona, Paratyphi B, Albany, Meleagridis and Newport indicates the horizontal transfer potential of SGI1. Here, we report that SGI1 could be conjugally transferred from S. enterica donor strains to non-SGI1 S. enterica and Escherichia coli recipient strains where it integrated into the recipient chromosome in a site-specific manner. First, an extrachromosomal circular form of SGI1 was identified by PCR which forms through a specific recombination of the left and right ends of the integrated SGI1. Chromosomal excision of SGI1 was found to require SGI1-encoded integrase which presents similarities to the lambdoid integrase family. Second, the conjugal transfer of SGI1 required the presence of a helper plasmid. The conjugative IncC plasmid R55 could thus mobilize in trans SGI1 which was transferred from the donor to the recipient strains. By this way, the conjugal transfer of SGI1 occurred at a frequency of 10−5−10−6 transconjugants per donor. No transconjugants could be obtained for the SGI1 donor lacking the int integrase gene. Third, chromosomal integration of SGI1 occurred via a site-specific recombination between a 18 bp sequence found in the circular form of SGI1 and a similar 18 bp sequence at the 3′ end of thdF gene in the S. enterica and E. coli chromosome. SGI1 appeared to be transmissible only in the presence of additional conjugative functions provided in trans. SGI1 can thus be classified within the group of integrative mobilizable elements (IMEs).

Introduction

A chromosomal genomic island called Salmonella genomic island 1 (SGI1) was initially described in epidemic multidrug-resistant Salmonella enterica serovar Typhimurium phage type DT104 strains (S. Typhimurium DT104) (Boyd et al., 2000; 2001). The 43 kb SGI1 contains an antibiotic resistance gene cluster conferring resistance to ampicillin (Ap), chloramphenicol (Cm), florfenicol (Ff), streptomycin (Sm), spectinomycin (Sp), sulphonamides (Su) and tetracycline (Tc) of epidemic multidrug-resistant S. Typhimurium DT104 (Arcangioli et al., 1999; Bolton et al., 1999; Briggs and Fratamico, 1999). Epidemic S. Typhimurium DT104 emerged during the 1980s as a global health problem because of its involvement in diseases in animals and humans (Glynn et al., 1998; Poppe et al., 1998; Tauxe, 1999; Hancock et al., 2000; Threlfall, 2000; Cloeckaert and Schwarz, 2001; Ribot et al., 2002). Since its identification in epidemic multidrug-resistant S. Typhimurium DT104, SGI1 has been described in S. Typhimurium DT120 and in other S. enterica serovars (S. Agona, S. Paratyphi B, S. Albany, S. Meleagridis and S. Newport) (Cloeckaert et al., 2000; Boyd et al., 2001; 2002; Meunier et al., 2002; Doublet et al., 2003; 2004a; Ebner et al., 2004; Mulvey et al., 2004).

The 13 kb SGI1 antibiotic resistance gene cluster is located near the 3′ end of SGI1 and constitutes a complex class 1 integron that belongs to the In4 group (Boyd et al., 2002). The antibiotic resistance gene cluster of SGI1 is bounded by inverted repeats of 25 bp IRi and IRt and have a 3′-CS that includes a copy of IS6100 (Brown et al., 1996; Partridge et al., 2001a,b). Further, the antibiotic resistance gene region is surrounded by 5 bp direct repeats, strongly suggesting it was integrated in SGI1 by a transposition event (Partridge et al., 2001a,b; Boyd et al., 2002). Thus, the antibiotic resistance gene cluster of SGI1 can be considered as a complex In4-type integron (Boyd et al., 2002). Interestingly, in SGI1 there is a duplication of a part of the 5′-CS, that lead to a second attI1 site followed by a gene cassette. Variant SGI1 antibiotic resistance gene clusters have recently been described in S. Typhimurium DT104, S. Agona, S. Albany and S. Newport. SGI1 variants were accordingly classified in SGI1-A to SGI1-H (Boyd et al., 2002; Doublet et al., 2003; 2004a,b). These clusters of antibiotic resistance genes were likely generated through chromosomal recombinational events or by antibiotic resistance gene cassette replacement at one of the attI1 sites and conferred different antibiotic resistance profiles.

The 43 kb SGI1 has been previously sequenced and found to contain 44 predicted open reading frames (ORFs) (GenBank accession number AF261825) (Boyd et al., 2001). Fifteen ORFs did not show any significant homology to known gene sequences. In the first part of SGI1, a number of ORFs show significant homology to plasmid-related genes involved in mating pair formation and DNA transfer (Boyd et al., 2001). These ORFs have putative products that show similarity to mating pair stabilization protein, pilus assembly proteins, bacterial DNA helicase and ATPase (Boyd et al., 2001). Immediately downstream of the imperfect left 18 bp direct repeat (DR-L) flanking SGI1 in the Salmonella chromosome, the first SGI1 gene encodes a putative integrase (int). Overlapping the int gene by 4 bp, a putative excisionase gene, xis, is trancribed in the opposite direction. Products of SGI1int and xis genes exhibit 29% and 31% identity to similar proteins from the Bacteroides fragilis transposon Tn4555 respectively (Boyd et al., 2000). The G+C content for SGI1 is 49.17%, compared with 51–53% for the S. Typhimurium genome. Within SGI1, the resistance gene cluster is 58.7% G+C, whereas the 5′ region is 44% G+C. Thus, the G+C content suggests a potential mosaic structure for SGI1 (Boyd et al., 2001).

The 43 kb SGI1 is located between the thdF and int2 genes of the chromosome of S. Typhimurium. The int2 gene is part of a retron sequence which has been reported to date only in S. Typhimurium strains (Boyd et al., 2000; 2001). In all other SGI1-carrying S. enterica serovars, SGI1 showed the same chromosomal location i.e. between the thdF and the yidY gene, which is the gene following the retron sequence in S. Typhimurium (Boyd et al., 2001; 2002; Meunier et al., 2002; Doublet et al., 2003; 2004a,b,c; Ebner et al., 2004). In all S. enterica serovars, SGI1 is flanked by imperfect 18 bp direct repeats at the left and right junctions in the Salmonella chromosome. The right junction direct repeat sequence (DR-R) was previously shown to be identical to the last 18 bp of the thdF gene from non-SGI1 carrying S. enterica serovars (Boyd et al., 2001; Doublet et al., 2003). However, the left junction direct repeat sequence (DR-L) is identical in all serovars, suggesting the origin of this sequence may be from the SGI1 donor (Doublet et al., 2003). The SGI1 identification on the chromosome of several S. enterica serovars, the imperfect direct repeats flanking SGI1 in the Salmonella chromosome, and the SGI1-borne integrase and excisionase, indicated its horizontal transfer potential.

