Modulating factors for the Pkn4 kinase cascade in regulating 6-phosphofructokinase in Myxococcus xanthus

Authors

  • Hirofumi Nariya,

    1. Department of Biochemistry, Robert Wood Johnson Medical School, Piscataway, NJ 08854, USA.
    Search for more papers by this author
  • Sumiko Inouye

    Corresponding author
    1. Department of Biochemistry, Robert Wood Johnson Medical School, Piscataway, NJ 08854, USA.
      E-mail inouyesu@umdnj.edu; Tel. (+1) 732 235 4161; Fax (+1) 732 235 4559.
    Search for more papers by this author

E-mail inouyesu@umdnj.edu; Tel. (+1) 732 235 4161; Fax (+1) 732 235 4559.

Summary

Myxococcus xanthus, a Gram-negative developmental bacterium, contains a large number of protein Ser/Thr kinases (PSTKs). Among these PSTKs, Pkn4 has been shown to be 6-phosphofructokinase (PFK) kinase. PFK associates with the regulatory domain of Pkn4 (Pkn4RD) and is activated by Pkn4-mediated phosphorylation. The activation of PFK is required to consume glycogen accumulated during early development and is essential for efficient sporulation. Using the yeast two-hybrid screen, we identified three new factors, MkapA, MkapB and MkapC, that interact with Pkn4 and each contains well-known protein–protein interaction domains. MkapB contains eight tandem repeats of the TPR (tetratrico peptide repeat) domain and its interaction with Pkn4RD was phosphorylation-dependent. MkapB remained associated with Pkn4RD. As a result, Pkn4 did not interact with PFK and its activation was inhibited. While deletion of the pfk-pkn4 operon did not inhibit fruiting body formation, the spore yield was low. In contrast, a mkapB deletion mutant exhibited a 24 h delay in fruiting body formation, accumulated less glycogen in the stationary phase and gave rise to 3.2% spore formation as opposed to 100% attained with DZF1. In addition to Pkn4, MkapA associated with other membrane-associated PSTKs, Pkn1, Pkn2, Pkn8 and Pkn9, while MkapB associated with Pkn8 and Pkn9, and MkapC with Pkn8. These results indicate that there are complex PSTK networks in M. xanthus that share common modulating factors.

Introduction

Myxococcus xanthus is a Gram-negative soil bacterium that exhibits a communal lifestyle during vegetative growth and multicellular development. Upon nutritional starvation, M. xanthus cells begin to migrate cooperatively towards aggregation centres by gliding on the solid surface, forming a multicellular fruiting body which holds 105 cells. About 10% of the starved cells within fruiting bodies can differentiate to myxospores, which are dormant and resistant to various environmental stresses. The developmental process is achieved by a series of sophisticated intercellular signalling pathways that regulate the expression of a specific set of genes (reviewed by Dworkin, 1996). For this purpose, M. xanthus has developed numerous signal transduction pathways involving a receptor-type histidine (His) kinase (HK) and eukaryotic serine/threonine (Ser/Thr) kinase.

In bacteria, the two-component signal transduction system is predominant. This involves a receptor-type HK that is autophosphorylated at a His residue upon signal binding and the phosphoryl group is subsequently transferred to an aspartic acid (Asp) residue in a response regulator. This phosphorylation induces a conformational change in the regulatory domain (RD) of the response regulator resulting in the activation of the effector domain. The activated effector domain, equipped with a DNA-binding motif, regulates gene expression in response to environmental signals (reviewed by Stock et al., 2000). In M. xanthus, HKs that are essential in development have been investigated: asgA (Plamann et al., 1995), asgD (Cho and Zusman, 1999a), espA (Cho and Zusman, 1999b), sdeK (Pollack and Singer, 2001), and mrpA (Sun and Shi, 2001). SdeK probably monitors the accumulation of (p)ppGpp, whereas AsgA and AsgD appear to be involved in both environmental sensing and intercellular signalling. mrpA and its cognate response regulator gene, mrpB, are required for the synthesis of an essential transcription factor, MrpC. MrpC is a transcriptional activator of the fruA gene, which encodes an essential response regulator for fruiting body development (Ueki and Inouye, 2003).

On the other hand, in eukaryotes, protein Ser/Thr kinase (PSTK) and Tyr kinase (PTK) are known to play a major role in signal transduction pathways that modulate cellular responses and adaptations to various environmental conditions. Upon ligand binding, PSTK and PTK are phosphorylated, activated and recruit a variety of proteins to form signalling complexes in a specific signalling pathway. These signalling complexes are assembled by protein–protein interactions via protein interacting domains that function in phosphorylation-dependent manner (reviewed by Hunter, 2000). Recent advances in the sequencing of whole prokaryotic genomes revealed that PSTKs exist in a wide variety organisms such as the pathogenic bacteria Mycobacterium tuberculosis and Mycobacterium leprae, and the developmental bacteria, M. xanthus, Streptomyces sp. and Synechocyctis sp. However, only a few studies have demonstrated their functional roles at a molecular level. In the case of Streptomyces coelicolor A3(2), AfsK has been shown to phosphorylate AfsR, a transcription activator for afsS involved in secondary metabolism (Lee et al., 2002). AfsR is also phosphorylated by other AfsK-like protein, PkaG and AfsL, suggesting that the regulatory networks involving PSTKs are diverse and versatile in S. coelicolor A3(2) (Sawai et al., 2004). The crystal structure of the catalytic domain (CD) of PknB from M. tuberculosis showed remarkable conservation with the PSTK superfamily in eukaryotes (Ortiz-Lombardia et al., 2003). Furthermore it has been suggested that PknB and its phosphatase, PstP, may function as a pair in vivo to control mycobacterial cell growth (Boitel et al., 2003). However, protein substrates of PknB have yet to be identified.

The genomic analysis (http://tigrblast.tigr.org) revealed that M. xanthus contains at least 99 PSTKs, many of which have a hydrophobic sequence between the kinase CD and the RD, suggesting that they may function as a receptor-type kinase. Among 99 PSTKs, Pkn1 (Munoz-Dorado et al., 1991), Pkn2 (Udo et al., 1995), Pkn5 and Pkn6 (Zhang et al., 1996), Pkn9 (Hanlon et al., 1997), Pkn4 (Nariya and Inouye, 2002; 2003) and MasK (Thomasson et al., 2002) have been characterized for their roles in the M. xanthus life cycle. Pkn1, Pkn2, Pkn6, Pkn9 and MasK possess a hydrophobic sequence, and Pkn2, Pkn6 and Pkn9 were shown to be transmembrane kinases. Pkn4 is the membrane-embedded 6-phosphofructokinase (PFK) kinase exposed both CD and RD in the cytoplasm. Pkn4 activates PFK by phosphorylation at Thr-226 during fruiting body development and sporulation. The activation of PFK by Pkn4 is required for glycogen consumption and for effective myxospore formation (Nariya and Inouye, 2002; 2003).

In order to elucidate factor(s) involved in the regulatory mechanism of PFK activation by Pkn4 during vegetative growth and fruiting body development, a yeast two-hybrid screen was performed using Pkn4 as bait and the M. xanthus genomic library. Three factors, MkapA, MkapB and MkapC, containing well-characterized protein–protein interaction domains, were found to associate with Pkn4. Among these factors, MkapB associated with Pkn4 in a phosphorylation-dependent manner and this association inhibited PFK activation by interfering with its interaction with Pkn4. These results indicate that MkapB functions as a modulator for PFK activation by affecting glycogen metabolism. Furthermore, using membrane-associated PSTKs, Pkn1, Pkn2, Pkn8 and Pkn9, as bait, MkapB was also found to associate with Pkn8 and Pkn9. MkapA associated with all PSTKs tested while MkapC associated with only Pkn8 in addition to Pkn4. As deletion of mkapB showed a significant delay in fruiting body formation, these multi-kinase associated proteins (Mkaps) may play important roles in modulating signal transduction through membrane-associated PSTKs in M. xanthus.

