SEARCH

SEARCH BY CITATION

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Growth of Sinorhizobium meliloti under Pi-limiting conditions induced expression of the major H2O2-inducible catalase (HPII) gene (katA) in this organism. This transcription required the PhoB transcriptional regulator and initiated from a promoter that was distinct from the OxyR-dependent promoter which activates katA transcription in response to addition of H2O2. In N2-fixing root nodules, katA was transcribed from the OxyR- and not the PhoB-dependent promoter. This is consistent with the accumulation of reactive oxygen species (ROS) in nodules and also indicates that bacteroids within nodules are not Pi-limited. Pi-limited growth also induced expression of catalase genes in Agrobacterium tumefaciens (HPI) and Pseudomonas aeruginosa (PA4236-HPI) suggesting that this may be a widespread phenomenon. The response is not a general stress response as in both S. meliloti and P. aeruginosa increased transcription is mediated by the phosphate responsive transcriptional activator PhoB. The phenotypic consequences of this response were demonstrated in S. meliloti by the dramatic increase in H2O2 resistance of wild type but not phoB mutant cells upon growth in Pi-limiting media. Our data indicate that in S. meliloti, katA and other genes whose products are involved in protection from oxidative stress are induced upon Pi-limitation. These observations suggest that as part of the response to Pi-limitation, S. meliloti, P. aeruginosa and A. tumefaciens have evolved a capacity to increase their resistance to oxidative stress. Whether this capacity evolved because Pi-starved cells generate more ROS or whether the physiological changes that occur in the cells in response to Pi-starvation render them more sensitive to ROS remains to be established.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Reactive oxygen species (ROS), such as a superoxide anion radical (O2), hydrogen peroxide (H2O2) and hydroxyl radicals (HO), are unavoidably generated as a by-product of normal respiratory processes of all aerobically growing organisms owing to inadequate metabolic reduction of molecular oxygen to water. ROS can damage DNA, lipid membranes and proteins and have been implicated in numerous biological processes. To defend against ROS-induced damage bacteria have evolved sophisticated molecular mechanisms to sense ROS levels and activate increased synthesis of enzymes such as catalase, alkyl hydroperoxide reductase and superoxide dismutase (SOD), and small proteins like thioredoxin and glutaredoxin, and molecules such as glutathione (Steinman et al., 1997; Kim et al., 2000a; Zheng et al., 2001; Chelikani et al., 2004; Harrison et al., 2005). SOD dismutes O2 to H2O2 and H2O, catalase converts H2O2 to oxygen and water (McCord and Fridovich, 1969) and alkyl hydroperoxide reductase converts alkyl hydroperoxides to their corresponding alcohols (Storz and Imlay, 1999). In addition, expression of catalases and other protective proteins elevates under certain growth conditions including entry into the stationary phase of growth (Storz and Imlay, 1999; Mongkolsuk and Helmann, 2002; Imlay, 2003).

The katA gene from Agrobacterium tumefaciens which encodes a bifunctional catalase-peroxidase (HPI) has been shown to be regulated by OxyR (Nakjarung et al., 2003). In Pseudomonas aeruginosa two catalases have been characterized: KatA is the major catalase detected during all growth phases while synthesis of KatB is induced upon exposure to H2O2 and paraquat. Little information exists regarding a third catalase KatE (Ma et al., 1999). In Escherichia coli, katG (HPI) expression is regulated by OxyR while a second catalase gene, katE (HPII), is expressed in the stationary phase (Schellhorn and Hassan, 1988). It is worth noting that OxyR and the other peroxide and organic hydroperoxide sensing transcription factors PerR and OhrR regulate expression of genes involved in a diverse range of activities including haem biosynthesis and metal uptake (Mongkolsuk and Helmann, 2002). In E. coli, OxyR regulates alkylhydroperoxide reductase (Ahp) and this protein has been shown to be the principal scavenger of H2O2 (Seaver and Imlay, 2001).

Rhizobia are a group of bacteria that form nodules on the roots or stems of legume host plants. Within these root nodules the bacteria employ an aerobic metabolism including oxidative phosphorylation to produce ATP and reducing equivalents required for N2 fixation. ROS are generated and play important roles during the infection process, in nodule development and during active N2 fixation (Kwon and An, 1999; Santos et al., 2001; Rubio et al., 2002; Del Carmen Vargas et al., 2003; D’Haeze et al., 2003; Shaw and Long, 2003; Panek and O’Brian, 2004; Dombrecht et al., 2005; Harrison et al., 2005). In the alfalfa symbiont Sinorhizobium meliloti, three haem-containing catalase (hydroperoxidase) enzymes have been characterized. The KatA and KatC proteins are monofunctional catalases (HPII) while KatB is a bifunctional catalase-peroxidase (HPI) which in addition to converting H2O2 to oxygen and water can also use H2O2 to oxidize organic substrates (Ardissone et al., 2004). The katA gene is induced upon exposure to H2O2 and this regulation is mediated by OxyR. Recently, Jamet et al. (2005) presented data which indicated that OxyR regulates the H2O2-induced expression of katA in free-living cells and also the high expression of katA observed in N2-fixing bacteroids. Expression of katC is induced by heat, salt and ethanol stress while katB is constitutively expressed in free-living culture and is not induced under oxidative stress conditions. While S. meliloti katA mutants appear unaffected in N2 fixation, katA katC double mutants were impaired in symbiotic nitrogen fixation (Sigaud et al., 1999). The symbiotic phenotype of katB katC double mutants together with the finding that the katB katC genes appear to be expressed in infection threads led Jamet et al. (2003) to propose that these genes are essential for establishment of the root-nodule symbiosis. Further support for the importance of ROS to this symbiosis stems from the nodulation and impairment in N2 fixation that was observed in sodA mutants of S. meliloti (Santos et al., 2000).

In many bacteria, including S. meliloti, a two-component signal transduction system consisting of a sensor histidine kinase, PhoR, and a response regulator, PhoB, is activated when bacteria are grown in media in which the concentration of phosphate limits cellular growth (Wanner, 1993; Scholten et al., 1995). Under phosphate starvation conditions, PhoR is believed to phosphorylate PhoB converting it into an active transcription factor that induces the expression of a number of genes whose products are involved in a general cellular response to Pi-limitation including phosphorus uptake and metabolism (VanBogelen et al., 1996; Bardin and Finan, 1998; Summers et al., 1998; Antelmann et al., 2000). The promoter regions of PhoB-regulated genes share a highly conserved 18-base pair (bp) sequence (pho box) that is often centred at the −35 region of PhoB-activated promoters (Kimura et al., 1989; Makino et al., 1993). Here we report that the katA gene of S. meliloti is induced upon growth under Pi-limiting conditions and that induction is shown to be PhoB dependent. The PhoB-dependent katA promoter is mapped and shown to be separate and distinct to that regulated by OxyR in response to exposure to H2O2. Moreover, we demonstrate conclusively that the OxyR-dependent katA promoter is utilized in bacteroids in root nodules. The effect of Pi-limitation on catalase expression is shown to extend to other bacterial genera, as expression of catalase genes in P. aeruginosa (katA, i.e. PA4236) and A. tumefaciens (katA, i.e. Atu4642) is demonstrated to be induced upon Pi-limited growth. The physiological consequences of Pi-limited growth are assessed by measuring the sensitivity of cells to H2O2 and we propose that as part of their response to Pi-limitation, S. meliloti and other bacteria have evolved mechanisms of increasing their protection from ROS. Why Pi-starved cells require such protective enzymes is discussed.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

katA expression of Pi-starved S. meliloti cells is regulated by PhoB and not by OxyR