Since the early 1980s, a large number of different chromosomally integrated conjugative elements have been identified (Churchward, 2002). These mobile elements carry different functions such as antibiotic resistance, specific degradation, symbiosis and virulence (Osborn and Boltner, 2002). At first, they were all classified as conjugative transposons. However, as more chromosomal conjugative elements have been analysed, many mobile elements appeared to integrate into a specific site in the recipient which was the same site in which they reside in the donor (Churchward, 2002). Thus, these site-specific integrated elements did not correspond to the definition of a transposon. Recently, Burrus et al. (2002a) proposed to classify as integrative and conjugative elements (ICEs), mobile elements which excise by a site-specific recombination, transfer by conjugation and integrate by recombination between a specific site of the circular form and a site in the host genome.

Conjugative transposons have been largely studied in Gram-positive Streptococci and Gram-negative Bacteroides (Churchward, 2002). Conjugative transposon-like elements in Enterobacteriaceae have been less studied (Pembroke et al., 2002). The SXT element found in Vibrio cholerae appeared to be larger than common Gram-positive conjugative transposons (Beaber et al., 2002; Pembroke et al., 2002). The SXT element is a typical ICE which has been previously termed constin (acronym for conjugative self-transmissible, integrating element) (Hochhut and Waldor, 1999). SGI1 shares very similar characteristics with the SXT element of V. cholerae. They both carry multiple antibiotic resistance genes including the floR gene; they both present a mosaic structure (Boyd et al., 2001; Beaber et al., 2002); chromosomal integration and excision of the SXT element requires the integrase-encoding int gene that is also found in SGI1; integration of the SXT element occurs via a site-specific manner at the 5′ end of prfC of the V. cholerae and E. coli chromosomes (Hochhut and Waldor, 1999); SGI1 has the same location in different S. enterica serovars, i.e. between the thdF and yidY genes of the chromosome (Boyd et al., 2001; 2002; Meunier et al., 2002; Doublet et al., 2003; 2004b,c; Ebner et al., 2004).

We report here the transfer of SGI1 by conjugation from different serovars of S. enterica SGI1-carrying donor strains to S. enterica and E. coli recipient strains. An extrachromosomal circular form of SGI1 was detected and sequence analysed for the site-specific recombination with the chromosomal host sequence. Conjugal transfer of SGI1 required the presence of a helper plasmid, i.e. the conjugative IncC plasmid R55 introduced in the SGI1-donor strains in this study. SGI1 integrated in the recipient E. coli or S. enterica chromosome in a site-specific manner at the same site where SGI1 is located in the S. enterica chromosome, i.e. 3′ end of thdF. SGI1 appeared to be a non-self-transmissible but mobilizable element.

Results

Detection of an extrachromosomal circular form of SGI1

Conjugative transposons and ICEs such as SXT from V. cholerae both integrate and excise from the chromosome via an extrachromosomal circular intermediate (Churchward, 2002). We tested whether an extrachromosomal circular SGI1 element is formed in the different SGI1-carrying S. enterica serovars. As previously reported (Boyd et al., 2000), tests for excision of SGI1 by polymerase chain reaction (PCR) experiments using primers located on the chromosome and genomic DNAs from S. Typhimurium DT104 strains harbouring SGI1, were performed but without success (Boyd et al., 2000). Therefore, we tried to purify an extrachromosomal form of SGI1 by different plasmid extraction methods. No extrachromosomal form of SGI1 could be detected by Southern blot hybridization of these plasmid preparations (data not shown). Thus, we used a more sensitive PCR assay to detect an extrachromosomal form of SGI1 in a concentrated plasmid preparation by a two-step DNA amplification. Primers SGI1circ1 and SGI1circ2 oriented towards the left and right ends of SGI1 were used (Table 1, Fig. 1). These primers would only amplify a product of 364 bp if SGI1 excizes from the chromosome and circularizes by recombination between DR-L and DR-R of the integrated SGI1. A PCR fragment of the expected size was obtained from S. Agona strain 959SA97 and S. Albany strain 7205.00 after a second round of PCR amplification by using the same primers (Fig. 2). This result indicated that a circular extrachromosomal form of SGI1 occurs in S. enterica strains harbouring the integrated SGI1. No PCR product for the circular form of SGI1 was obtained for S. Typhimurium DT104 strain BN9181 and S. Paratyphi B strain 44. The plasmid extraction procedures were probably inefficient to isolate a circular extrachromosomal form of SGI1 from these serovar strains or the frequency of excision was possibly too low to be detected by this assay in these strains. The PCR fragments obtained for S. Agona strain 959SA97 and S. Albany strain 7205.00 were sequenced to determine the specific SGI1 recombinational site for the insertion and excision of SGI1 into thdF (see below).

Table 1.  Bacterial strains, plasmids and primers used in this study.
Strains and plasmidRelevant genotype and resistance profilea or characteristicsReference or source
  • a

    . Abbreviations: Ap, Ampicillin; Az, Sodium Azide; Cm, Chloramphenicol; Enr, enrofloxacin; Ff, Florfenicol; Gm, Gentamicin; Km, Kanamycin; Sm, Streptomycin; Sp, Spectinomycin; Su, Sulphonamides; Tc, Tetracyclines; Tm, Trimethoprim.

  • b

    . Strains labelled as TC1 are E. coli BM14 transconjugant strains; the number before TC1 corresponds to the strain number of the parental S. enterica donor strain.