Results

Identification of Pkn4-associating factors

We reported earlier that Pkn4 activates PFK by phosphorylation to control glycogen metabolism for effective sporulation during fruiting body development (Nariya and Inouye, 2003). Interestingly, while the expression levels of PFK and of Pkn4 remain similar in vegetative growth as well as in the stationary phase, the glycogen content in the cell is drastically increased in the stationary phase. This suggests that there may exist a modulating factor(s) for Pkn4 activity. In the present work, we applied a yeast two-hybrid screen using Pkn4 (Fig. 1A) as bait to identify this putative factor(s). Three Pkn4-associating factors were identified. The functional roles of these factors have not been previously described. Thus we designated them multi-kinase associated protein: (MkapA, MkapB and MkapC) (Table 1 and Fig. 1B).

Figure 1.

Schematic diagram of the membrane PSTKs and the kinase-associated proteins.
A. Schematic diagram of the membrane PSTKs, Pkn1, 2, 4, 8 and 9 used as bait for yeast two-hybrid screen. The kinase catalytic domain (Hanks et al., 1988) is shown by a grey box and a putative hydrophobic stretch is shown by a solid bar. The Ala, Ser and Gly (ASG)-rich region in Pkn2, the Pro, Ala, Thr and Gly (PATG)-rich region in Pkn4 and the kinesin light chain (KLC)-like region in Pkn8 are represented by a box with letters. The kinase catalytic domain (CD) and regulatory domain (RD) of Pkn4 are indicated by arrows with domain names.
B. The kinase-associated proteins, MkapA, B, C, K9ap1 and Pkn14 identified by yeast two-hybrid screen. A C2H2-type Zn-finger motif in MkapA is shown by a shaded box. Eight tandem repeats of the TPR domain in MkapB and three tandem repeats of the FN3-like domain in MkapC are represented by grey boxes with a number respectively. The FHA domain in K9ap1 and the CD in Pkn14 are indicated by grey boxes with domain names respectively. Numbers on the top of bars are positions of residues.

Table 1.  The positive clones identified by yeast two-hybrid screen using the membrane PSTKs as bait from Myxococcus xanthus genomic library.
TargetaBait
Pkn1mPkn2Pkn4Pkn8Pkn9
  • a

    . Non-duplicated clones were not listed.

  • b

    . Not detected.

  • c

    . See Discussion.

  • d

    . Total number of positive clones.

MkapA2052 6 214
MkapBb 8 3 9
MkapC 321
Pkn1421
K9ap1 5
K8ap1c 7
K8ap2c 7
K8ap3c10
Totald2572287848

MkapA consists of 151 residues with a C2H2-type Zn-finger-like  motif,  CX3CX9HX3H,  and  a  blast search  did not reveal homology with any other proteins (http://www.ncbi.nlm.nih.gov). In eukaryotes, many Zn-finger proteins including the C2H2-type Zn-finger have been shown to associate with PSTKs and PTKs by yeast two-hybrid screens (Wolf and Rohrschneider, 1999). Thus, the Zn-finger-like motif of MkapA most probably functions as the association domain for Pkn4. MkapB consists of 271 residues containing eight tandem repeats of the tetratrico peptide repeat (TPR) domain, which is also known to be a protein–protein interaction domain (Das et al., 1998). MkapC is a large protein consisting of 1167 residues with three tandem repeats of fibronectin type 3 (FN3)-like domain from residues 252–507 which is satisfactory for association with Pkn4 based on the DNA sequences. The N-terminal region from the FN3-like domain has no homology to any other proteins and the C-terminal region has a weak similarity to heparinase II from Flavobacterium heparinus (Su et al., 1996). MkapA, B and C are likely to be cytoplasmic proteins because they contain neither a putative hydrophobic sequence nor a signal peptide [as predicted by the tmhmm and signalp programs (http://www.cbs.dtu.dk)].

Pkn4 domain(s) for association with Mkaps A, B and C

To determine the domain(s) in Pkn4 that associate with MkapA, B or C in the yeast two-hybrid screen, the Pkn4-kinase catalytic domain (Pkn4CD) and the Pkn4-regulatory domain (Pkn4RD) shown in Fig. 1A were cloned in pGBD-NdeI and used as bait. Yeast strain PJ69-4A harbouring both bait and prey plasmids was grown to mid-log phase and subjected to a spot test as described by Ohta and Newton (2003). As shown in Fig. 2A, the cells containing Pkn4 with MkapA or B or C formed colonies within 2 days while the cells harbouring Pkn4RD formed colonies only with MkapB and C but not with MkapA which associated with Pkn4CD. After 7 days of incubation (Fig. 2B), the cells containing Pkn4RD and MkapA did form colonies, indicating that their association was not strong. No difference of growth was observed for all combinations in SD-WL medium (data not shown).

Figure 2.

Interactions between Pkn4, Pkn4CD and Pkn4RD with Mkaps by yeast two-hybrid screen. PJ69-4A containing both bait (Pkn4, Pkn4CD and Pkn4RD) and prey (Mkaps) or empty prey (pGAD-NdeI) plasmids were grown to mid-log phase in SD-WL medium. The cells were washed and resuspended in SD-WLAde medium to be 1.0 at OD600. Two microlitres of the serially diluted 10-fold suspensions were spotted onto in SD-WLAde plate and incubated for 2 (A) and 7 (B) days.

To quantify these interactions, β-galactosidase activity was assayed as shown in Table 2. MkapA associated with Pkn4 and Pkn4CD with high efficiently exhibiting β-galactosidase activities of 30.5 and 31.8 U respectively. On the other hand, the association of MkapB and MkapC with either Pkn4 or Pkn4RD were similar and at lesser efficiency (approximately 10 U). MkapA association with Pkn4RD was the weakest (2.1 U). All other combination displayed the same β-galactosidase activity as that of the empty prey plasmid. The results from the β-galactosidase assays correlated well with the growth profiles of the serially diluted spots (Fig. 2). Thus, these results indicate that Pkn4 associates with MkapB and MkapC through the RD domain, whereas Pkn4 associates with MkapA through the CD domain.

Table 2.  Interaction of Mkaps with Pkn4, Pkn4CD and Pkn4RD measured by β-galactocidase activity in yeast two-hybrid screen.
PreyBait
Pkn4Pkn4CDPkn4RD
  1. β-Galactocidase assay was performed by the method described by Miller (1972) on the same cultures used in Fig. 2 and three independent cultures of each strain.

MkapA30.531.8 2.1
MkapB11.8 0.313.6
MkapC 8.5 0.211.9
Empty 0.2 0.2 0.2

Although we previously showed that Pkn4 and Pkn4RD co-precipitated with PFK using anti-PFK IgG (Nariya and Inouye, 2002), PFK was not detected using Pkn4 as bait (Table 1). Therefore, the association of Pkn4 with PFK was also examined using Pkn4, Pkn4CD and Pkn4RD as bait. PFK was able to associate with Pkn4RD, but not with the entire Pkn4 protein (data not shown), indicating that the in vivo association between Pkn4 and PFK is subtle in the presence of ATP as described later.