To identify candidate genes whose expression could be regulated by PhoB, the DNA sequence of the S. meliloti genome was scanned for potential 18 bp PhoB binding sites using a programme that employed a frequency weight matrix derived from the previously identified five PhoB binding sites from S. meliloti (two sites from each of the orfA-pit and phoC promoters and a single site from the phnG promoter; Bardin et al., 1996; 1998; P.A. McLean, C.M. Liu, C.C. Sookdeo, F.C. Cannon, unpublished) and nine PhoB binding sites from E. coli (phoA, phoB, phoE, phoH, pstS1, pstS2, ugpB1, ugpB2, ugpB3; Tommassen et al., 1987; Kimura et al., 1989; Torriani, 1990; Kasahara et al., 1991; Kim et al., 1993). Among the potential PhoB binding sites identified, we noted that a sequence upstream of the katA gene generated a high relative similarity score, placing it between the scores for the PhoB binding sites in the phnG and phoC promoters. The genome sequence in the katA gene region (see Fig. 1) showed that the oxyR gene (840117–839185) lay 194 nucleotides upstream of katA (840311–841792) and that these two genes are divergently transcribed (Galibert et al., 2001). OxyR is a known regulator of catalase gene expression in E. coli, A. tumefaciens and S. meliloti.

image

Figure 1. Schematic map of the S. meliloti katA-oxyR gene region. The 1568 bp PCR product containing the S. meliloti katA and oxyR intergenic region was ligated directly into pCR2.1(TA) vector to produce pTH940. The 768 bp PstI fragment from pTH940 was subcloned into pFUS1 gusA reporter vector in two orientations to generate the katA::gusA fusion plasmid pTH1030 and the oxyR::gusA fusion plasmid pTH1031. The internal region of oxyR was subcloned into pUCP30T as a 441 bp NotI–EcoRI fragment to give plasmid pTH1436. The internal region of katA was subcloned into pUCP30T as an 850 bp EcoRI fragment to give plasmid pTH1464. The predicted PhoB-binding motifs (pho box) are shown along with the pho box consensus motif. The numbers indicate the relative distance to the catalase translational start codon.

Download figure to PowerPoint

To investigate whether katA expression responds to media phosphate concentrations, we polymerase chain reaction (PCR)-amplified the DNA region located between katA and oxyR (see Fig. 1) and cloned this fragment into the broad host range reporter vector pFUS1 (Reeve et al., 1999). Plasmids designated pTH1030 and pTH1031 were identified, in which the katA promoter and oxyR promoters, respectively, drive expression of the gusA reporter gene. S. meliloti phoB+, phoB and oxyR mutant strains carrying these plasmids were subcultured into morpholinopropane sulphonic acid (MOPS)-buffered minimal media with 2 mM and 0 mM inorganic phosphate. β-Glucoronidase and alkaline phosphatase activities were determined following incubation of these cultures for 32 h. Alkaline phosphatase activities were measured in these experiments as its synthesis is highly regulated by media phosphate concentration and its expression is dependent on PhoB (Bardin and Finan, 1998). As expected, the measured alkaline phosphates activities confirmed that the phosphate excess or phosphate-deficient status of the cells (data not shown). In the wild-type and oxyR mutant backgrounds, phosphate starvation resulted in at least a fivefold increase in katA::gusA expression compared with cells grown in excess Pi (Fig. 2). This increase in katA::gusA expression observed in the Pi-starved cultures was eliminated in the phoB mutant strain. In contrast, the expression of the oxyR::gusA gene fusion showed similar values in the wild-type and phoB mutant backgrounds (Fig. 2). With the exception of the katA::gusA fusion in the wild-type background, oxyR::gusA- and katA::gusA-directed β-glucoronidase activity in phosphate-starved cells was lower than in cells grown with excess phosphate. This low activity could reflect a reduction in the copy number of the fusion plasmids; however, this aspect was not further investigated. The data clearly demonstrated that PhoB was required for the induction of katA expression that took place in cells starved for Pi whereas OxyR was not involved in this process. Moreover, as oxyR expression did not increase upon Pi-starvation (Fig. 2) it would seem very unlikely that the PhoB-dependent induction of katA transcription was mediated via an increase in oxyR transcription.

image

Figure 2. Pi-starvation-induced expression of katA in S. meliloti requires phoB while H2O2-induced expression of katA in S. meliloti requires oxyR. The S. meliloti katA::gusA fusion plasmid pTH1030 and oxyR::gusA fusion plasmid pTH1031 were individually introduced into S. meliloti strain RmG212 (phoB+oxyR+ indicated as wt) and its derivative strains; RmH615 (RmG212, phoB3::TnV, indicated as phoB); and RmK842 (RmG212, oxyR::Ω, indicated as oxyR), followed by growth in Pi-free MOPS medium, MOPS medium with 2 mM Pi for 32 h, and LB medium without and with challenging with 1 mM H2O2 at OD600 around 0.4. The wild-type RmG212 carrying the reporter vector pFUS1 was used as a control. β-Glucuronidase activities expressed as Miller units and corresponding alkaline phosphatase activities (not shown) were determined as described in Experimental procedures. Each value corresponds to the mean of triplicate assays ± standard error.

Download figure to PowerPoint

H2O2-dependent induction of katA requires oxyR and not phoB

As challenging with sublethal levels of H2O2 is known to induce transcription of catalase in S. meliloti and many microorganisms, it was important to establish whether PhoB played a role in this induction. Moreover, as OxyR was known to be involved in the H2O2-induced transcription of catalase genes in several bacteria including A. tumefaciens, we examined whether expression of oxyR was affected by a phoB mutation (Fig. 2). The results revealed no involvement of phoB in the H2O2-dependent induction of katA transcription as in both the phoB+ and phoB mutant background, katA expression was strongly induced by the addition of 1 mM H2O2. In contrast, the induction of katA expression by 1 mM H2O2 was abolished in the RmG212 oxyR mutant background (Fig. 2). No H2O2-dependent induction of oxyR transcription was observed and further no effect of PhoB on oxyR transcription was detected as the β-glucoronidase activity detected from oxyR::gusA fusion was similar in wild-type and phoB mutant strains (Fig. 2).

Catalase activity is induced in Pi-starved S. meliloti cells

Herouart et al. (1996) showed that S. meliloti contains three catalase enzymes, encoded by katA, katB and katC, that can be separated by non-denaturing polyacryalamide gel electrophoresis (PAGE). To determine whether increased katA transcription also led to increased catalase activity in S. meliloti, cell extracts were prepared from wild-type, katA mutant and phoB mutant strains that were grown under conditions of excess and limiting Pi (Fig. 3). Examination of these extracts by PAGE through staining for catalase activity revealed that the fastest migrating KatA enzyme was clearly induced in Pi-starved wild-type cells. This activity was not detected in either katA or phoB mutant strains. A slight increase in KatC activity was also observed in extracts from Pi-starved cells; however, this response was not phoB dependent and may be part of a general stress response (Fig. 3).

image

Figure 3. Staining of S. meliloti catalase isozymes activities. S. meliloti strains were grown in LBmc overnight, washed and subculture into Pi-excess (P2) or Pi-limiting (P0) medium. Total protein (15 µg) prepared from each sample was resolved on a 7.5% non-denaturing polyacrylamide gel and stained as described in Experimental procedures. Strains examined include RCR2011, indicated as wild type (wt) RmP559 (RCR2011 phoB3::TnV as phoB) and RmP375 (RCR2011 katA::Tn5 as katA).