S. enterica
 Typhimurium DT104 BN9181SGI1+; ApCmFfSmSpSuTc Arcangioli et al. (1999)
 Agona 959SA97SGI1+; ApCmFfSmSpSuTc Cloeckaert et al. (2000)
 Agona 47SA97SGI1-C+; SmSpSu Boyd et al. (2002)
 Agona 47SA97Δint::kanSGI1-C+, SGI1Δint::kan; KmSmSpSuThis study
 Agona 47SA97Δxis::kanSGI1-C+, SGI1Δxis::kan; KmSmSpSuThis study
 Paratyphi B 44SGI1+; ApCmFfSmSpSuTc Meunier et al. (2002)
 Albany 7205.00SGI1-F+; ApCmFfSuTcTm Doublet et al. (2003)
 Schwarzengrund CGST5SGI1; EnrThis study
 Schwarzengrund CGST5TC1SGI1-F+; ApCmEnrFfSuTcTmThis study
E. coli K-12
 BM14 pro met azi; AzInstitut Pasteur, France
 BM14-9181TC1bSGI1+; ApAzCmFfSmSpSuTcThis study
 BM14-959TC1SGI1+; ApAzCmFfSmSpSuTcThis study
 BM14-44TC1SGI1+; ApAzCmFfSmSpSuTcThis study
 BM14-7205TC1SGI1-F+; ApAzCmFfSuTcTmThis study
 BM14-47TC1SGI1-C+; AzSmSpSuThis study
Plasmids
 IncC R55 (K. pneumoniae)Tra+; ApCmFfGmKmSu Gaffney et al. (1981)
 pKD4Derivative pANTSγ, containing an FRT-flanked kanamycin resistance (kan); Ap Datsenko and Wanner (2000)
 pKD46Derivative pINT-ts, λ Red recombinase under control of ParaB promoter; Ap Datsenko and Wanner (2000)
Primers
 SGI1circ15′-AGCAAAATCGTGAGAAGGGA-3′This study
 SGI1circ25′-TGATGAGACACCTGACGAGC-3′This study
 EcU7-L125′-ACATCTACAACAGGGCAAAG-3′This study
 Ec104D
 Recint-F
5′-AACCATTTTGAGGTCACACA-3′5′-ACTTAGGCTAGTGTACTATTACGGAGTTGTTG AAGGTGAGGATGGCAAAAGTGTAGGCTGGA GCTGCTTC-3′This study
This study
 Recint-R5′-CAGATTCTTGTACTTTATCTTCAAAAATATCT GGAAAGCCTCTCATTGCTCATATGAATATCC TCCTTAG-3′This study
 Recxis-F5′-AAACCTTGAATGCCTTGAGAAGCGAAATTG CAGAAATGAAGCAATTACTGGTGTAGGCTGG AGCTGCTTC-3′This study
 Recxis-R5′-CTACGGCCGCGAGGAAAACTCGTGATGTAA TTTGTAACGTCTTGGTGAAGCATATGAATATCC TCCTTAG-3′This study
Figure 1.

Model of the site-specific integration and excision of SGI1. SGI1 integrates specifically at the 3′ end of the chromosomal thdF gene (attB). The left and right junctions (DR-L and DR-R) are formed by the recombination between the chromosomal attB site and the SGI1 attP site. SGI1 DNA is represented in black lines. The 18 bp sequences of attB and attP sites are shown (see also Fig. 4). Primers SGI1circ1 and SGI1circ2 used for detection of the circular SGI1 form are indicated by arrows. The left and right junctions PCRs (LJ and RJ) are indicated. Abbreviation for restriction site: X, XbaI.

Figure 2.

Detection of a circular extrachromosomal form of SGI1. PCR products amplified using primers SGI1circ1 and SGI1circ2 (Fig. 1). Lanes: 0, 100 bp ladder; 1, S. Agona strain 959SA97; 2, S. Albany strain 7205.00; 3, S. Agona strain 47SA97; 4, S. Agona strain 47SA97Δint::kan; 5, S. Agona strain 47SA97Δxis::kan.

SGI1 is not self-transmissible but mobilizable

The identification of SGI1 in the chromosome of several S. enterica serovars with identical locations, i.e. at the 3′ end of thdF, and the fact that a number of SGI1 ORFs show similarity to plasmid genes involved in mating pair formation and pilus assembly (Boyd et al., 2001), suggested that SGI1 might be transmissible as other conjugative transposons or ICEs. Conjugation experiments were undertaken to determine whether SGI1 was self-transmissible from a S. enterica serovar to E. coli K-12 or from a S. enterica serovar to another. Several conjugation experiments in broth or on plates were conducted by mating several S. enterica SGI1 donor strains with E. coli K-12 BM14 (Azr) with different donor to recipient ratios. Different experiments were also conducted to transfer SGI1 from SGI1-carrying S. Albany strain 7205.00 to the SGI1-negative enrofloxacin-resistant S. Schwarzengrund strain CGST5 (Table 2). In all assays, no SGI1 transconjugants could be obtained using either E. coli K-12 strain BM14 or S. Schwarzengrund strain CGST5 as recipients (Table 2). These results indicated that SGI1 is not self-transmissible from S. enterica to E. coli or to another SGI1-negative S. enterica strain. These data suggest that SGI1 does not encode all conjugal functions required for its self-transfer in contrast to what is seen for the SXT element (Hochhut and Waldor, 1999; Beaber et al., 2002). Therefore, mobilization of SGI1 in trans was performed by introducing the conjugative IncC plasmid R55 from Klebsiella pneumoniae (Gaffney et al., 1981; Cloeckaert et al., 2001) in the SGI1-carrying S. enterica donor strains, as R55 could provide all conjugal transfer functions to these for successful transfer of SGI1 (Table 1).

Table 2.  SGI1 mobilization by IncC R55 plasmid.
SGI1 donor strainResistance profileConjugative plasmid R55Recipient strainSGI1 transfer frequency
  1. ND, not determined.

S. Typhimurium DT104 BN9181ApCmFfSmSpSuTc E. coli K-12 BM14< 10−9
S. Agona 959SA97ApCmFfSmSpSuTc E. coli K-12 BM14< 10−9
S. Paratyphi B 44ApCmFfSmSpSuTc E. coli K-12 BM14< 10−9
S. Albany 7205.00ApCmFfSuTcTm E. coli K-12 BM14< 10−9
S. Albany 7205.00ApCmFfSuTcTm S. Schwarzengrund CGST5< 10−9
S. Typhimurium DT104 BN9181ApCmFfSmSpSuTc+ E. coli K-12 BM145.1 × 10−5
S. Agona 959SA97ApCmFfSmSpSuTc+ E. coli K-12 BM148.0 × 10−6
S. Paratyphi B 44ApCmFfSmSpSuTc+ E. coli K-12 BM141.5 × 10−5
S. Albany 7205.00ApCmFfSuTcTm+ E. coli K-12 BM147.2 × 10−5
S. Albany 7205.00ApCmFfSuTcTm+ S. Schwarzengrund CGST5+ (ND)