Phosphorylation of MkapB by Pkn4 inhibits PFK phosphorylation

To investigate the possible roles of the Mkaps in the Pkn4-PFK cascade, we first examined the effect of MkapB on PFK phosphorylation by Pkn4. MkapB was purified as described in Experimental procedures and was found to form a dimer on the basis of gel filtration analysis (data not shown). The phosphorylations of PFK and MkapB by Pkn4 were performed as described previously (Nariya and Inouye, 2002). When PFK (1 µg) and MkapB (1 µg) were separately added to the phosphorylation mixture containing Pkn4 (0.1 µg) and incubated for 30 min in P-buffer [50 mM Tris-HCl (pH 8.0), 10 mM MgCl2, 2 mM DTT] with 200 µM ATP and 1.2 µCi of [γ-32P]-ATP, PFK and MkapB were each phosphorylated as shown in lanes 1 and 2 in Fig. 3A respectively. Interestingly, as shown in lane 3, when both PFK and MkapB were added to the same reaction mixture, MkapB phosphorylation was observed at the same level as in the case of MkapB alone (lane 2), whereas PFK phosphorylation was decreased to 20%. To further examine the effect of MkapB on PFK phosphorylation, PFK (1 µg) was added to the mixture after MkapB (1 µg) was pre-incubated with Pkn4 (0.1 µg) for 5 (lane 4) and 30 (lane 5) min. The reaction mixtures were incubated for another 30 min. As shown in lanes 4 and 5, PFK phosphorylation by Pkn4 was completely abolished under these conditions. MkapB did not affect Pkn4 autophosphorylation, however. As interaction between PFK and MkapB was not detected in the yeast two-hybrid screen (data not shown), MkapB-mediated inhibition of PFK phosphorylation did not result from its binding to PFK. Instead, as both MkapB and PFK can associate with Pkn4RD (Fig. 2), these results suggested that Pkn4 association with MkapB, even after its phosphorylation, inhibited subsequent association between Pkn4 and PFK. On the other hand, the reverse inhibition was not observed. Pre-incubation with Pkn4 and PFK did not inhibit MkapB phosphorylation by Pkn4. Both PFK and MkapB were phosphorylated under these conditions (lane 6).

Figure 3.

Phosphorylation of MkapB by Pkn4.
A. Effects of MkapB on PFK phosphorylation by Pkn4. The phosphorylation of PFK (lane 1), MkapB (lane 2) and PFK with MkapB (lane 3) by Pkn4 were performed as described previously (Nariya and Inouye, 2002). After MkapB was pre-incubated with Pkn4 for 5 min (lane 4) and 30 min (lane 5), PFK was added to the mixture and the reaction mixtures were incubated a further 30 min. MkapB was added and incubated for 30 min after PFK was pre-incubated with Pkn4 for 30 min (lane 6). After reactions, samples were separated on a 12% SDS-PAGE and transferred to PVDF membrane and subjected to autoradiography. The bold letter plus (+) indicates a protein added later.
B. Phospho-amino acids analysis of MkapB phosphorylated by Pkn4. The band of phosphorylated MkapB in lane 2 of (A) was excised from the PVDF membrane and subjected to phospho-amino acid analysis as described previously (Munoz-Dorado et al., 1991). The acid hydrolysate was separated on a cellulose plate by electrophoresis. Lane 1: phospho-Ser, Thr and Tyr stained with ninhydrin as a standard; lane 2: autoradiography of the acid hydrolysate. Pi and Ori indicate free inorganic phosphate and the application origin of samples respectively.

Phosphorylation-dependent association of MkapB with Pkn4

To further elucidate the MkapB inhibition on PFK phosphorylation, the associations of MkapB and PFK with Pkn4 were examined by immunoprecipitation analysis using anti-Pkn4RD IgG as described previously (Nariya and Inouye, 2002). Pkn4 or Pkn4RD were incubated with MkapB in the presence or absence of ATP, and immunoprecipitates were than analysed by SDS-PAGE. As shown in Fig. 4A, MkapB co-precipitated with Pkn4 in the presence of ATP (lane 2), but not in its absence (lane 3). The MkapB band in lane 2 was broad and its position was slightly up-shifted compared with that of purified MkapB (lane 1) probably due to phosphorylation by Pkn4.

Figure 4.

The association of MkapB and PFK with Pkn4.
A. Phosphorylation-dependent binding of MkapB to Pkn4. The phosphorylation reaction was performed as described previously (Nariya and Inouye, 2002). MkapB (2.5 µg) was incubated with Pkn4 (250 ng) or Pkn4RD (125 ng) at 30°C for 60 min in 30 µl of P-buffer in the presence (+) or absence (–) of 200 µM ATP. Lane 1: 500 ng of each protein was applied as a standard.
B. Binding of MkapB to autophosphorylated Pkn4. Autophosphorylated Pkn4 (Pkn4-P) was incubated with MkapB in P-buffer without ATP (lane 1) and with ATP (lane 2).
C. Inhibition of PFK binding to Pkn4 by MkapB. After MkapB and Pkn4 were incubated for 30 min, PFK (1 µg) was added to the incubation mixture and incubated for a further 60 min. The complexes were precipitated with anti-Pkn4RD IgG. The precipitates were analysed on a 12% SDS-PAGE and stained with Coomassie brilliant blue (Bio-Rad).
HC indicates a heavy chain of the antibody. The bold letter plus (+) indicates the later addition of ATP (B) or MkapB (C) to the mixtures.

To clarify whether phosphorylation of MkapB is required for its association with Pkn4, Pkn4 was first autophosphorylated in P-buffer with ATP. The buffer was then changed to P-buffer without ATP using BIOMAX-10K (Millipore). MkapB was added to phosphorylated Pkn4 (Pkn4-P) and immunoprecipitation was performed. As shown in lane 1 of Fig. 4B, MkapB was not detected. On the other hand, MkapB did co-immunoprecipitate with Pkn4 when ATP was added to the mixture at a final concentration of 200 µM (lane 2). These results indicate that autophosphorylation of Pkn4 is not sufficient, and that phosphorylation of MkapB by Pkn4 is absolutely required for their association. Although the interaction of MkapB and Pkn4RD was observed in the yeast two-hybrid screen (Fig. 2 and Table 2), MkapB did not co-immunoprecipitate with Pkn4RD in the presence or absence of ATP (lanes 4 and 5 in Fig. 4A). It is possible that MkapB might be phosphorylated by a PSTK in yeast cells resulting in the interaction of phosphorylated MkapB with Pkn4RD.

To elucidate how MkapB interferes with PFK phosphorylation by Pkn4, the associations of PFK and MkapB with Pkn4 were examined in the presence or absence of ATP. As shown in Fig. 4C, when PFK (1 µg) was added to P-buffer containing Pkn4 (250 ng) without ATP, they formed a complex as detected by immunoprecipitation using anti-Pkn4RD IgG (lane 2) as reported previously (Nariya and Inouye, 2002). On the other hand, the amount of PFK bound to Pkn4 decreased in the presence of ATP (lane 1), indicating that once phosphorylated, PFK dissociated from Pkn4. To examine the effect of MkapB on PFK and Pkn4 association, MkapB (2.5 µg) and Pkn4 (250 ng) were pre-incubated for 30 min with or without ATP and then PFK was added to the mixture. After further incubation for 60 min, Pkn4 complexes were immunoprecipitated by anti-Pkn4RD IgG. Surprisingly, only MkapB was detected with Pkn4 in the presence of ATP (lane 3), while only PFK was detected with Pkn4 without ATP (lane 4). These results indicate that PFK is not able to associate with Pkn4 in the presence of phosphorylated MkapB. Therefore, the inhibition by MkapB on PFK phosphorylation results from the binding of phosphorylated MkapB to Pkn4 that interferes with Pkn4 binding to PFK.