Download figure to PowerPoint

The katA gene has two promoters: the distal promoter (p1) is dependent on OxyR for transcription and is induced by H2O2; the proximal promoter (p2) is dependent on PhoB and is induced upon Pi-limitation

To identify the katA promoter that responds to phosphate limitation, mRNA from wild-type cells grown with excess and limiting Pi was examined by primer extension analysis. We identified two prominent extension products corresponding to G and C transcriptional start sites 25 and 26 nucleotides upstream of the annotated katA ATG translational start codon (Fig. 4A, lane 1). The PhoB-like binding site CTGTCGTTCAGCCGTCAC that was identified in the original in silico screen was located 23 nucleotides upstream of the C transcriptional start site residue. To identify the katA promoter that responds to H2O2 induction, primer extension reactions were performed on mRNA isolated from wild-type cells that were challenged with H2O2. An extension product was detected 103 nucleotides upstream of the katA ATG translational start codon (Fig. 4A, lanes 4 and 5). The H2O2-responsive and the Pi-starvation-responsive transcriptional start sites were designated p1 and p2 respectively (Fig. 4C). To obtain direct evidence for the interaction of PhoB and the katA promoter, a labelled katA promoter fragment was assessed for the ability to bind PhoB in gel shift assays. As shown in Fig. 4B, PhoB bound specifically to the katA promoter, as the addition of purified PhoB to the katA promoter fragment resulted in a band of reduced mobility and addition of a 10-fold excess of unlabelled promoter fragment resulted in loss of the signal.

image

Figure 4. A. Determination of transcriptional start sites of katA in S. meliloti strain RCR2011 through extension of 32P-labelled primer ML2838. Lane 1, RCR2011 cells grown in MOP minimal medium without phosphate; lane 2, RmP559 cells grown in MOPS minimal medium without phosphate; lane 3, RCR2011 cells grown in MOP minimal medium with 2 mM phosphate; lane 4, RCR2011 cells grown in LB; lane 5, RCR2011 cells grown in LB and induced with H2O2. B. Electrophoretic mobility shift assays of a 182 bp PCR product (primers ML3167 and ML3168) containing katA promoter region. Lane 1, 182 bp 32P-end-labelled PCR probe; lane 2, labelled probe incubated with PhoB protein; lane 3, labelled probe incubated with PhoB protein and competed with 10-fold amount of cold probe. C. Sequence of katA promoter showing various features. Translational start codons from katA and oxyR are indicated in bold capitals, and large bold arrows indicate the location and direction of transcription of katA and oxyR genes; the OxyR DNA binding site motifs are shaded grey (proposed by Jamet et al., 2005); the +1 and the −10 regions are indicated; pho box sequence is boxed; location of various primers used in this experiment is indicated by arrows.

Download figure to PowerPoint

The 77-nucleotide distance that separated the p1 and p2 transcriptional start sites (Fig. 4) suggested that these two promoters may function as distinct entities. Accordingly, we PCR-amplified six fragments that dissected the oxyR-katA intergenic region and cloned these fragments into pTH1582, a derivative of the pJP2 gusA reporter plasmid (Prell et al., 2002) (Fig. 5A). Strains carrying these plasmids were assayed under conditions of Pi-starvation and following addition of H2O2. RCR2011 strains with the plasmid carrying the complete intergenic region (designated 1+2, pTH1881) showed both H2O2 and Pi-starvation induction of β-glucuronidase activity (Fig. 5B and C). In the wild-type background, only H2O2-dependent induction of β-glucuronidase activity was observed with plasmids 1 and 6 that contain the complete p1 promoter region. This induction was also observed in the RCR2011 phoB mutant background with plasmids 1, 1+2 and 6 (pTH1877, pTH1881 and pTH1895 respectively; Fig. 5C). Conversely, in the wild-type background, plasmids 2, 3, 4 and 5 which minimally carry the region from the PhoB box to the katA gene all showed Pi-limited induction of β-glucuronidase activity (Fig. 5B). Moreover, this induction was not observed in the RCR2011 phoB mutant. In addition, strains carrying plasmids 2, 3, 4 and 5 (pTH1878, pTH1879, pTH1880 and pTH1894) showed no H2O2 induction of β-glucuronidase activity. In all cases where Pi-limited induction of β-glucuronidase was observed in the wild type, no induction was detected in the RCR2011 phoB mutant. We note that the magnitude of the response following H2O2 treatment or Pi-starvation from cultures carrying the plasmids 1 and 2, respectively, was similar to that observed in cultures carrying plasmid 1+2 in which both promoters are present. These data demonstrated that the distal promoter (p1) and the proximal promoter (p2) function independently of each other.

image

Figure 5. Dissection of p1 and p2 promoters of S. meliloti katA gene. A. Schematic showing the various katA promoter fragments cloned upstream of gusA in the reporter plasmid pTH1582. Resulting plasmids 1, 2, 1+2, 3, 4, 5 and 6 were named pTH1877, pTH1878, pTH1881, pTH1879, pTH1880, pTH1894 and pTH1895 respectively. B. Effect of media Pi concentration on the expression of gusA from promoters cloned in the gusA reporter plasmid pTH1582 (described in A). C. Effect of addition of H2O2 on the expression of gusA from promoters cloned in the gusA reporter plasmid pTH1582 (described in A). Wild-type S. meliloti refers to RCR2011::ΩSp-Sm and the phoB mutant is RCR2011::phoB3::TnV (RmP559). The S. meliloti strains were grown in LBmc containing tetracycline, washed once with MOPS minimal medium containing no phosphate and then subcultured in LBmc and MOPS minimal media with and without 2 mM inorganic phosphate. MOPS cultures were grown for ∼36 h to an OD600 of 0.3–0.5, and LBmc cultures were grown to an OD600 of 0.5 followed by an induction with 1 mM H2O2 for 6 h. Colorimetric assays were conducted for measuring β-glucuronidase activity using PNPG as substrate. β-Glucuronidase values for S. meliloti carrying the empty pTH1582 vector varied from 54 to 120 Miller units.

Download figure to PowerPoint

To confirm that OxyR was required for the H2O2-dependent induction of the katA p1 promoter, we measured β-glucuronidase activity from the full-length katA promoter, the p1 and the p2 promoter fusion plasmids in an oxyR mutant background. The oxyR::Ω mutant was constructed as described in Experimental procedures. No H2O2 induction of β-glucuronidase activity was obtained from full-length or p1 promoter constructs (Fig. 6A), showing OxyR was required for transcription from the p1 promoter. No role for OxyR in the phosphate-mediated regulation of katA transcription was apparent as the induction of p2 transcription observed in Pi-limited cells was not affected by the oxyR mutation (Fig. 6B).

image

Figure 6. OxyR is required for the H2O2-dependent induction of katA p1 promoter. The stably replicating gusA reporter plasmids carrying the full-length katA promoter (indicated as katA, pTH1881), H2O2-dependent katA promoter (indicated as p1, pTH1877) and the Pi-starvation-induced katA promoter (indicated as p2, pTH1878) were introduced into S. meliloti wild type (RCR2011, indicated as wt) and the oxyR mutant (RCR2011 oxyR::Ω, indicated as oxyR). Strain RCR2011 carrying the modified pJP2 vector was used as a control. A. Promoter activities monitored by measuring the β-glucuronidase activities after 2 h of induction by 1 mM H2O2 (1 mM H2O2, solid box) or no H2O2 treatment (0 mM H2O2, open box) as described in Experimental procedures. β-Glucuronidase activities are expressed as Miller units and each value corresponds to the mean of triplicate assays with standard error. B. Promoter activities monitored by measuring the β-glucuronidase activities after 32 h growth in MOPS minimal medium supplemented with 2 mM Pi (P2, solid box) or no Pi added (P0, open box) as described in Experimental procedures.