Table 2 shows the results of mobilization experiments between the SGI1-, R55-carrying S. enterica donor strains and the E. coli strain BM14 or S. Schwarzengrund strain CGST5 recipient strains. Transconjugants were obtained in all mobilization assays. E. coli transconjugants showed the antibiotic resistance profile conferred by SGI1 (ApCmFfSmSpSuTc) or SGI1-F (S. Albany donor strain 7205.00) (ApCmFfSuTcTm) and the additionnal resistance to sodium azide. In mobilization using S. Schwarzengrund strain CGST5 as recipient and S. Albany strain 7205.00 as donor, S. Schwarzengrund transconjugants also showed the resistance profile of SGI1-F with the initial resistance to enrofloxacin. The kanamycin resistance phenotype conferred by plasmid R55 was not transferred to the E. coli or S. Schwarzengrund transconjugants. The absence of plasmid R55 in the E. coli transconjugants was also confirmed by a specific PCR described previously (Meunier et al., 2003) (data not shown). These results indicated that plasmid R55 was not transferred into the transconjugants tested. The E. coli transconjugants obtained which did not carry plasmid R55 were also tested for their ability to transfer SGI1 by conjugation to an SGI1-negative S. enterica recipient strain. No S. enterica transconjugants were obtained, strengthening the hypothesis that SGI1 was not self-transmissible.

The SGI1 transfer frequency was calculated for each S. enterica serovar donor strain by dividing the number of transconjugants by the number of donors (Table 2). E. coli transconjugant colonies were found at a frequency from 10−5 to 10−6 depending on the S. enterica serovar donor strain (Table 2).

Analysis of SGI1 in E. coli transconjugants

The presence of SGI1 in E. coli transconjugants was confirmed by antibiotic susceptibility testing, PCR mapping of the SGI1 complex class 1 integron and by Southern blot hybridization as described previously (Boyd et al., 2001; 2002; Meunier et al., 2002; Doublet et al., 2003; 2004a,b).

Escherichia coli transconjugants were tested for their antibiotic susceptibilities (Table 1). Each transconjugant showed an antibiotic resistance profile similar to that of the SGI1-carrying S. enterica donor strain with the additional resistance to Az specific from the recipient E. coli strain BM14. These antibiotic resistance profiles suggested the occurrence of SGI1 in the E. coli transconjugants.

Polymerase chain reaction (PCR) mapping of the SGI1 complex integron was performed on genomic DNA extracted from the E. coli transconjugants. All transconjugants yielded PCR products of the sizes expected from the respective SGI1-carrying S. enterica donor strain (data not shown). Southern blot hybridization of HindIII-digested genomic DNA using the pSTF3 probe containing nearly the entire SGI1 complex integron of S. Typhimurium DT104 (corresponding to the XbaI fragment shown in Fig. 1) confirmed the presence of the SGI1 complex integron in the E. coli transconjugants (Fig. 3). Indeed, identical HindIII Southern blot profiles were obtained for both the S. enterica donor strain and the corresponding E. coli transconjugant (S. Typhimurium DT104 strain 9181 and E. coli strain BM14-9181TC1; S. Agona strain 959SA97 and E. coli strain BM14-959TC1; S. Paratyphi B strain 44 and E. coli strain BM14-44TC1; S. Albany strain 7205.00 and E. coli strain BM14-7205TC1) (Fig. 3A). Besides the hybridization of the SGI1 antibiotic resistance gene cluster presented above, the presence of SGI1 in transconjugants was furthermore assessed by Southern blot hybridization of XbaI-digested genomic DNA using the p1-9 probe corresponding to a 2 kb EcoRI fragment comprising parts of S023 and S024 ORFs (Fig. 1) (Boyd et al., 2001). The p1-9 probe revealed two XbaI fragments of the expected 4 kb and 9 kb sizes in the E. coli transconjugants BM14-9181TC1, BM14-959TC1, BM14-44TC1, BM14-7205TC1 as in the SGI1-carrying S. Typhimurium DT104 strain 9181, S. Agona strain 959SA97, S. Paratyphi strain B 44 and S. Albany strain 7205.00 (Fig. 3B), strengthening the fact that SGI1 was transferred into the E. coli transconjugants by mobilization.

Figure 3.

A. Southern blot hybridization with the pSTF3 probe containing the SGI1 complex integron (see Fig. 1) of HindIII-digested genomic DNAs of S. enterica strains and E. coli transconjugants. Lanes 1–4 correspond to the different donor S. enterica serovar strains and lanes 5–8 to the corresponding E. coli transconjugant strains respectively. Lanes: 1, S. Typhimurium DT104 strain BN9181; 2, S. Agona strain 959SA97; 3, S. Paratyphi B strain 44; 4, S. Albany strain 7205.00; 5, E. coli strain BM14-9181TC1; 6, E. coli strain BM14-959TC1; 7, E. coli strain BM14-44TC1; 8, E. coli strain BM14-7205TC1.
B. Southern blot hybridization with the p1-9 probe (see Fig. 1) of XbaI-digested genomic DNAs of S. enterica strains and E. coli transconjugants. Lanes 1–4 correspond to the different donor S. enterica serovar strains and lanes 5–8 to the corresponding E. coli transconjugant strains respectively. Lanes: 1, S. Typhimurium DT104 strain BN9181; 2, S. Agona strain 959SA97; 3, S. Paratyphi B strain 44; 4, S. Albany strain 7205.00; 5, E. coli strain BM14-9181TC1; 6, E. coli strain BM14-959TC1; 7, E. coli strain BM14-44TC1; 8, E. coli strain BM14-7205TC1.

SGI1 integrates into the Salmonella or E. coli chromosomes site-specifically at the 3′ end of thdF

To assess whether the thdF gene is the integration site for SGI1 in the E. coli chromosome as in the S. enterica chromosome (Boyd et al., 2001; 2002; Meunier et al., 2002; Doublet et al., 2003; 2004a), we examined the SGI1 junctions in the E. coli chromosome for transconjugants BM14-9181-TC1, BM14-959-TC1, BM14-44-TC1 and BM14-7205-TC1. PCRs were performed using primers corresponding to the left and right junctions of SGI1 in the E. coli chromosome (Table 1). In the E. coli chromosome, the thdF gene is not followed by the yidY gene as in S. enterica non-Typhimurium serovars but by the tnaL, tnaA and tnaB genes involved in tryptophan catabolism (GenBank accession numbers NC_000913, NC_003197). In E. coli, the yidY gene is found downstream of the tnaB gene. For the E. coli transconjugants, we thus used a reverse primer for the right junction PCR (Ec104D) that was located within the tnaL gene of the chromosome (Table 1). We also used PCR to detect the presence or absence of the retron sequence which is found downstream of SGI1 in S. Typhimurium DT104 but not in the other SGI1-carrying S. enterica serovars. PCR results were positive for the left junction between the left end of SGI1 (int gene) and the 3′ end of the thdF gene of the E. coli chromosome (data not shown). For the right junction, PCR results were positive between the right end of SGI1 (S044) and the tnaL gene of the E. coli chromosome (data not shown). The retron sequence was not detected in the E. coli transconjugant BM14-9181TC1 using a specific primer of the retron in the right junction PCR (data not shown). PCR products showed the expected sizes of approximately 500 bp for both the left junction and right junction without retron sequence. These data thus indicated that SGI1 integrates into the 3′ end of thdF in the E. coli chromosome as observed in S. enterica. Moreover, these results confirmed that SGI1 and the retron sequence found downstream of SGI1 in S. Typhimurium DT104 are independent and not co-transferred (Boyd et al., 2000).