The phospho-amino acids of MkapB that are phosphorylated by Pkn4 were analysed as described in Experimental procedures. The band corresponding to MkapB in lane 2 in Fig. 3A was excised from the PVDF membrane and analysed to determine the phospho-amino acids. As shown in Fig. 3B, MkapB was found to be phosphorylated at a Thr residue by Pkn4.

mkapB gene expression during M. xanthus life cycle

As expression of the pfk-pkn4 operon was previously reported to be constant throughout vegetative growth and development (Nariya and Inouye, 2003), it was important to similarly examine mkapB expression. To determine a transcriptional initiation site(s) used during vegetative growth and development, primer extension analysis was carried out using total RNAs extracted from the mid-log (ML) and the early stationary (ES) phase cells during vegetative growth (Fig. 5C), and 12 and 24 h developmental cells of DZF1 as shown in Fig. 5A. The transcriptional initiation site was G for both vegetative growth and development (Fig. 5B). To characterize the pattern of mkapB gene expression, an mkapB–lacZ fusion was constructed with the mkapB promoter region from −331 to +202 with respect to the transcriptional initiation site fused to the lacZ gene as reporter (Fig. 5B). The mkapBP–lacZ/DZF1 strain was obtained by integrating the pmkapBP–lacZ into the original location of the DZF1 chromosome. β-Galactosidase activity of mkapBP–lacZ/DZF1 was low until the late-log (LL) phase in vegetative growth and then was greatly increased at the stationary phase (Fig. 5D). When the ES phase cells were spotted on TM agar plates as described in Experimental procedures, β-galactosidase activity remained at almost the same level until 6 h and then steadily decreased until 24 h as development progressed.

Figure 5.

The expression of the mkapB gene.
A. Primer extension analysis. The primer extension analysis was performed with total RNAs extracted from DZF1 cells at the ML (lane 1) and ES (lane 2) phases (C) in vegetative growth and at 12 h (lane 3) and 24 h (lane 4) of development using MkapB-AS as a primer. The sequence ladder was created using the same primer on pMkapB as template.
B. The mkapB promoter region. The transcription initiation site is indicated by +1 with a bold letter. A putative translation initiation site is shown by bold letters. The sequences corresponding to primers used for PCR and the primer extension are underlined with arrows and names.
C. Growth curves of DZF1 and DmkapB in CYE medium at 30°C. 100 Klett unit corresponds to 5 × 108 cells ml−1 in CYE medium. The cells were harvested at the early log (EL, 12 h), mid-log (ML, 16.5 h), late-log (LL, 24 h), early stationary (ES, 36 h), mid-stationary (MS, 48 h) and late-stationary (LS, 60 h) phases during vegetative growth. Open and closed circles represent the DZF1 and DmkapB strains respectively.
D. lacZ fusion analysis. The promoter region from −331 to +202 of the mkapB gene shown in (B) was fused to lacZ. The development process was initiated by spotting the ES cells and the developmental cells were collected at 0, 6, 12, 18 and 24 h as described by Nariya and Inouye (2003). β-Galactosidase activity was measured during vegetative growth (closed circle) and development (open circle) at indicated time points.

In contrast to the expression of the pfk-pkn4 operon, mkapB expression was upregulated when cells entered the ES phase and stayed at a high level until 12 h of development. Therefore, it appears that MkapB that is expressed in the ES phase is likely phosphorylated by Pkn4 thereby inhibiting PFK activation by interfering its association with Pkn4. This then results in glycogen accumulation at the ES phase (Nariya and Inouye, 2003).

Effect of MkapB on glycogen metabolism

Previously, we demonstrated that glycogen accumulates at the stationary phase and that the accumulated glycogen is consumed for effective myxospore formation during development. The deletion of pfk-pkn4 strain (ΔPFKN) caused a higher accumulation of glycogen at the ES phase relative to DZF1 and the accumulated glycogen was not utilized during development resulting in low spore yield (Nariya and Inouye, 2003). To elucidate the effect of MkapB on glycogen metabolism, an mkapB deletion strain, ΔmkapB, was constructed by replacing the 0.7 kb SacI–BstBI fragment of the mkapB gene with the 1.3 kb kanamycin-resistant gene (Fig. 6A). ΔmkapB grew normally up to the LL phase similar to DZF1 in CYE medium (Fig. 5C), but then entered into the stationary phase earlier than DZF1 and did not reach maximum growth. The ΔmkapB cells began to lyse 12 h earlier than DZF1.

Figure 6.

Restriction map of the 2.6 kb NruI–BsaI fragment in pMkapB, glycogen levels and developmental phenotypes of DZF1, ΔPFKN and ΔmkapB.
A. Location of the mkapB gene and the region replaced with the kanamycin-resistant gene, and their transcripional orientations are indicated by arrows and the names mkapB and Kmr respectively.
B. Glycogen levels in vegetative growth and at 48 h of development. The glycogen was isolated from 1010 cells of DZF1 (open box), ΔPFKN (grey box) and ΔmkapB (filled box) at indicated time points by the method described previously (Nariya and Inouye, 2003). One unit (U) is defined as the amount of glycogen that produced an absorption of 1.0 at 510 nm as iodine complex.
C. The ES phase cells of DZF1 and ΔmkapB were spotted onto TM agar plates and incubated at 30°C.

To elucidate the effect of MkapB on glycogen metabolism during vegetative growth and at 48 h of development, the levels of glycogen were measured for ΔmkapB, ΔPFKN and DZF1. As shown in Fig. 6B, the glycogen amounts of the three strains were similarly low at the ML and LL phases. At the ES and MS phases, the glycogen levels were greatly increased in both DZF1 (0.63 unit) and ΔPFKN (1.23 unit). On the other hand, the levels in ΔmkapB were about 24% and 36% of DZF1 at the ES and MS phases respectively. After 48 h of development initiated by spotting the ES phase cells on TM agar plates, the glycogen amounts were 0.12, 1.23 and 0.14 units in DZF1, ΔPFKN and ΔmkapB respectively. The accumulated glycogen in DZF1 and ΔmkapB were consumed during early development, but the level of glycogen of ΔPFKN stayed unchanged as reported previously (Nariya and Inouye, 2003). Therefore, the Pkn4-mediated activation of PFK that is required for glycolysis was inhibited by MkapB whose expression was upregulated in the ES phase and glycogen thus accumulated. On the other hand, in ΔmkapB glycogen accumulation was less than in DZF1 at the ES phase because MkapB was not present to inhibit PFK activation of PFK by Pkn4 and thus glycolysis proceeded.

It was demonstrated previously that the glycogen accumulated at the ES phase in DZF1 was almost consumed at 30 h during development leading to a high spore yield, whereas no glycogen consumption was observed in ΔPFKN resulting in a low spore yield (Nariya and Inouye, 2003). The spore yields of DZF1, ΔPFKN and ΔmkapB at 48 h of development were 7.1%, 0.12% and 0.23% of the initial cell numbers used for development respectively. The spore yield of ΔmkapB was 3.2% compared with that of DZF1 (100%), and was double that of ΔPFKN (1.7%). Therefore, these results strongly support the previous conclusion that the consumption of the accumulated glycogen in early development is essential for effective spore formation.

Effect of MkapB on fruiting body formation

Given that MkapB also associates with Pkn8 and Pkn9 (Table 1), the role of mkapB in fruiting body formation was investigated. As shown in Fig. 6C, ΔmkapB showed a 24 h delay in fruiting body formation compared with DZF1 on TM agar plates spotted with the ES phase cells, whereas ΔPFKN did not show any delay in fruiting body formation (Nariya and Inouye, 2003). ΔmkapB did not exhibit any defective phenotype in either A or S motilities (data not shown). MkapB seems to have pleiotropic effects on fruiting body formation and sporulation through interacting with Pkn8 and Pkn9, and probably with other PSTKs.