Download figure to PowerPoint

Transcription of the S. meliloti katA gene in alfalfa nodules is driven from the p1 promoter and requires oxyR and not the phoB gene

The katA gene is known to be highly expressed in S. meliloti bacteroids in alfalfa root nodules (Sigaud et al., 1999; Jamet et al., 2003; 2005). The identification of the two differentially regulated promoters upstream of katA raises the question as to which promoter is utilized in nodules. To address this question, alfalfa seedlings were inoculated with wild-type strain RCR2011, and its derivatives RmP631 (RCR2011 oxyR::Ω) and RmP375 (RCR2011 phoB3::Tn5) carrying the stably replicating reporter plasmids in which the full-length, the p1 and the p2, katA promoters were cloned upstream of the gusA gene (plasmids: pTH1881, pTH1877 and pTH1878 respectively). Twenty-eight days after inoculation, the nodules were harvested and assayed for β-glucuronidase activity as described in Experimental procedures. High β-glucuronidase activity was detected in nodules formed by the wild-type and phoB mutant strains carrying the full-length and p1 promoter constructs, but activity from these constructs was absent in the oxyR mutant background (Fig. 7). Only background activity was detected in nodules formed from strains carrying the p2 promoter. These data definitively establish that katA expression in bacteroids is driven from the p1 promoter and requires functional OxyR.

image

Figure 7. Expression pattern and regulation of S. meliloti katA promoters in symbiotic bacteroids. The stably replicating GusA reporter plasmids carrying the full-length katA promoter (indicated as katA, pTH1881), H2O2-dependent katA promoter (indicated as p1, pTH1877) and the Pi-starvation-induced katA promoter (indicated as p2, pTH1878) were introduced into S. meliloti wild type (RCR2011, indicated as wt) and its derivatives, oxyR mutant (RCR2011 oxyR::Ω, indicated as oxyR), and phoB mutant (RCR2011 phoB3::TnV, referred as phoB). The wild-type strain RCR2011 carrying the modified pJP2 vector was used as a control. Nodules were harvested 28 days after inoculation with these strains and β-glucuronidase activities were determined as described in Experimental procedures. Each value corresponds to the mean of triplicate assay ± standard errors.

Download figure to PowerPoint

Catalase genes in A. tumefaciens and P. aeruginosa are induced upon growth in Pi-limiting conditions

To investigate whether expression of catalase genes in other organisms is subject to regulation in response to Pi-limitation, using the pho box weight matrix, we first scanned the sequences upstream of these catalase genes for PhoB-like binding sites. A putative PhoB binding site (5′-TAGTCAT CTTC ATGACAG-3′) was detected between the divergently transcribed oxyR (Atu4641) and katA (Atu4642) genes of A. tumefaciens. This site was located between 150 and 133 nucleotides upstream of the katA ATG translational start codon. We note that whereas the S. meliloti katA encodes a hydroperoxidase HPII protein with only catalase activity, the A. tumefaciens katA gene is predicted to encode a hydroperoxidase HPI protein with both catalase and peroxidase activities (Xu et al., 2001; Prapagdee et al., 2004). The region upstream of the A. tumefaciens katA gene was PCR amplified and cloned into the gusA reporter vector pFUS1 to give the plasmid pTH1863. A. tumefaciens C58 strains carrying pFUS1 and pTH1863 were grown in MOPS-buffered minimal media containing 2 mM and 7.5 µM Pi as described in Experimental procedures. β-Glucuronidase assays of these cultures showed that the katA::gusA gene fusion was strongly induced in response to Pi-limitation (Fig. 8A). In A. tumefaciens the phoB gene appears to be essential as phoB mutants could not be constructed (Danhorn et al., 2004). We therefore transferred the A. tumefaciens katA::gusA fusion plasmid into S. meliloti phoB+ and phoB strains and examination of these strains revealed that β-glucuronidase activity was induced in Pi-limiting media in the phoB+ but not the phoB strain (data not shown). In summary, our data showed that in A. tumefaciens katA expression is induced upon growth of A. tumefaciens in Pi-limiting media.

image

Figure 8. Pi-limitation induces katA expression in Agrobacterium tumefaciens and in Pseudomonas aeruginosa. A. A. tumefaciences wild-type strain C58 carrying a plasmid born katA::gusA fusion and the pFUS1 vector control were grown in MOPS minimal medium with 7.5 µM Pi (P7.5µM, open box) or 2 mM Pi (P2mM, solid box) for 24 h at 28°C, followed by the determination of β-glucuronidase activities as described in Experimental procedures. The β-glucuronidase activities are expressed as Miller units and each value corresponds to the mean of triplicate assays with standard error. Parallel alkaline phosphatase assays revealed that cells grown with 7.5 µM Pi had high activity which confirmed the phosphate starvation status of the cells (data not shown). B. Plasmid pTH1860 carrying the P. aeruginosa katA promoter region fused to gusA was introduced into P. aeruginosa wild-type strain PAO1 and its phoB::Km mutant derivative strain PHOB1. Strain PAO1 carrying the empty reporter gusA vector pFUS1 was used as a control. The β-glucuronidase assay was performed after 32 h growth in MOPS minimal medium with no phosphate added (P0, open box) or in a medium supplemented with 2 mM Pi (P2, solid box) as described in Experimental procedures. The β-glucuronidase activities are expressed as Miller units and each value corresponds to the mean of triplicate assays ± standard error. Parallel alkaline phosphatase assays confirmed the phosphate starvation status of the cells (data not shown).

Download figure to PowerPoint

The P. aeruginosa PAO1 katA (PA4236) gene encodes a monofunctional catalase HPII and a PhoB-like binding site (5′-CTGTCATTCATCCTTAAC-3′) was predicted 157 bp upstream of its translational start codon. To examine the influence of Pi availability in expression of this gene, the P. aeruginosa katA promoter region was cloned into the pFUS1 gusA reporter vector as described in Experimental procedures and the resulting plasmid was transferred into wild-type P. aeruginosa PAO1 and its phoB derivative PHOB1 (Kato et al., 1992; 1994; Wu et al., 2000). Growth of these strains under Pi-starvation conditions resulted in a large induction of katA transcription in the wild-type background; however, little or no induction occurred in the phoB mutant background (Fig. 8B). We conclude that the Pi-limited induction of katA transcription in P. aeruginosa was dependent on the phoB gene.

Primer extension analysis revealed that the 5′ end of the P. aeruginosa katA mRNA transcript that responded to Pi-limitation was 131 nucleotides upstream of the katA translation start codon (Fig. 9A and C). The PhoB-like binding site was centred a further 34 nucleotides upstream of this start site and addition of purified S. meliloti PhoB protein to a labelled DNA fragment encompassing this region resulted in a gel shift consistent with PhoB binding to this region (Fig. 9B). Together these data confirm the identification of a PhoB-regulated promoter for the katA gene of P. aeruginosa.

image

Figure 9. A. Determination of transcriptional start sites of katA in P. aeruginosa strain PAO1 through extension of 32P-labelled extension primer. Total RNA for primer extension was isolated from culture grown in MOPS minimal medium without phosphate. We believe that the quadruplet band in the lower part of the primer extension lane is a result of premature termination of the extension reaction. B. Electrophoretic mobility shift assays of the 188 bp PCR product containing the P. aeruginosa strain PAO1 katA promoter region. Lane 1, 188 bp 32P-end-labelled PCR probe; lane 2, labelled probe incubated with PhoB protein; lane 3, labelled probe incubated with PhoB protein and competed with 10-fold amount of cold probe. C. Sequence of katA promoter showing various features. Translational start codon from katA is indicated in bold capitals; the +1 and the −10 regions are indicated; pho box sequence is boxed; location of various primers used in this experiment is indicated by arrows.