In previous studies, the left and right junctions of SGI1 (called DR-L and DR-R) in different S. enterica serovars have been sequenced and analysed (Fig. 4) (Boyd et al., 2001; Doublet et al., 2003). The potential chromosomal attachment site (named attB in this study) corresponding to the last 18 bp of the thdF gene of different SGI1-negative S. enterica serovars were also determined. The imperfect 18 bp direct repeats flanking SGI1 appeared thus to be a duplication of the last 18 bp of the thdF gene. DR-R was proposed to correspond to the sequence of the thdF gene from an SGI1-negative strain, and DR-L to that from the SGI1 donor DNA and not the result of a duplication event (Boyd et al., 2001; Doublet et al., 2003). The DNA sequences of the SGI1 chromosomal junction PCR products in the E. coli transconjugants were determined and their DR-L and DR-R repeats are shown in Fig. 4. The sequence of the potential specific recombinational site (named attP in this study) of the extrachromosomal circular form of SGI1 (see above) was also determined (Fig. 4). The SGI1 attP site sequence was slightly divergent from the attB site sequences of the different S. enterica serovars or E. coli (Fig. 4). According to the genome sequence (GenBank accession number NC_003197) the attB site of S. Typhimurium LT2 presents two nucleotide substitutions at positions 9 and 12, whereas the other attB sites of serovars Agona, Paratyphi B, Albany and E. coli showed only one substitution at position 12 (Fig. 4). These results confirm that in all S. enterica serovars and in all E. coli transconjugants, the DR-L and DR-R repeats formed, after chromosomal integration of SGI1, correspond to attP and attB respectively. The new 3′ end of thdF formed by the SGI1attP site does not alter the thdF ORF in E. coli or in the S. enterica serovars.

Figure 4.

Alignment of the attP site of SGI1; attB sites (3′ end of thdF) of SGI1-negative S. Typhimurium strain LT2 (GenBank accession number NC_003197), S. Agona (Boyd et al., 2001), S. Paratyphi B (Doublet et al., 2003), S. Albany (Doublet et al., 2003) and E. coli K-12 (GenBank accession number NC_000913); direct repeats (DR-L and DR-R) flanking SGI1 in S. Typhimurium DT104 strain BN9181 (Boyd et al., 2001), S. Agona strain 959SA97 (Boyd et al., 2001), S. Paratyphi B strain 44 (Doublet et al., 2003), S. Albany strain 7205.00 (Doublet et al., 2003) and E. coli transconjugants from this study. *, DR-L and DR-R sequences of the E. coli transconjugants were always identical independently of the SGI1 donor strain studied. Nucleotides in boldface letters represent substitutions in the attB site and DR-R.

Role of int and xis in transfer of SGI1

SGI1 contains at its 5′ end two ORFs, named int and xis, encoding a putative integrase Int and excisionase Xis respectively (GenBank accession number AF261825) (Boyd et al., 2001). The SGI1 site-specific integration shown by the results above suggests a role of the SGI1-encoded Int in the horizontal transfer. The putative SGI1int gene encodes a 405 amino acid protein showing 29% identity to the integrase of Tn4555 from B. fragilis (GenBank accession number U75371) (Tribble et al., 1997). In the members of the lambdoid integrase family, two well conserved domains in their C-terminal ends are involved in the active sites of these enzymes (Azaro and Landy, 2002). The predicted amino acid sequence of the SGI1 integrase Int contains these domains (Fig. 5). Domain I corresponds to amino acids 229–251, and domain II corresponds to amino acids 328–365 of the SGI1 integrase Int (Fig. 5). SGI1 integrase Int domains contain highly conserved residues in the integrase family, in particular the tyrosine 363 should correspond to the invariant tyrosine of domain II that corresponds to the active nucleophile site (Azaro and Landy, 2002). The excisionase Xis protein from bacteriophage λ is the best characterized member of a large family of recombinational factors that control integrase-mediated DNA recombinations. Int-catalysed recombination is regulated by the bacteriophage-encoded Xis, which both stimulates excision and inhibits integration (Cho et al., 2002; Swalla et al., 2003).

Figure 5.

Alignment of the C-terminal domains I and II amino acid sequences of SGI1 Int to the consensus C-terminal domains of integrase family. Int (SGI1) (GenBank accession number AF261825) (Boyd et al., 2001), Int (Tn4555) (GenBank accession number U75371) (Tribble et al., 1997), Int (λ) (GenBank accession number J02459) (Hoess et al., 1980), Consensus sequence of integrase domains I and II from Poyart-Salmeron et al. (1989). Highly conserved amino acids are indicated by capitals, less conserved amino acids with small letters and ‘x’ represents any amino acid. Gaps introduced for alignment are indicated by (–). (*) indicated identical amino acids and (:) indicated similar amino acids in Int (SGI1) to the consensus. The highly conserved arginine, histidine and tyrosine residues are in boldface letters.

Insertional deletions of an internal part of SGI1 int or xis gene were constructed into a chromosomally integrated SGI1-C in S. Agona strain 47SA97 to test whether Int  or  Xis  are  required  for  excision  and  integration  of SGI1. S. Agona strains 47SA97, 47SA97Δint::kan and 47SA97Δxis::kan were tested for the presence of an extrachromosomal circular SGI1 element using the plasmid extraction method and PCR assay described above. The S. Agona parental strain 47SA97 and S. Agona strain 47SA97Δxis::kan yielded a PCR product of the expected size (Fig. 2, lanes 3 and 5), indicating that an extrachromosomal circular form of SGI1 occurs in these strains. No PCR product for the circular form of SGI1 was obtained in repeated attempts for S. Agona strain 47SA97Δint::kan (Fig. 2, lane 4). Thus, these results indicate that the SGI1 integrase Int is required for SGI1 excision from the chromosome and/or circularization as previously described for the SXT element integrase (Hochhut and Waldor, 1999). However, the presence of the SGI1 excisionase Xis appears not necessary for excision and circularization of the integrated SGI1.