Association of MkapA and MkapC with Pkn4

As shown in Fig. 2, MkapA and MkapC were found to associate with Pkn4CD and Pkn4RD by the yeast two-hybrid screen respectively. In order to demonstrate their interaction, we performed pull-down analysis using haemagglutinin epitope (HA)-tagged MkapA (HA-MkapA) and the FN3 region in MkapC (HA-FN3) as described in Experimental procedures. Histidine-tagged Pkn4CD or Pkn4RD was added to the soluble fractions of E. coli expressing HA-MkapA or HA-FN3. The complexes formed were then isolated using Ni-NTA resin and analysed by Western blot using anti-HA IgG (Sigma). As shown in Fig. 7A, MkapA formed a complex with Pkn4CD (lanes 1 and 3), but not with Pkn4RD (lanes 2 and 4). While a weak association of MkapA with Pkn4RD was detected by the yeast two-hybrid screen (Fig. 2 and Table 2), their association may not be strong enough to detect by pull-down analysis. On the other hand, the FN3 region in MkapC formed a complex with Pkn4RD as shown in Fig. 7B (lanes 2 and 4). As MkapA was found to associate with Pkn1m, a kinase-defective mutant, the interaction of MkapA with Pkn4CD may not be dependent on phosphorylation. These results were consistent with those obtained by the yeast two-hybrid screen.

Figure 7.

Interaction of MkapA and MkapC with Pkn4. The complexes of HA-MkapA (A) and HA-FN3 (B) with Pkn4CD or Pkn4RD were pulled-down by the addition of Ni-NTA resin as described in Experimental procedures. The protein eluted from the resin were analysed on a 10% SDS-PAGE and visualized by Coomassie brilliant blue (lanes 1 and 2) and by Western blot using anti-HA IgG (lanes 3 and 4).

Association of MkapA, B and C with Pkn1, Pkn2, Pkn8 and Pkn9

In order to examine whether the association with MkapA, B and C was unique to Pkn4, we carried out a yeast two-hybrid screen of the M. xanthus genomic library with four other membrane-associated PSTKs, Pkn1, Pkn2, Pkn8 and Pkn9, as bait (Fig. 1A). Interestingly, all PSTKs tested were found to associate with MkapA, while Pkn8 and Pkn9 associated with MkapB, and Pkn8 with MkapC (Table 1). Pkn8 contains two hydrophobic sequences probably functioning as a transmembrane segment in between CD and RD. Therefore, Pkn8 seems to expose both domains in the cytoplasm. Based on the analysis using the Prosite database (http://hits.isb-sib.ch/cgi-bin/PFSCAN), the RD of Pkn8 shows similarity with the kinesin light chain (KLC) and is predicted to contain five tandem repeats of TPR. The TPR domain is known to interact with TPR domains in other proteins (D’Andrea and Regan, 2003), thus the Pkn8RD and MkapB association was examined using the yeast two-hybrid screen. Pkn8RD was found to interact with MkapB (data not shown). Furthermore, Pkn8 was found to interact with Pkn14, a new member of the PSTK family that seems to be a cytoplasmic as it does not contain the predicted hydrophobic sequence in the RD (Fig. 1B).

Pkn9 was also found to interact with another interesting protein, termed Pkn9associated protein 1 (K9ap1). Pkn9 is a transmembrane PSTK having a CD at the N-terminus in the cytoplasm and a C-terminal RD in the periplasmic space. Deletion of the pkn9 gene causes severe reduction in development progression resulting in 40% of the spore yield of the parent strain, DZF1 (Hanlon et al., 1997). K9ap1 contains a fork-head associated (FHA) domain (Durocher et al., 2000) at the N-terminal end followed by a putative hydrophobic sequence (Fig. 1B), suggesting that K9ap1 is a transmembrane protein having the N-terminal FHA domain in the cytoplasm and the C-terminal region in the periplasmic space.

Discussion

Cellular signalling requires constant assembly and disassembly of protein complexes depending on the environmental conditions. In Bacillus subtilis, entry into sporulation is tightly controlled by the multicomponent His-Asp phosphorelay system involving multiple histidine kinases, KinA, B, C and D, to Spo0F, Spo0B and finally the response regulator Spo0A (reviewed by Burkholder and Grossman, 2000). When initiation of DNA replication is perturbed, the onset of sporulation is prevented at the first step in the relay by inhibiting the accumulation of phosphorylated KinA through Sda (Burkholder et al., 2001). As Sda binds to the KinA autokinase domain, Sda forms a molecular barricade that prevents interdomain communication between the phosphorylatable His residues and the ATP binding site of KinA (Rowland et al., 2004). On the other hand, in eukaryotes, it is known that PSTKs and PTKs regulate various cellular functions via protein–protein interactions in a phosphorylation-dependent manner (reviewed by Hunter, 2000). Although M. xanthus contains 99 PSTKs, such adaptor/modulator proteins for PSTKs had not yet been identified. To find a factor(s) that binds and modulates PSTK function, we performed yeast two-hybrid screens using membrane-associated PSTKs as bait. When the yeast two-hybrid screen was performed using the M. xanthus genomic library with Pkn4 as bait, three factors, MkapA, MkapB and MkapC, containing well-characterized protein–protein interaction domains were identified. In this study, MkapB was demonstrated to associate with the Pkn4RD upon phosphorylation by Pkn4 and to remain (Figs 2–4). As a result, the activation of PFK was inhibited based on interference with PFK and Pkn4 interaction. Therefore, MkapB functioned as a modulator for glycogen accumulation by suppressing the activation of PFK in a phosphorylation-dependent manner in the stationary phase and in early development, periods with exhibiting mkapB expression. As mkapB expression decreased at the appearance of sonication-resistant myxospores (Fig. 6A), PFK was activated by phosphorylation with Pkn4 and consequently, accumulated glycogen was consumed for effective sporulation (Nariya and Inouye, 2003). This is the first demonstration of a PSTK cascade in prokaryotes, which modulates a specific biological function.

MkapB contains eight tandem repeats of TPR and was found to interact with Pkn8 and Pkn9. The TPR domain exists in a variety of organisms, from bacteria to human, and is involved in various cellular functions (D’Andrea and Regan, 2003). Comparison of TPRs from a variety of proteins reveals eight loosely conserved consensus residues which form the hydrophobic surfaces on two α-helices of TPR (Lamb et al., 1995). Based on the three-dimensional structure of several TPRs determined by NMR and X-ray crystallography (see review by D’Andrea and Regan, 2003), TPR domains are known to interact with TPR proteins and also non-TPR proteins. TPR–TPR interactions are mediated by the hydrophobic surfaces formed by the eight consensus residues. TPR–non-TPR protein interactions are not limited to the consensus residues in the α-helices but can also involve interactions with residues in the turns between two helices of a single TPR and between adjacent TPRs. Although Pkn4, Pkn8 and Pkn9 associated with MkapB, there is no detectable similarity in their RDs. The KLC-like domain of Pkn8RD containing five tandem repeats of TPR associated with MkapB. Therefore, it is most likely that Pkn8 and MkapB interaction is mediated by their TPR domains. On the other hand, the P-rich sequence was found in the Pro, Ala, Thr and Gly (PATG)-rich region (from 384 to 480) of Pkn4 and in the PA-rich region (from 427 to 554) of Pkn9, downstream of their CDs. P-rich motives are known to play critical roles in the assembly and regulation of many signalling complexes by binding SH3 and WW domains (Lu et al., 1999; Zarrinpar et al., 2003). Therefore, P-rich sequences of Pkn4 and Pkn9 may play a role in the interaction with MkapB. Note that Pkn1 and Pkn2 that did not interact with MkapB contain neither a TPR nor a PA-rich region.

The Zn-finger of MkapA consists of CX3CX9HX3H with nine residues in a finger loop. The Zn-fingers function as molecular recognition elements and are extremely common protein domains as perhaps 1% of all mammalian genes encode Zn-finger proteins (Mackay and Crossley, 1998). The typical C2H2, C3H and GATA-like C4 fingers have been known to interact with DNA and RNA in a sequence-specific manner and also to associate with proteins (Mackay and Crossley, 1998). MkapA was found to associate with the CDs of Pkn4 (Figs 2 and 7) and Pkn8 (data not shown) using the yeast two-hybrid screen. As MkapA is a small protein consisting of 151 residues with a Zn-finger, the association of MKapA with the CDs of PSTKs is most probably mediated by its Zn-finger.