Download figure to PowerPoint

Growth of wild-type S. meliloti under Pi-limiting conditions increases survival upon subsequent exposure to H2O2

In view of the induction of katA upon growth under Pi-limiting conditions, we wished to assess the biological effect of Pi-limited growth on the susceptibility of S. meliloti cells to oxidative damage. For these experiments, cells were cultured in MOPS-buffered minimal media with excess (2 mM Pi) and limiting Pi (no added Pi). These cells were then exposed to various concentrations of H2O2 for 2 h and plated on Luria–Bertani (LB) media to determine the per cent survival as described in Experimental procedures. Cells grown with excess Pi showed similar sensitivities to H2O2 whereas Pi-limited cells showed large differences in survival depending on the strain being examined. Wild-type Pi-limited cells were much more resistant to killing by H2O2 than cells pre-grown with excess Pi (Fig. 10A and B). This response required PhoB as Pi-limited phoB mutants cells were highly sensitive to H2O2. This adaptation did not require oxyR as the response of the oxyR mutant and wild-type strain were similar. Interestingly, Pi-starved katA mutant cells behaved similarly to the wild-type at intermediate concentrations of H2O2 (1.5–2.5 mM). While at 5 mM H2O2, the Pi-starved katA mutant cells clearly showed an increased sensitivity to H2O2, their survival was over 100-fold greater than the phoB mutant cells (viable counts for wild type, oxyR, katA and phoB mutants following treatment with 5 mM H2O2 were 2 × 109, 1.5 × 109, 2 × 108 and 4 × 105, respectively, Fig. 10A and data not shown). Interestingly the graphs show that Pi-starved cells of all strains appear generally more resistant to H2O2 than the cells grown with 2 mM Pi. Perhaps this reflects the more rapid growth and metabolic activity of cells grown with 2 mM Pi. This more rapid growth could lead to higher endogenous H2O2 levels compared with Pi-starved cells.

image

Figure 10. Adaptation of Pi-starved S. meliloti cells to H2O2 challenge. The S. meliloti strains were grown in Pi-free MOPS medium (P0, open box) or MOPS medium with 2 mM Pi (P2, solid box) followed by challenge with 2.5 mM or 5 mM H2O2 for 2 h as descried in Experimental procedures. The examined S. meliloti strains are: wild-type RCR2011 (×wt) and its derivatives phoB mutant (RCR2011 phoB3::TnV, ▪phoB), oxyR mutant (RCR2011 oxyRΩ, ◆oxyR) and katA mutant (RCR2011 katA::Tn5, ▴katA). A and B demonstrate the survival percentage of cells pre-grown in P0 medium or P2 medium, respectively, followed by challenge with H2O2. C and D represent the remaining H2O2 level after 2 h challenging with 2.5 mM or 5 mM H2O2 respectively. The 100% survival is represented by cells numbers before H2O2 treatment. Values and data points represent the means of three representative experiments with error bars showing standard deviations.

Download figure to PowerPoint

Quantification of the H2O2 level remained in the above cultures (Fig. 10C and D) revealed high levels of H2O2 in cells grown with 2 mM Pi. In contrast, except for the phoB mutant, Pi-starved cultures showed low levels of H2O2. The phoB mutant cells showed high residual H2O2 which is consistent with its removal by activities such as KatA, whose synthesis is regulated by PhoB.

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

The data in this report establish that the katA genes from S. meliloti, A. tumefaciens and P. aeruginosa are induced upon the growth of these strains under phosphate starvation conditions. In all these strains, katA expression was shown previously to increase in response to oxidative stress (Ma et al., 1999; Xu et al., 2001; Jamet et al., 2003), and except for P. aeruginosa, this induction required the oxyR regulatory gene (Ochsner et al., 2000; Eiamphungporn et al., 2003; Jamet et al., 2005).

In the case of the S. meliloti katA gene, our data clearly demonstrate two promoters, the proximal promoter (p2) regulated by PhoB in response to media Pi concentrations and the distal promoter (p1) regulated by OxyR in response to H2O2 (Figs 4 and 5). The location of the PhoB-like binding sites relative to the transcriptional start sites of the katA genes in S. meliloti and P. aeruginosa is consistent with a general model where under Pi-limiting conditions, activated PhoB binds to the −35 region of these promoters and, as described for E. coli, activates transcription through an interaction with the sigma-70-like subunit of RNA polymerase (Makino et al., 1993). The location of the transcriptional start site for the H2O2-responsive and oxyR-dependent promoter identified in this study (Fig. 4) is the same as that recently reported by Jamet et al. (2005), who also described OxyR-like binding sites upstream of this promoter. Plasmid pTH1894, with promoter fragment 5 (Fig. 5A) fused to β-glucuronidase gene, has the −35 region but lacks the upstream OxyR-like binding sites and therefore is not induced by H2O2 when expressed in S. meliloti (Fig. 5C). Dual transcriptional regulation of phosphate starvation-inducible promoters has previously been reported for the E. coli psiE gene and ugp operon; in both these cases transcription is regulated by PhoB and the cyclic AMP receptor protein. For the psiE gene both regulators act at the same promoter, while the transcriptional start sites for the two promoters transcribing the ugp operon are separated by 48 nucleotides (Kasahara et al., 1991; Kim et al., 2000b).

Our ability to separate the OxyR-dependent from the PhoB-dependent katA promoters allowed us to unambiguously demonstrate that the H2O2-responsive OxyR-dependent promoter is active in N2-fixing root nodules. This result is consistent with reports indicating that bacteroids experience considerable oxidative stress (Jamet et al., 2003; Rubio et al., 2004; Puppo et al., 2005) and our conclusion concurs with that recently reported by Jamet et al. (2005). We note that the absence of transcription from the PhoB-dependent katA promoter in nodules is consistent with other results showing that S. meliloti bacteroids are not Pi-limited (Yuan et al., 2005).

The Pi-starvation-induced KatA proteins from S. meliloti and P. aeruginosa are similar in size (494 and 482 amino acids respectively), and share 58% amino acid identity. Both are considered to be the housekeeping catalases; they are expressed in aerobically grown cultures and are believed to detoxify ROS generated as part of normal oxidative metabolism (Herouart et al., 1996; Hassett et al., 2000). In contrast to the similarities between these two KatA proteins, the gene organization around the katA gene in these two organisms share little similarity. In S. meliloti oxyR lies directly upstream and is divergently transcribed from katA, while the rplQ katA bfrA gene region in P. aeruginosa is not linked to oxyR (Ma et al., 1999; Galibert et al., 2001). Interestingly in A. tumefaciens as in S. meliloti, oxyR and katA are divergently transcribed; however, unlike the monofunctional catalase coded by the katA gene of S. meliloti, the KatA protein from A. tumefaciens is a bifunctional catalase/peroxidase (HPI) which shares 59% amino acid identity with the S. meliloti KatB (SMa2379) protein and no significant sequence homology to S. meliloti KatA (SMc00819) (Xu and Pan, 2000). The variation in genome context and in the class of catalase induced in the three strains examined in this report suggests that the induction of catalase activity in response to Pi-starvation may be a general response among aerobic bacteria. We note that in E. coli, neither the KatG nor KatE catalase is notably induced in response to Pi-starvation (Mulvey et al., 1990; VanBogelen et al., 1996; and data not shown). However, expression of both these and other genes involved in the protection of cells to various stresses increases upon entry into stationary phase (Schellhorn, 1995; Storz and Imlay, 1999). Moreau and colleagues have shown that when Pi-starved E. coli cells are incubated aerobically with excess glucose as carbon source, they require the primary H2O2 scavenging enzyme alkylhydroperoxide reductase (AhpCF) to remain viable (Moreau et al., 2001; Moreau, 2004). Moreover, the viability of Pi-starved ahp mutant cells is further reduced upon the introduction of a katG mutation (Moreau et al., 2001). Paradoxically while OxyR is known to regulate ahp and katG expression in E. coli, the viability of Pi-starved oxyR mutant cells was much greater than the viability of ahp or ahp katG double mutants under these conditions (Moreau et al., 2001).