Mobilization experiments were undertaken to determine whether the int and xis SGI1 mutants were mobilizable from S. Agona to E. coli K-12. Table 3 shows the results of conjugation experiments between the SGI1-C, R55 carrying S. Agona donor strains 47SA97, 47SA97Δint::kan and 47SA97Δxis::kan, and the E. coli recipient strain BM14. E. coli transconjugants were obtained using the SGI1-C, R55 carrying S. Agona parental strain 47SA97 as donor at a transfer frequency of 2.5 × 10−6 similar to other S. enterica serovars (Tables 2 and 3). However, no transconjugants were obtained using the SGI1-C, R55 carrying S. Agona strain 47SA97Δint::kan as donor (Table 3). The SGI1-C, R55 carrying S. Agona donor strain 47SA97Δxis::kan was still able to transfer SGI1-C at a frequency of 3.1 × 10−7 (Table 3). These results indicate that the SGI1 transfer requires the SGI1 integrase Int. The SGI1 integrase Int thus probably generates the extrachromosomal circular form of SGI1 which represents an intermediate required for the transfer process itself. However, the putative SGI1 Xis protein is not essential for the SGI1 excision, circularization and transfer.

Table 3.  Role of SGI1 integrase and excisionase in SGI1 conjugal transfer.
S. Agona SGI1 donor strainResistance profileIntegraseExcisionaseConjugative plasmid R55Recipient strainSGI1 transfer frequency
47SA97SmSpSu++ E. coli BM14< 10−9
47SA97SmSpSu+++ E. coli BM142.5 × 10−6
47SA97Δint::kanKmSmSpSu++ E. coli BM14< 10−9
47SA97Δxis::kanKmSmSpSu++ E. coli BM143.1 × 10−7

Discussion

Salmonella genomic island 1 (SGI1) is a genomic island containing an antibiotic resistance gene cluster identified in several S. enterica serovars (Boyd et al., 2000; 2001; 2002; Meunier et al., 2002; Doublet et al., 2003; 2004a,b,c; Ebner et al., 2004; Mulvey et al., 2004). Its identification in these S. enterica serovars, including the epidemic S. Typhimurium DT104, from different animal species and from humans around the world indicates a large diffusion of this genomic island and led to the hypothesis of the SGI1 horizontal transfer potential. The identical chromosomal location of SGI1 in the S. enterica serovars studied, suggested that SGI1 integrates into the chromosome via a site-specific integration at the 3′ end of the thdF gene (Boyd et al., 2001; Meunier et al., 2002; Doublet et al., 2003; 2004a,b). In this study, SGI1 was found to transfer by conjugative mobilization, using conjugative plasmid R55 (Gaffney et al., 1981; Cloeckaert et al., 2001), from a donor (S. enterica) to a recipient strain (E. coli or S. enterica). After conjugal transfer, SGI1 was also found integrated in the recipient chromosome at the 3′ end of the thdF gene. Various elements, including phages, plasmids and pathogenicity islands have been described to integrate site-specifically at the 3′ end of genes such as tRNA genes (Osborn and Boltner, 2002). Attempts to identify a putative origin of replication (ori) in SGI1 were not successful (Boyd et al., 2001). Thus, SGI1 can be considered as a non-replicative element which needs to integrate into the chromosome to be maintained in the host strain.

The excision and integration events of SGI1 seem to be closely related to the site-specific recombination found in lambdoid phages (Osborn and Boltner, 2002). The extrachromosomal circular intermediate of SGI1 detected by PCR most probably occurred after recombination between DR-L and DR-R during excision of the chromosome. The excision and circularization of SGI1 require a functional SGI1-encoded integrase by the int gene which presents similarity to the λ integrase family. For the SXT element of V. cholerae, and similar to lambdoid phages, the SXT int gene must be expressed both in donor, for excision, and in recipient, for integration, for a successful conjugal transfer of the SXT element (Hochhut and Waldor, 1999). We found here that a functional SGI1 int gene is required in the donor strain for excision and/or circularization. Hochhut and Waldor found that for the conjugal transfer of the SXTΔint element, the int gene must be provided in trans both in donor and recipient. The requirement for the SGI1 integrase Int could possibly be similar for the transfer of SGI1 where int is deleted.

The SGI1-encoded excisionase Xis appears not essential for excision, circularization and conjugal transfer of SGI1. However, the transfer frequency of an SGI1Δxis::kan strain was found approximately one log lower compared to the isogenic strain with a functional excisionase. The excisionase Xis from bacteriophage λ is now the best characterized member of the large family of recombinational factors that control integrase-mediated recombination (Azaro and Landy, 2002). During excision, λ Xis helps λ Int to bind DNA that facilitates formation of the excisive nucleoprotein complex (Cho et al., 2002). Thus, the excisionase stimulates excision from the host chromosome (Swalla et al., 2003). This influence of the excisionase is in accordance with a lower SGI1 transfer frequency of an SGI1Δxis::kan strain compared to that of the parental strain. The precise excision of the large pathogenicity island, SPI7 has been recently described in S. enterica serovar Typhi (Bueno et al., 2004). SPI7 which is integrated in a tRNA gene (pheU), is bounded by 52 bp direct repeats and contains an integrase gene adjacent to an att site as SGI1. The frequency of SPI7 excision has been determined to be about 5 × 10−8 per cell during the growth of S. Typhi (Bueno et al., 2004). This frequency of precise excision appeared to be among the lowest reported for such pathogenicity islands (Bueno et al., 2004). For the SXT transfer, Burrus and Waldor determined that while SXT excision is required for SXT transfer, the number of excised circular SXT molecules does not ordinarily appear to be a major factor limiting SXT transfer (Burrus and Waldor, 2003). Five percent of cells grown contained the excised circular SXT element, yet the frequency  of  SXT  transfer  from  these  cells  was  less  than 10−5 per cell (Burrus and Waldor, 2003). According to the SGI1 transfer frequency of 10−5−10−6 per donor, the frequency of SGI1 excision is probably higher than its transfer frequency. However, the SGI1 excision frequency remains to be determined. Studies are underway to examine the SGI1 excision, integration and regulation of these different steps in the SGI1 transfer.