On the other hand, MkapC contains three repeats of the FN3-like domain. Repeats of this domain mediate fibronectin polymerization. The FN3-like domain is a ubiquitous one in mammalian proteins that include cell adhesion molecules, cell surface hormone and cytokine receptors, chaperonins, and carbohydrate-binding domains (Harpaz and Chothia, 1994). Although three repeats of FN3-like domain in MkapC were sufficient for the association with Pkn4RD and Pkn8RD (data not shown), the association domains of Pkn4 and Pkn8 remain to be demonstrated. Besides the FN3-like domains, the sequence of the C-terminal region of MkapC has weak similarity to hepalinase II. Therefore, it is tempting to speculate that the hepalinase II-like activity of MkapC may be regulated through its phosphorylation by Pkn4 or Pkn8.

In addition to Mkaps, Pkn9 was found to associate with a putative transmembrane protein, K9ap1, which has an FHA domain at the N-terminal region. This domain has been shown to be a recognition module for phospho-Thr and Tyr motifs and to be involved in numerous processes including intracellular signal transduction, transcription, protein transport, DNA repair and protein degradation in both eukaryotes and prokaryotes (Durocher et al., 2000). Although FHA domains consisting of roughly 75 residues do not exhibit extensive sequence similarity, they do share similar secondary and tertiary structures (Li et al., 2000). Therefore, it is likely that Pkn9 with the phospho-Thr motif may form a heterodimer with K9ap1 via the FHA domain when Pkn9 is activated by ligand binding, and thus function as a modulator or an adapter molecule in the Pkn9 signalling pathway.

Interestingly, Pkn8 was found to associate with a new member of PSTK, Pkn14, that was predicted to be a cytoplasmic PSTK from its sequence (Fig. 1B). As Pkn8 was found to phosphorylate a kinase-deficient mutant of Pkn14 in vitro (data not shown), it is possible that Pkn14 is a substrate of Pkn8 and is the PSTK downstream of Pkn8. This would indicate that Pkn8 and Pkn14 form a kinase cascade in the Pkn8 signalling pathway similar to that of a receptor-type PTK cascade in eukaryotes (see review by Schlessinger, 2000). Beside Pkn14, Pkn8 was also found to associate with three other targets (Table 1). Based on the blast search, K8ap1 was found to be identical to FruD, which is involved in cell division (Akiyama et al., 2003). K8ap2 and K8ap3 were homologous to the Enzyme I component in the phosphotransferase system (PTS) and E. coli KpsF that is required for polysialic acid capsule expression (Cieslewicz and Vimr, 1997) respectively.

Based on the results of this study, we propose that MkapA, B and C probably modulate PSTK functions by forming a network as depicted in Fig. 8. As MkapA associated with the CDs of Pkn4 and Pkn8, MkapA may function as a regulator for the auto-kinase activity of PSTKs or as an adapter molecule for recruiting downstream factors in their signalling pathways. MkapB, consisting of eight tandem repeats of TPR domain, also functions as an adapter molecule for recruiting factors in Pkn8 and Pkn9 signalling pathway. The elucidation of the roles of MkapB in the phosphorylation of Pkn14 and K9ap1 by Pkn8 and Pkn9 and the identification of downstream factors by yeast two-hybrid screens will provide further insights into the complex PSTK networks along with their roles in the M. xanthus life cycle.

Figure 8.

A network of Ser/Thr kinases via multikinase-associated proteins (Mkap) in M. xanthus. Interactions between PSTKs and other proteins identified by the yeast two-hybrid screen are indicated by bars with arrow heads at both ends. MkapB inhibition of PFK phosphorylation by Pkn4 is shown by a T-bar. Phosphorylations characterized in this study are indicated by grey arrows.

Experimental procedures

Myxococcus xanthus libraries for yeast two-hybrid screen

The genomic DNA (200 µg) prepared from M. xanthus DZF1 was partially digested with AciI, HinP1I and MspI, and fragments in length of 0.5–2.5 kb for each digestion were isolated with use of 0.7% agarose gel electrophoresis. The isolated fragments were ligated with pGAD-C1, -C2 and -C3 (James et al., 1996) at the ClaI site and nine ligated mixtures were electroporated into E. coli DH 10B (Gibco-BRL). Transformation efficiency for each mixture was about 1 × 107 colonies per 1 µg of DNA. More than 95% of the transformants were found to contain the M. xanthus genomic DNA fragments (data not shown). Because the genome size of M. xanthus is approximately 9140 kb (http://tigrblast.tigr.org), 1 × 107 colonies from each transformation were harvested. Three cultures with the same vector (e.g. AciI, HinP1I or MspI fragments in pGAD-C1) were pooled together. Plasmids were isolated from the pooled cultures by the method described by Birnboim and Doly (1979) with addition of the polyethlene glycol treatment and the resulting libraries of the three vectors were referred to as pGAD-Mx1, pGAD-Mx2 and pGAD-Mx3.

Constructions of pGBD-PSTKs and its expression in the yeast PJ69-4A strain

The yeast GAL4 fusion vectors, pGAD-NdeI and pGBD-NdeI were constructed because it makes it easy to shuttle the genes used as bait from pET vector in which the pkn1, pkn2, pkn4, pkn9 and pfk genes had been cloned in the NdeI–BamHI or NotI sites. The multicloning sites between EcoRI and BglII of pGAD-C1 and pGBD-C1 were modified to NdeI–ClaI–BamHI–NotI by introducing NdeI-linker listed in Table 4 at the EcoRI and BglII sites of both plasmids. As a result, the NdeI and BamHI or NotI sites of pGAD-NdeI and pGBD-NdeI can be used to construct the fusion genes with GAL4–AD or GAL4–BD. The NdeI–BamHI or NotI fragments of pkn1 (Munoz-Dorado et al., 1991), pkn2 (Udo et al., 1995), pkn9 (Hanlon et al., 1997), and pkn4, pkn4CD, pkn4RD and pfk (Nariya and Inouye, 2002) genes from pET vector were cloned into pGBD-NdeI or pGAD-NdeI resulting in pGBD-Pkn1, -Pkn2, -Pkn9, -Pkn4, -Pkn4CD, -Pkn4RD, -PFK and pGAD-PFK respectively. pGBD-Pkn8, pGAD-MkapA, -MkapB and MkapC were constructed using NdeI–BamHI or NotI fragments amplified by polymerase chain reaction (PCR) using the primers, Pkn8-N and Pkn8-C, MkapA-N and MkapA-C, MkapB-N and MkapB-C, and MkapC-N and MkapC-C, respectively (Table 4), and the chromosomal DNA as a template. All of the PCR-amplified fragments were confirmed by DNA sequence before they were used.

Table 4.  The linker and primers used in study.
PrimerSequence
  1. Bold letters indicate the translational initiation and stop codons. Underlined sequences represent restriction enzyme sites.