In probing the biological basis for the induction of catalase upon Pi-limited growth, we observed that Pi-starved cells are much more resistant to killing upon exposure to H2O2 than are cells pre-grown with excess Pi (Fig. 10A and B). This result is expected if the induction of katA in Pi-starved cells plays a major role in protecting the cells from H2O2. Indeed Pi-starved katA mutant cells were more sensitive to H2O2 than the wild type. However, Pi-starved phoB mutant cells were even more sensitive to H2O2 than the katA mutant cells. A direct explanation for this finding is that, in addition to katA, other PhoB-regulated genes that play a significant role in protecting cells from H2O2 are induced upon Pi-starvation. Our data demonstrating that more H2O2 is degraded by Pi-starved katA mutant cells than phoB mutant cells support this suggestion (Fig. 10C and D).

In a recent report, Krol and Becker (2004) employed microarrays to compare the expression profile of S. meliloti grown in Pi-limiting and Pi-excess conditions. Among 98 genes whose expression increased and appeared to be PhoB regulated were several genes they observed to be involved in oxidative stress. These include a non-haem haloperoxidase (SMa1809) for which they also detected PhoB-like binding sites in the promoter region. In addition, while PhoB binding sites were not detected in the promoter regions of the katA or bfr (SMc03786) genes, they also observed increased expression of both these genes. The bfr gene is annotated to encode a bacterioferritin protein. These are ferritin-like proteins that store iron in non-reactive sites and have been shown in several bacteria to help protect the cell from the oxidative damage that otherwise is initiated by ferrous iron (Ma et al., 1999; Smith, 2004). Thus, the data described in this report together with the data of Krol and Becker (2004) represent strong evidence that Pi-starvation results in the induction of several genes that are involved in protecting the cell from oxidative stress. We note that while some of these genes, such as katA, may overlap with those induced upon exposure to H2O2, others may not; an example of the latter would appear to be a recently reported peroxidase, SMc01944, that is induced by oxidative stress (Barloy-Hubler et al., 2004) but does not appear to be induced upon Pi-starvation (Krol and Becker, 2004). In studying the resistance of P. aeruginosa to pyocyanin, Hassett et al. (1992) noted that growth in media with low phosphate led to increased pyocyanin production and increased catalase and superoxide dismutatase activities. The latter was considered to give increased cellular protection against pyocyanin and addition of exogenous pyocyanin to a mutant defective in pyocyanin production resulted in increased catalase production. We are not aware of further studies in which the effect of phosphate limitation on catalase production in P. aeruginosa has been explored.

It is possible that the physiological and metabolic consequences of Pi-deficiency such as altered cell membrane composition could lead to a greater sensitivity of the cell to oxidative stress and hence a need to increase synthesis of protective enzymes (Geiger et al., 1999; Ruberg et al., 1999; Summers et al., 1999; Gao et al., 2004). Alternatively, Pi deficiency may result in increased ROS because of an altered metabolism such as uncoupling of the electron transport chain (ETC). In this respect, we note that the major source of ROS during aerobic metabolism in E. coli remains to be established and unexpectedly, in E. coli, the ETC is not the major source of ROS (Seaver and Imlay, 2004). Moreover, Moreau (2004) recently presented evidence that glucose catabolism in Pi-starved E. coli leads directly to an increase in oxidative damage. The direct demonstration that Pi-starved S. meliloti cells actually generate more ROS and the role of the various protective enzymes remains to be established.

Identification of the physiological rationale for the induction of catalase in response to phosphate limitation should lead to insights into the biology of oxidative stress. Moreover, as phosphate is a limiting nutrient in many environments, it is of interest to determine the phylogenetic distribution of the regulation of catalase expression by available phosphate.

Experimental procedures

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Bacterial strains, plasmids, media and growth conditions

The plasmid and S. meliloti strains employed in this study are listed in Table 1. In a few experiments, we employed an RCR2011 derivative carrying an ΩSp-Sm insertion in the SmaI site located in the intergenic region between smc03107 and smc03108. This insertion had no effect on either the pho regulon or any other phenotype examined. The Agrobacterium tumefaciences strain used is wild-type C58. The P. aeruginosa strains used are wild-type PAO1 and its derivative PHOB1 (phoB::Km) (Kato et al., 1994). The E. coli helper strains MT616 was used for triparental mating (Finan et al., 1986). E. coli host strain BL21 [F- ompT hsdSB (rB mB) gal dcm (DE3) pLysS (Cmr)] from Novagen was used for PhoB protein overexpression (Novagen). Phage ΦM12 was used for S. meliloti transduction (Finan et al., 1984). E. coli strains were grown at 37°C in LB medium (yeast extract, 5 g l−1; tryptone, 10 g l−1; NaCl, 5 g l−1). S. meliloti strains were grown in LB medium containing 2.5 mM MgSO4 and 2.5 mM CaCl2 (LBmc). The phosphate-free medium was MOPS-buffered minimal media (Bardin et al., 1996), supplied with 0.3 µg ml−1 biotin and 10 ng ml−1 CoCl2 (Watson et al., 2001) with the addition of 15 mM filter-sterilized carbon source.

Table 1.  Bacterial strains and plasmids.
Strain or plasmidsRelevant propertiesSource or reference
Sinorhizobium meliloti strains
 RCR2011Wild-type strainFinan collection
 Rm1021SU47 str-21 Meade et al. (1982)
 RmG212RM1021 lacZFinan collection
 RmG878Rm1021, katA::Tn5Finan collection
 RmH615RmG212, phoB3::TnV Bardin and Finan (1998)
 RmP110Rm1021 with changed wild-type pstCZ.C. Yuan, Z. Zaheer and T.M. Finan, submitted
 RmP143RCR2011, phoB3::TnV, pstC1021This study
 RmP375RCR2011, katA::Tn5This study
 RmK842RmG212, pTH1436 integrated, oxyR::ΩThis study
 RmK882RmG212, pTH1464 integrated, katA::ΩThis study
 RmP559RCR2011, phoB3::TnV, pstC wild typeThis study
 RmP631RCR2011, oxyR::ΩThis study
 RmP632RCR2011, katA::ΩThis study
Plasmids
 pJQ200-SK SacB suicide vector Quandt and Hynes (1993)
 pUCP30TSuicide vectorGenbank accession no. U33752
 pFUS1pMP220 with promoterless gusA; Tcr Reeve et al. (1999)
 pJP2RK2 (parAB) vector with promoterless gusA Prell et al. (2002)
 pCR2.1Ampr, Kanr, TA clone vectorInvitrogen
 pTH825681 bp PhoB cds in pET21aThis study
 pTH940pCR2.1 with 1.5 kb intergenic region of oxyR-katAThis study
 pTH1030 S. meliloti katA::gusA fusion in pFUS1This study
 pTH1031 S. meliloti oxyR::gusA fusion in pFUS1This study
 pTH1188pCR2.1 with 864 bp intergenic region of rplQ-katAThis work
 pTH1278NotI fragment from pTH1031 into pCR2.1This work
 pTH1436HindIII–XbaI internal fragment of oxyR in pUCP30TThis study
 pTH1437EcoRI–XbaI from pTH1278 into pUCP30TThis work
 pTH1464EcoRI internal fragment of katA into pUCP30TThis study
 pTH1582pJP2 but with the changed gusA from pFUS1This work
 pTH1860EcoRI fragment of P. aerginosa katA in pFUS1This study
 pTH1863EcoRI fragment of A. tumefaciens katA in pFUS1This study
 pTH1877HindIII–BglII fragment of S. meliloti katA (−408 to −73 with respect to ATG)This study
 pTH1878HindIII–BglII fragment of S. meliloti katA (−99 to +233 with respect to ATG)This study
 pTH1879HindIII–BglII fragment of S. meliloti katA (−70 to +233 with respect to ATG)This study
 pTH1880HindIII–BglII fragment of S. meliloti katA (−119 to +233 with respect to ATG)This study
 pTH1881HindIII–BglII fragment of S. meliloti katA (−408 to +233 with respect to ATG)This study
 pTH1894HindIII–BglII fragment of S. meliloti katA (−142 to +233 with respect to ATG)This study
 pTH1895HindIII–BglII fragment of S. meliloti katA (−408 to −57 with respect to ATG)This study
 pTH1907pJQ200-SK, wild-type pstCZ.C. Yuan, Z. Zaheer and T.M. Finan, submitted

When necessary, media were supplemented with appropriate antibiotics at following concentrations: tetracycline –10 µg ml−1 in solid medium and 3 µg ml−1 for liquid culture for S. meliloti, P. aeruginosa and A. tumefaciences carrying pFUS1, pJP2 or modified pJP2-borne promoter–gusA fusions; gentamicin –40 µg ml−1 was used to select for S. meliloti single cross-over recombinants, ampicillin (100 µg ml−1), chloramphenicol (10 µg ml−1) and gentamicin (8 µg ml−1) were used for E. coli strains; kanamycin (20 µg ml−1) for E coli and neomycin (200 µg ml−1) for S. meliloti were added, and streptomycin (200 µg ml−1) for S. meliloti was used.