The precise excision of SGI1 by recombination formed a circular intermediate with an SGI1 attP site which is identical to the DR-L of the SGI1-integrated element. Our results indicate that the SGI1 integration into the chromosome occurs by recombination between the SGI1 attP site and the thdF attB site. When SGI1 integration takes place at the attB site, the last 18 bp of thdF gene (attB site) are found at the 3′ end of SGI1 and form the DR-R. In both E. coli and S. enterica recipients the 18 bp of the SGI1 attP site were found to replace the 18 bp of the thdF attB site and thus created a new 3′ end of the chromosomal thdF gene coding for an identical C-terminal amino acid sequence of the ThdF protein. Homology searches in databases show that the thdF gene appears highly conserved in some bacteria of the family Enterobacteriaceae such as S. enterica, E. coli, Shigella spp. as well as its 18 bp end. According to these data, there are some bacterial species that could be a potential host of SGI1. However, the range of sequences which could potentially be considered as attB sites of SGI1 remains to be experimentally determined. The SXT element found in epidemic multidrug-resistant V. cholerae shares very similar properties of excision and integration. The SXT element inserts into the chromosomal prfC gene of V. cholerae and E. coli (Hochhut and Waldor, 1999). The SXT element integrates at an attB site of 17 bp sequence corresponding to amino acids 18–23 of the PrfC product. The SXT element provides a new 5′ end to prfC with a predicted N-terminal novel amino acid terminus (Hochhut and Waldor, 1999). Unlike SGI1 integration, the 17 bp attP site sequence of the SXT element circular form is identical to the attB sequence site in V. cholerae but differs at four nucleotide positions from the attB of E. coli. Moreover, after SXT element integration into the E. coli chromosome, variant left-junction attL and right-junction attR sites may be formed (Hochhut and Waldor, 1999). The IncJ element R391 derived from a South African Providencia rettgeri is genetically and functionally related to the SXT element (Hochhut et al., 2001a). The R391 element and SXT elements integrate at the identical attB site within the 5′ end of prfC and may form tandem arrays in the chromosome (Hochhut et al., 2001a).

Unsuccessful conjugation experiments suggested that SGI1 was not self-transmissible. However, SGI1 was successfully transferred to recipient S. enterica and E. coli strains when conjugal functions were provided in trans by the conjugative IncC plasmid R55 (Gaffney et al., 1981; Cloeckaert et al., 2001). Complete sequence analysis of SGI1 revealed ORFs whose putative products show similarity to conjugation and mobilization proteins encoded by the IncHI1 plasmid R27 from S. Typhi (Sherburne et al., 2000). Thus, these gene products appear not sufficient to allow the conjugal SGI1 transfer but could possibly contribute to it. However, this hypothesis needs to be experimentally assessed.

The properties of SGI1, i.e. its large size, its antibiotic resistance gene cluster, its conjugative mobilization and its site-specific integration shown in this study, are very similar to those of the SXT element found in epidemic multidrug-resistant V. cholerae in Asia (Hochhut and Waldor,  1999;  Hochhut  et al.,  2001b;  Beaber  et al.,  2002). The mobile Staphylococcus aureus pathogenicity island bovine 2 (SaPIbov2) shares also several properties with SGI1 (Ubeda et al., 2003). SaPIbov2 is bounded by 18 bp direct repeats and contains the sip gene, which encodes a functional integrase protein (Ubeda et al., 2003). SaPIbov2 is integrated into the chromosome at the 3′ end of a gene encoding GMP synthase. SaPIbov2 can be excised to form a circular element and can integrate site-specifically at a chromosomal att site in a Sip-dependent manner (Ubeda et al., 2003). However, the SaPIbov2 transfer mechanism remains unknown (Ubeda et al., 2003).

The SXT element also called constin has been classified as an ICE (Burrus et al., 2002a). SGI1 appears to move from the chromosome by recombination mechanisms similar to those of ICEs. However, in contrast to ICEs the conjugal transfer of SGI1 appears to require an helper plasmid providing the mating apparatus. Therefore, we have designated SGI1 as an integrative mobilizable element (IME) related to the term of ICE as previously proposed by Burrus et al. (Burrus et al., 2002b). Other IMEs reported such as non-replicating Bacteroides units (NBUs) were also found to be transferred by mobilization and integrated site-specifically into the chromosome (Burrus et al., 2002b). The NBUs are small elements of approximately 10–12 kb in length (Churchward, 2002). The well studied NBU1 integrates into a gene encoding the LeutRNA in the Bacteroides chromosome, but at numerous sites in the E. coli chromosome (Shoemaker et al., 1996a,b). IMEs have also been described in Gram-positive clostridia as clostridial mobilizable transposons (Adams et al., 2002). This family of mobilizable transposons including Tn4451 and Tn4453 from Clostridium perfringens and Clostridium difficile, respectively, are capable of being mobilized in the presence of another conjugative element as we observed for mobilization of SGI1. However, a GA dinucleotide is present at both ends of the clostridial transposon and in the target sites (Adams et al., 2002). Excision and integration are mediated by the transposon-encoded resolvase TnpX (Lyras et al., 2004). Clostridial mobilizable transposons move from one site in the genome to another by the TnpX resolvase-mediated site-specific recombination mechanism that involves the formation of a circular intermediate (Adams et al., 2002). This transposon circular form harbours one copy of the duplicated GA dinucleotide at the joint (Adams et al., 2002). Compared to the SGI1 integrase, the large resolvase TnpX is a member of the resolvase/invertase family of serine site-specific recombinases which bind to the ends of the element and to the joint of the circular intermediate and to its target sites (Adams et al., 2002; 2004).

In summary, we have shown that the SGI1 excision from the Salmonella chromosome is mediated by the SGI1-encoded integrase. Thus, an extrachromosomal circular intermediate of SGI1 is formed by specific recombination between the 18 bp direct repeats flanking SGI1. This circular intermediate could be conjugally transferred in the presence of a helper plasmid providing the mating apparatus. Chromosomal integration of SGI1 occurred in a site-specific recombination between the attP site (the 18 bp repeat sequence found on the circular form of SGI1) and the attB site in the chromosomal thdF gene (18 bp repeat sequence at its 3′ end). As demonstrated in this study, the mobility of SGI1 by conjugative mobilization probably contributes to the spread of antibiotic resistance genes between different S. enterica serovars and this new mobile element could possibly spread in the future in other bacterial pathogens harbouring a conserved thdF gene.