NdeI-linkerAATCCATATGATCGATGGATCCGCGGCCGCA
GGTATACTAGCTACCTAGGCGCCGGCGTCTAG
HA-linkerCTAGAGGGTATTAATAATGGGTTACCCATACGACGTCCCAGACTACGCTCA
TCCCATAATTATTACCCAATGGGTATGCTGCAGGGTCTGATGCGAGTAT
Pkn8-NAAACATATGTTCGGAAAGCCGGAACGCGTTGCGGAG
Pkn8-CAAAGGATCCTCATCGTTTCGTCTCAVGCCGTTGCCAGGC
MkapA-NAAACATATGGGCGCCAGCCGTGCTAGGGAGGGGCGATA
MkapA-CAAAGGATCCTCAGTGCTTGAGGTCCTTGTGCCCCGG
MkapB-NAAACATATGGCCCGCGAAAAGGACAACATCGCTCTCTCC
MkapB-CAAAGCGGCCGCTCAGAACAAGGCTTCGAAGTCCGGGTCACCCT
MkapC-NAAACATATGGGGGTATGGGCAGCGGTGCTTGGC
MkapC-CAAAGGATCCTCACGGTCCCCACACCGGCCCGCTTGG
MkapB-P5AAAAAGCTTGACGACGAACAGGTCGGCGGCGTCCGTCA
MkapB-P3AAAGGATCCCTTGAACTCCTTGATGGCCTCGTCGAGCCA
MkapB-5CTCACCGCGCTCGGTGAAGGGGCACTCCAG
MkapB-ASACGAGTGTTGTGCTCGTCGGA
LacZ-3FSGGATCGGCCATTGCAGTGCTCCTCAGTCAGTCA
FN3-NAAACATATGCCGGAGCGTCGGCCGCTCCTCACCATTGAG
FN3-CAAAGGATCCTCACGGGATATCGAGCACCACGGGCGGCCCGTT

Yeast two-hybrid screen for M. xanthus PSTKs

A yeast two-hybrid screen was performed by the method described by James et al. (1996). The yeast strain, PJ69-4A, contains three reporter genes, GAL1–HIS3, GAL2–ADE2 and GAL7–lacZ (Table 3). PJ69-4A harbouring pGBD-PSTK was grown to 5 × 108 cells ml−1 in SD-W medium. Twenty micrograms of each pGAD-Mx1, pGAD-Mx2 and pGAD-Mx3 were transformed into 2.5 × 1010 cells and the cells were plated on SD-WL plates. Approximately 107 transformants were obtained for each set of library. After 2 days, approximately 2.5 × 105 transformants growing on SD-WL per plate were replica-printed on SD-WLAde plates. The primary positive colonies were further screened on SD-WLHis plates. pGAD plasmid containing positive fragments was isolated and the sequences of the fragment were determined by an ABI Genetic Analyzer 310 using the methods provided by a company. As a control experiment, PJ69-4A harbouring pGBD-PSTK was transformed with an empty vector, pGAD-NdeI. No positive colony was detected in these screens. The expressions of GAL4–BD fusion proteins in yeast strain, PJ69-4A were confirmed by immunoblotting analysis using GAL4–BD antibody (Santa Cruz Biotechnology). As PJ69-4A harbouring pGBD-Pkn1 could not form colonies, a kinase-defective mutant, Pkn1m, that had a substitution of N at invariable K-88 in catalytic subdomain II (Hanks et al., 1988) was used as bait. PJ69-4A harbouring pGBD-NdeI and pGBD-bait were cultured in SD-W medium (James et al., 1996) to Klett unit 200. The cells harvested were resuspended in SDS-PAGE sample application buffer to be 10 Klett units µl−1, and with the addition of glass beads (425-600 microns, Sigma) boiled in vigorous vortexes for 3 min. After centrifugation at 10 000 g for 1 min, supernatants were applied onto SDS-PAGE and fusion proteins were detected by immunoblotting analysis as previously described (Nariya and Inouye, 2003).

Table 3.  Plasmids and strains.
Plasmid or strainDescriptionReference or accession number
E. coli strains
 E. coli DH5aRecipient strainHanahan (1983)
 E. coli HB101Strain for rescue pGAD plasmid by leuB6 complementationManiatis et al. (1989)
 E. coli BL21 (DE3)Strain for pET vector expressionStudier et al. (1990)
 E. coli DH10BStrain for construction of M. xanthus library for Y2HGibco-BRL
 E. coli SB221Strain for pINK-HA vector expressionNakamura et al. (1982)
M. xanthus strains
 DZF1sglA1 used as a parent strainMorrison and Zusman (1979)
 Δ FKNpfk-pkn4 deletion strain with KmrNariya and Inouye (2003)
 ΔmkapBmkapB deletion strain with KmrThis study
 mkapBP–lacZ/DZF1lacZ reporter strain under the control of the mkapB promoterThis study
Yeast strain
 PJ69-4AMATa trp1-901 leu2-3, 112 ura3-52 his3-200 gal4Δ gal80Δ LYS2::GAL1–HIS3 GAL2–ADE2 met2::GAL7–lacZJames et al. (1996)
Plasmids
 pUC19Cloning vectorYanisch-Perron et al. (1985)
 pET16b(+)Expression vector under T7 promoterNovagene
 pGBD-C1GAL4–BD fusion expression vector for Y2H with trp1James et al. (1996)
 pGAD-C1∼C3GAL4–AD fusion expression vector for Y2H with leu2James et al. (1996)
 pGBD-NdeIInsertion of NdeI-linker at EcoRI–BglII site in pGBD-C1This study
 pGAD-NdeIInsertion of NdeI-linker at EcoRI–BglII site in pGAD-C1This study
 pUC7Km(P-)1.3 kb HincII fragment containing kanamycin-resistant gene (Kmr) from Tn5 in pUC7Norioka et al. (1995)
 pZKATlacZ transcriptional fusion vectorUeki and Inouye (2003)
 pZKDeletion of 3.0 kb SmaI fragment containing Mx8-attP from pZKATThis study
 pINIII(NdeI)KmIPTG-inducible expression vector with KmrThis study
 pINK-HAN-terminal HA-tagged protein expression vector constructed by insertion of HA-linker at XbaI and NdeI site in pINIII(NdeI)KmThis study
 pGMkapA5439 bp BamHI–EcoRI fragment in pUC19AF377338
 pGMkapB5581 bp EcoRI–SalI fragment in pUC19AF377339
 pGMkapC7642 bp EcoRI–SphI fragment in pUC19AF377340
 pGPkn144304 bp BamHI–SalI fragment in pUC19AF377337
 pGK9ap11578 bp AciI fragment obtained by Y2H using pGBD-Pkn9 as baitAY569568
 pGBD-Pkn1m2.1 kb NdeI–BamHI fragment from pET-Pkn1m in pGBD-NdeIThis study
 pGBD-Pkn41.9 kb NdeI–NotI fragment from pET-Pkn4 in pGBD-NdeIThis study
 pGBD-Pkn4CD1.1 kb NdeI–NotI fragment from pET-Pkn4CD in pGBD-NdeIThis study
 pGBD-Pkn4RD0.8 kb NdeI–NotI fragment from pET-Pkn4RD in pGBD-NdeIThis study
 pGBD-Pkn83.1 kb NdeI–BamHI fragment in pGAD-NdeIThis study
 pGBD-Pkn92.3 kb NdeI–BamHI fragment from pET-Pkn9 in pGBD-NdeIThis study
 pGAD-PFK1.1 kb NdeI–NotI fragment from pET-PFK in pGAD-NdeIThis study
 pGAD-MkapA0.45 kb NdeI–BamHI fragment in pGAD-NdeIThis study
 pGAD-MkapB0.8 kb NdeI–NotI fragment from pET-MkapB in pGAD-NdeIThis study
 pGAD-MkapC3.5 kb NdeI–BamHI fragment in pGAD-NdeIThis study
 pGAD-FN30.9 kb NdeBamHI fragment in pGAD-NdeIThis study
 pMkapB2607 bp NruI–BsaAI fragment from pGMkapB at the SmaIThis study
site of pUC19This study
 pMkapB-KR0.7 kb BstBI–SacI fragment in pMkapB was replaced with KmrThis study
 pmkapBP–lacZ500 bp HindIII–BamHI fragment of the mkapB promoter region in pZKThis study
 pET-MkapB
 