β-Glucuronidase and alkaline phosphatase assays

The S. meliloti and P. aeruginosa strains were inoculated in 2 ml of LBmc containing 2.5 µg ml−1 tetracycline and grown overnight, aerobically, at 30°C to optical density at 600 nm (OD600) of ∼1.0. Cultures (1 ml) were spun down in a 1.5 ml microcentrifuge tube, washed twice in an equal volume of phosphate-free MOPS minimal medium (P0 medium) and resuspended in 250 µl of the P0 medium. Aliquots (10 µl) of these suspensions were subcultured into 5 ml of P0 medium, or MOPS minimal medium supplied with 2 mM KH2PO4 (P2 medium) and incubated for over 32 h at 30°C. For alkaline phosphatase assays, 2 ml of cultures were spun down at 10 000 r.p.m. for 1 min, resuspended in 1 M Tris-HCl (pH 8.0) and assayed as described by Bardin et al. (1996). β-Glucuronidase assays were performed according to the protocol described by Reeve et al. (1999).

Agrobacterium tumeaciences strain C58 carrying the plasmid katA::gusA fusions or the control, pFUS1, was grown in LB medium supplied with 2.5 µg ml−1 tetracycline for 8–10 h at 28°C. One millilitre of culture was spun down and washed twice in P0 medium and resuspended in 0.5 ml of P0 medium. Ten microlitres were subcultured into 5 ml of P2 medium or MOPS minimal medium supplied with 7.5 µM KH2PO4 (A. tumeaciences grows extremely slowly in P0 medium) and incubated for over 24 h at 28°C. β-Glucuronidase and alkaline phosphatase assays were performed as described above.

DNA manipulation and genetic techniques

Cloning procedures, including DNA isolation, restriction digestion, ligation, transformation and agarose gel electrophoresis, were performed according to Sambrook et al. (1989). Conjugal mating with MT616 as the helper strain was performed as previously described (Charles and Finan, 1990). ΦM12-generalized transduction was performed according to Finan et al. (1984).

Generation of promoter–gusA gene fusion reporter plasmids

To generate katA::gusA and oxyR::gusA gene fusions, the S. meliloti katA-oxyR intergenic region was PCR amplified from genomic DNA, using primers, ML2402: 5′-AAA ACA GCG CCC GGG TAA CGA TGC CG-3′ and ML2403: 5′-TTT CCG GGT TGC GGT TCA GCT CCA GC-3′. The 1569 bp PCR product was directly ligated into pCR2.1(TA) vector and the correct sequence and clone orientation was determined by sequencing using M13 Forward (−20) primer and the resulting plasmid was designed pTH940. The 768 bp PstI fragment covering the oxyR-katA intergenic was subcloned into the promoterless gusA reporter vector, pFUS1, in two orientations to produce katA::gusA fusion plasmid pTH1030 and oxyR::gusA fusion plasmid pTH1031 respectively (Fig. 1). In addition, the BamHI–XbaI fragment of pTH1030 carrying the 768 bp oxyR-katA intergenic region was subcloned into a modified, stably replicating gusA reporter vector pJP2 (Prell et al., 2002) digested with BamHI and XbaI to give plasmid pTH1584.

The S. meliloti strains used to study the promoter activities of various fragments from katA upstream regions were generated by transforming each of RCR2011::ΩSp-Sm and RCR2011 phoB3::TnV (referred to as RmP559) strains with plasmids generated by cloning these various PCR-amplified fragments (Fig. 5A) into the HindIII and BglII sites of pTH1582, a modified pJP2 vector (Prell et al., 2002) in which the gusA gene is replaced by the one from pFUS1 (Reeve et al., 1999).

To generate P. aeruginosa katA::gusA fusion, PAO1 genomic DNA was prepared according to Kato et al. (1999) and the rplQ-katA intergenic region was PCR amplified with primers ML2403 (5′-AAC GAC CTG GGC AAG CGC TAC G-3′) and ML2402 (5′-TTG AGA TCG GGG AAC TTG AGC-3′) and directly ligated into pCR2.1(TA) vector to give plasmid pTH1188. The EcoRI fragment from pTH1188 including the 864 bp rplQ-katA intergenic region was subcloned into pFUS1 vector to generate the P. aeruginosa katA::gusA fusion plasmid pTH1860 which was verified by DNA sequencing.

To generate the A. tumefaciences katA::gusA fusion, the katA-oxyR intergenic region was PCR amplified from strain C58 genomic DNA prepared according to Charles and Nester (1993) with the primers ML3463 (5′-AGG ACA GTG CAG GCT GGG AGA TGG CG-3′) and ML3464 (5′-GTT GAA GGA GGT GCC GAG CGG ATT GG-3′). The 475 bp PCR product was ligated into the pCR2.1(TA) vector to give plasmid pTH1862, and the EcoRI fragment from pTH1862 was subcloned into pFUS1 vector to generate the katA::gusA fusion plasmid pTH1863. Sequence and orientation was verified by DNA sequencing. Primer synthesis and DNA sequencing were carried out by the MobixLab, McMaster University.

Construction of null mutants of S. meliloti katA, oxyR and phoB genes

To disrupt the S. meliloti oxyR gene, a NotI fragment carrying the internal region of oxyR was subcloned from pTH1031 into pCR2.1 to give plasmid pTH1278. A HindIII–XbaI fragment carrying the 441 bp oxyR internal region was then subcloned into the suicide vector pUCP30T to give plasmid pTH1436. To disrupt the S. meliloti katA gene, an EcoRI fragment from pTH940 carrying the 851 bp internal region of katA was subcloned into pUCP30T to give plasmid pTH1464. These gentamicin-resistant plasmids were introduced and recombined into the streptomycin-resistant S. meliloti Rm1021 derivative RmG212 (lac) by triparental mating, using the MT616 E. coli strain as a helper (Finan et al., 1986). Inactivation of katA and oxyR was confirmed by PCR using primer ML2402 and ML2403 to give a 5872 bp PCR product including the inserted 4303 bp pUCP30T vector backbone and the 1569 bp katA-oxyR intergenic region (data not shown). Inactivation of katA was further confirmed by the disappearance of the KatA activity in the native PAGE gels stained with horseradish peroxidase (HRP) and diaminobenzidine for the catalase isozymes activity as described (Chen et al., 2004). Strains RmK882 and RmK842 contained insertionally inactivated katA and oxyR genes respectively.

To generate oxyR and katA null mutations in RCR2011 background, the gentamicin-resistant markers from RmK842 (RmG212, oxyR) and RmK882 (RmG212, katA) were transduced into RCR2011 to generate strains RmP631 (RCR2011, oxyR) and RmP632 (RCR2011, katA) respectively. In addition, to construct RmP375 (RCR2011, katA::Tn5), the neomycin-resistant marker from RmG882 (Rm1021, katA::Tn5) was transduced into RCR2011.