Experimental procedures

Bacteria, media, plasmids and antibiotic susceptibility testing

The Salmonella strains harbouring SGI1 used in conjugation experiments are listed in Table 1. S. Schwarzengrund strain CGST5 and E. coli K-12 strain BM14 strains were used as recipient strains. All strains were grown at 37°C in brain heart infusion broth or agar plates. IncC conjugative plasmid R55 from K. pneumoniae was used as a helper plasmid for mobilization experiments. IncC plasmid R55 has been previously described to be self-transmissible (Tra+) and to confer resistance to Ap, Cm, Ff, kanamycin (Km), gentamicin (Gm) and Su (Gaffney et al., 1981; Cloeckaert et al., 2001; Meunier et al., 2003). Donor, recipient and transconjugant strains were screened for antibiotic resistance by the disc diffusion method on Mueller-Hinton agar plates (Members of the SFM Antibiogram Committee, 2003). Susceptibility was tested by using disk containing the following antibiotics: Ap (10 µg), Cm (30 µg), Ff (30 µg), Km (30 IU), Gm (15 µg), Sm (10 IU), Sp (100 µg), Su (200 µg), Tc (30 IU) and trimethoprim (Tm) (5 µg). All antibiotic discs except Ff were purchased from Bio-Rad (Marnes-la-Coquette, France). Ff disks were obtained from Schering-Plough Animal Health (Segré, France).

SGI1 bacterial conjugations

Conjugation experiments were carried out in brain heart infusion broth. The Salmonella donor strain and the recipient strain (Salmonella or E. coli) were mixed together with a donor-to-recipient ratio of approximately 4:1. This broth was incubated overnight at 37°C without shaking. The next day, the cells were streaked on appropriate selective brain heart infusion agar plates. The E. coli K-12 recipient strain BM14 was resistant to sodium azide (Az), and the S. Schwarzengrund recipient strain CGST5 was resistant to enrofloxacin. Sodium azide (500 µg ml−1) or enrofloxacin (20 µg ml−1) were used to select against Salmonella donor cells, and Sm (50 µg ml−1) and Tc (10 µg ml−1) to select against unmated recipient cells. The SGI1 frequency of transfer was determined by dividing the number of SGI1 transconjugants by the number of Salmonella SGI1 donor cells. Before mobilization experiments, plasmid R55 was introduced in Salmonella SGI1 donors by conjugation with E. coli strain BM14 carrying R55 as described above, using Km (50 µg ml−1), Sm (50 µg ml−1) and Tc (10 µg ml−1) to select Salmonella transconjugants.

PCR detection of the circular extrachromosomal form of SGI1

Primers SGI1circ1 and primer SGI1circ2 oriented towards the left and right chromosomal SGI1 junctions, were used for detection of a circular extrachromosomal form of SGI1 (Fig. 1, Table 1). A first PCR assay was performed using these primers and S. enterica plasmid DNA extracted by the QIAGEN plasmid mini kit (Qiagen, Courtaboeuf, France) as template DNA. PCRs were carried out using 2.5 units of Taq DNA polymerase in PCR buffer B (Promega, Marne-la-Coquette, France) containing 1.5 mM MgCl2, 0.2 mM dNTPs, 0.8 µM concentrations of primers. PCR cycling conditions were 94°C for 5 min followed by 35 cycles of 94°C for 30 s, 62°C for 1 min, 72°C for 30 s and a final extension at 72°C for 7 min. To detect whether an extremely low frequency of excision had occurred, a second round of PCR amplification was carried out using the same primers and the very weak purified PCR product of the expected size of 364 bp from the first PCR assay. At this step, a visibly detectable PCR product was obtained. This PCR fragment was sequenced to determine the SGI1 sequence through which specific recombination occurred.

PCR mapping, sequencing and Southern blot hybridization

Detection of SGI1 and its location were performed using primers corresponding to the left and right (with or without retron) junctions in the Salmonella or E. coli chromosome as described previously (Fig. 1) (Boyd et al., 2002; Doublet et al., 2003; 2004b). Primer EcU7-L12 located in the E. coli thdF gene and primer Ec104D in the E. coli tnaL gene, found downstream of thdF in the E. coli chromosome (GenBank accession number NC_000913), were used to assess SGI1 junctions in the E. coli chromosome (Table 1). PCR products corresponding to the left and right junctions in the E. coli chromosome of approximately 500 bp were sequenced. Nucleotide sequencing was achieved by Genome Express (Meylan, France). PCR mapping of the typical antibiotic resistance gene cluster (Fig. 1) associated with SGI1 was performed using conditions and primers described previously (Doublet et al., 2003; 2004b).

The antibiotic resistance gene organization was also assessed by Southern blot of genomic DNA cut by HindIII (Qbiogene, Illkrich, France) using as a probe the XbaI fragment of recombinant plasmid pSTF3, comprising nearly the entire S. Typhimurium DT104 SGI1 antibiotic resistance gene cluster (Fig. 1). The presence of entire SGI1 was also assessed by Southern blot of genomic DNA cut by XbaI (Qbiogene, Illkrich, France) by using probe p1-9 as previously described (Boyd et al., 2001; 2002; Doublet et al., 2003; 2004a,b). This probe corresponds to a 2 kb EcoRI fragment comprising parts of S023 and S024 ORFs, which encode putative helicase and exonuclease proteins (Boyd et al., 2001).

Construction of SGI1 int and xis mutations by insertion mutagenesis

Deletions of an internal part of int or xis gene were performed into a chromosomally integrated SGI1 in S. Agona 47SA97 by use of the one-step chromosomal gene inactivation technique (Datsenko and Wanner, 2000). Briefly, the kanamycin resistance gene kan flanked by FRT (FLP recognition target) sites was amplified by standard PCR using the template plasmid pKD4 and hybrid primers. These primers, Recint-F, Recint-R, Recxis-F and Recxis-R (Table 1), were synthesized with 20 nucleotides of priming sites of pKD4 and with 50 nucleotides from each side of the deleted region. The 1.6 kb long PCR fragment was purified and electroporated into the S. Agona strain 47SA97 in which the λ Red recombinase expression plasmid pKD46 was introduced. Homologous recombination between the genomic DNA and the PCR product resulted in the deletion of an internal part of the gene and in its replacement with the kan gene.

Acknowledgements

We thank C. Mouline for expert technical assistance. We also thank C.H. Chiu, H. Imberechts, R. Lailler and C. Mammina for providing human and animal Salmonella isolates of this study. This work was supported by a grant from the French Institut National de la Recherche Agronomique (INRA, Action Transversalité 2001–2003).

Ancillary