MkapB expression vector containing 0.8 kb NdeI–NotI fragment from pGBD-MkapB in pET16bThis study
 pINK-HA-MkapA0.45 kb NdeI–BamHI fragment from pGAD-MkapA in pINK-HAThis study
 pINK-HA-FN30.9 kb NdeI–BamHI fragment from pGAD-FN3 in pINK-HAThis study

Cloning the genomic DNA fragments containing the mkapA, B, C and pkn14 genes, and their nucleotide sequence accession numbers

The genomic DNA fragments containing mkapA, B, C and pkn14 were isolated from restricted genomic DNA fragments by Southern blot hybridization using the positive clones of yeast two-hybrid screen as probes. The probes were labelled by DIG-Chem-Link labelling and Detection Set following the procedure described in the kit (Boehringer Mannheim). The fragments harbouring mkapA, B, C and pkn14 genes were 5439 bp of BamHI–EcoRI, 5581 bp of EcoRI–SalI, 7642 bp of EcoRI–SphI and 4304 bp of BamHI–SalI fragments respectively. These were cloned into pUC19 resulting in pGMkapA, pGMkapB, pGMkapC and pGPkn14. Their DNA sequences have been determined and submitted to the GenBank DNA sequence database under Accession No. AF377338, AF377339, AF377340 and AF377337 respectively. The DNA sequence of the positive clone containing the k9ap1 gene is also submitted as AY569568.

Construction of a ΔmkapB strain

As shown in Fig. 6A, the 0.7 kb BstBI–SacI region in pMkapB was replaced with the 1.3 kb HincII fragment containing the kamamycin-resistant gene (Kmr) from pUC7Km(P-) (Norioka et al., 1995) in an opposite direction against the mkapB transcription. The resulting plasmid is named pMkapB-KR. pMkapB consists of the 2607 bp NruI–BsaAI fragment from pGMkapB at the SmaI site of pUC19. After digestion with ScaI, pMkapB-KR was introduced into DZF1 by electroporation, and the kanamycin-resistant colonies were screened for double crossing-over by colony hybridization using the pUC19 DNA as a probe and the deletion strains were confirmed by Southern blot analysis as described previously (Nariya and Inouye, 2003). The resulting strain was termed ΔmkapB.

Construction of a mkapBP–lacZ/DZF1 strain

The promoter region of mkapB from −331 to +202 was amplified by PCR using pGMkapB and the primers, MkapB-P5 and MkapB-P3 shown in Fig. 5B and Table 4. The PCR product digested with HindIII and BamHI was cloned into pZK (Table 3) resulting in the lacZ transcriptional fusion plasmid, pmkapBP–lacZ. pmkapBP–lacZ was electroporated into DZF1 and integrated at the original location by a single crossing-over. The recombination site of pmkapBP–lacZ was confirmed by PCR using MkapB-5 located 33 bases upstream of MkapB-P5 in the mkapB promoter region and LacZ-3FSC in pZK as primers (Fig. 5B and Table 4). The mkapBP–lacZ/DZF1 is the lacZ expression strain under the control of the promoter of mkapB in DZF1.

Purification of N-terminal His-tagged MkapB

All column chromatography was performed at 4°C using FPLC system LCC-500 Plus (Amersham Pharmacia Biotech). The columns used are purchased from Amersham Pharmacia Biotech. pET-MkapB, the expression vector of MkapB, was constructed by cloning the 0.8 kb NdeI–NotI fragment from pGBD-MkapB into pET16(+) (Novagene). MkapB was purified from the soluble fraction of E. coli BL21 (DE3) harbouring pET-MkapB by the method described for Pkn4 purification (Nariya and Inouye, 2002). The MkapB fraction eluted with 300 mM imidazole from Ni-NTA SUPER FLOW resin (Qiagen) was loaded on the HiTrap Q column and was eluted at 370 mM NaCl with a linear gradient from 0 to 1.0 M. The MkapB fraction was dialysed against buffer A [50 mM Tris-HCl, (pH 8.0) containing 100 mM NaCl, 2 mM DTT and 1 mM MgCl2] and after dilution to 0.5 mg ml−1 with buffer A, stored at −80°C.

Pull-down analysis

An HA-tagged protein expression vector, pINK-HA, was constructed by inserting the HA-linker (Table 4) between the XbaI and NdeI sites in pINIII(NdeI)Km in which the NdeI site was created at the translation initiate site of pINIIIKm (Ghrayeb et al., 1984). The DNA fragment coding FN3 region from 208 to 516 in Fig. 1B was amplified by PCR using primers FN3-N and FN3-C (Table 4). The PCR fragments digested with NdeI and BamHI and cloned into pGAD-NdeI. The resulting plasmid was named pGAD-FN3. The NdeI–BamHI fragments of pGAD-MkapA and pGAD-FN3 were isolated and cloned into pINK-HA resulting in the plasmids, pINK-HA-MkapA and pINK-HA-FN3 respectively. HA-tagged MkapA (HA-MkapA) and FN3 (HA-FN3) were expressed in E. coli SB221 (Nakamura et al., 1982) by addition of 2 mM IPTG for 4 h. The cells were suspended at 1000 Klett ml−1 in Pull-down buffer [50 mM Na-phosphate (pH 8.0) containing 10% (v/v) glycerol, 100 mM NaCl, 40 mM imidazole and 2 mM 2-mercaptoethanol]. After the cells were disrupted by sonication, the soluble fractions were prepared by centrifugation at 105 000 g for 30 min. After 10 µg of purified His-tagged Pkn4CD or Pkn4RD (Nariya and Inouye, 2002) was added to 1 ml of the soluble fractions, the mixtures were incubated for 2 h at 4°C. Ten microlitres of Ni-NTA SUPER FLOW resin were added to each mixture and incubated for 1 h. The resin containing the complexes was washed three times with 1 ml of Pull-down buffer then boiled in 100 µl of 1× SDS buffer for 1 min. Twenty microlitres and 1 µl of samples were separated on a 10% SDS-PAGE, and visualized by CBB stain and Western blot analysis using anti-HA IgG (Sigma). When the soluble fraction from cells harbouring pINK-HA was treated with Pkn4CD or Pkn4RD, no specific proteins was detected.

Microbial strains, growth conditions and plasmids

Microbial strains and plasmids used in this study are listed in Table 3. M. xanthus strains were cultured in CYE medium (Campos et al., 1978) at 30°C and supplemented with 80 µg ml−1 kanamycin when necessary. Development of M. xanthus cells was induced on TM [10 mM Tris-HCl, (pH 7.6), 8 mM MgSO4] agar plates as described by Nariya and Inouye (2003). E. coli were grown in LB (Miller, 1972) or M9 (Maniatis et al., 1989) medium supplemented with 100 µg ml−1 ampicillin or 40 µg ml−1 kanamycin when necessary.

Other methods

Phosphorylation and immunoprecipitation of Pkn4, PFK and MkapB were performed in P-buffer [50 mM Tris-HCl (pH 8.0), 10 mM MgCl2, 2 mM DTT] with and without 200 µM ATP and 1.2 µCi of [γ-32P]-ATP by the methods described previously (Nariya and Inouye, 2002; 2003). Phosphoamino acid analysis was carried out by the method described by Munoz-Dorado et al. (1991). The primer extension analysis was carried out using MkapB-AS as a primer by the method described previously (Nariya and Inouye, 2003). β-Galactosidase assays were carried out by the methods described by Kroos et al. (1986). The clear lysates were obtained from the cells that were harvested at indicated time points during vegetative growth and development.

Acknowledgements

We are grateful to M. Inouye for discussions and critical reading of this manuscript. We thank M. Inouye, T. Ueki and L. Vales for critical reading of the manuscript. This work was supported by the Foundation of Medicine and Dentistry of New Jersey.

Ancillary