To construct an RCR2011 phoB mutant, the neomycin-resistant marker carried by RmH615 (RmG212, phoB3::Tn5, pstC1021) was transduced into RCR2011 to give RmP143. As RmH615 carries the pstC1021 allele (Yuan et al., 2005), which is tightly linked to phoB, we assumed and confirmed by PCR that RmP143 also carried the co-transduced pstC1021. To convert the pstC1021 allele to wild type, a pJQ200-SK-derived plasmid, pTH1907 (Yuan et al., 2005), carrying the wild-type pstC allele was transferred to RmP143 by triparental mating. Single cross-over recombinants were selected on LB containing 40 µg ml−1 gentamicin and resolved recombinants were identified as gentamicin-sensitive colonies growing on LBmc with 5% sucrose as outlined by Quandt and Hynes (1993). Double cross-over integrants carrying the corrected wild-type pstC allele were confirmed by PCR amplification and sequencing and designated RmP559 (RCR2011, pstC wild type, phoB3::TnV).

Phosphate starvation and hydrogen peroxide killing assays

Sinorhizobium meliloti strains were first grown in LBmc liquid media at 30°C to OD600 0.6–0.8. Bacterial cells (1 ml) were harvested by centrifugation at 5000 r.p.m. and washed three times in P0 medium. After washing, the cells were resuspended in 1 ml of P0 medium followed by 1:100 dilution into 15 ml of P0 medium and 1:500 dilution into 15 ml of P2 medium. After 24 h aerobic growth at 30°C, the cells was collected by centrifugation at 4°C, washed twice in P0 medium and resuspended into 30 ml of P0 or P2 medium to grow for over 24 h at 30°C. Finally, cells from 5 ml of culture were collected by centrifuge at 5000 r.p.m. for 15 min at 4°C and resuspended in 1 M Tris-HCl pH 8.0 for alkaline phosphatase assays as described (Bardin and Finan, 1998). The remaining culture was spun down and resuspended into P0 or P2 medium to OD600 around 0.3. Aliquots (2 ml) of the cultures were transferred into sterile disposable plastic tubes and H2O2 was added to final concentrations of 2.5 mM and 5 mM respectively. The cell suspensions were incubated at 30°C for 2 h with shaking. The cells were serially diluted followed by plating onto LB agar plate. Colonies were counted after 3 days of incubation at 30°C. The survival rates of H2O2-treated bacteria were expressed as the percentage of colony-forming units (cfu) recovered from the 2.5 mM or 5 mM – H2O2-treated cultures compared with controls with no H2O2 treatment.

To determine the final H2O2 concentration after 2 h of H2O2 treatment, the Amplex® Red Hydrogen Peroxide/Peroxidase Assay Kit was used according to the protocol provided by the supplier (Cat. ♯ A22188, Molecular Probe). Briefly, 0.5 ml of H2O2-treated cells were spun down and the supernatant was diluted 1:10. Fifty microlitres of the diluted supernatant (in triplicate) and 50 µl of serially diluted standard H2O2 were added to 96-well microtitre plates. 50 µl of the prepared Amplex® working solution containing 100 µM 10-acetyl-3,7-dihydroxyphenoxazine (Amplex Red reagent) and 0.2 U ml−1 HRP were added and following 30 min of incubation at 30°C, the microtitre plates were read by a Safire microtitre plate reader with excitation and emission wavelengths of 550 nm and 590 nm respectively.

Hydrogen peroxide induction assay

H2O2 induction was carried out essentially as described (Herouart et al., 1996). S. meliloti strains were grown at 30°C in LBmc medium supplied with 2.5 µg ml−1 tetracycline with shaking to an OD600 around 0.4. Aliquots (2 ml) of the cultures were transferred into new sterile disposable plastic tubes and 1 mM H2O2 was added five times at 12 min intervals each. After 2 h induction at 30°C with shaking, cells were collected by centrifuge at 10 000 r.p.m. for 1 min and resuspended into 0.85% NaCl followed by the determination of katA::gusA and oxyR::gusA expression based on β-glucuronidase activity assays as described (Reeve et al., 1999).

Phosphate starvation and catalase activity gel staining

To prepare total protein samples for catalase activity gel staining S. meliloti strains were first grown in LBmc medium at 30°C to OD600 0.5–0.6. Culture (2 ml) was centrifuged at 10 000 r.p.m. for 1 min, washed twice in P0 medium and resuspended in 1 ml of the P0 medium. Two hundred and fifty microlitres were taken to inoculate 15 ml of P0 medium and 50 µl to inoculate 15 ml of P2 medium in sterile plastic tissue culture bottles with filter caps and allowed to grow at 30°C with shaking for 24 h. The cells were collected by centrifugation at 5000 r.p.m. for 15 min at 4°C, washed twice in P0 medium and resuspended in 30 ml of fresh P0 medium or P2 medium for another 20 h growth. The cells were collected from the remaining culture by centrifuging at 5000 r.p.m. for 15 min at 4°C and washing once with ice-cold 0.85% NaCl. Cells was resuspended in ice-cold sonication buffer consisting of 20 mM Tris (pH 8.4), 1 mM MgCl2, 10 mM KCl, 20% glycerol and 10 mM β-mercaptoethanol and lysed by sonication for 3 × 30 s on ice with brief cooling on ice between. Cell debris was removed by centrifugation at 6000 r.p.m. for 15 min at 4°C as described (Driscoll and Finan, 1996; Mitsch et al., 1998). Protein concentrations were determined using the Bio-Rad protein assay dye and bovine serum albumin (BSA) as a standard. Protein samples (15 µg each) were resolved at 100 V through a 7.5% non-denaturing polyacrylamide gel for 4 h at 4°C. To visualize and assess the catalase isozymes activity, the gel was stained using HRP and diaminobenzidine as described (Chen et al., 2004). To confirm equal protein loading for each sample, a parallel gel was stained with Coomassie blue R-250. To quantify the bands the stained catalase activity gel was scanned using an EPSON perfection 1240U scanner.

Plant growth and nodule extract preparation

Medicago sativa var. Iroquois seeds were surface sterilized by immersing the seeds in 70% ethanol for 5 min followed by three washes with sterile water. Seeds were then immersed in a 10% bleach solution for 20 min followed by three washes with sterile water. Surface-sterilized seeds were allowed to germinate on 1% water agar for about 40 h in the dark at room temperature. Seedlings with roots (about 5 mm in length) were transplanted into Leonard assemblies containing quartz sand:vermiculite mixture (1:1) and 250 ml of nitrogen-deficient Jensen's nutrient solution (containing per litre 0.05 g of K2HPO4, NaCl and MgSO4·7H2O, 0.25 g of CaHPO4, 0.005 g of FeCl3, and 1 ml of a trace element solution) prepared as described (Oresnik et al., 1994). Two days after transplantation, the seedlings in each Leonard assemblies were inoculated with 100 µl of an overnight culture of S. meliloti diluted in 10 ml of sterile ddH2O2. To measure β-glucuronidase activity in nodules, plants were harvested 4 weeks following inoculation, 7–10 nodules were picked and transferred into 1.5 ml microcentrifuge tubes containing 750 µl of ice-cold MMS buffer (40 mM MOPS, 20 mM KOH, 2 mM MgSO4, 0.3 M sucrose, pH 7.0). Nodules were crushed with mini-pestle followed by centrifugation for 2 min at 2000 r.p.m. Five hundred microlitres of the supernatant were transferred to a new tube and SDS was added to a final concentration of 0.01%. Ten microlitres of the nodule crude extract were taken to determine total protein concentration using the Bio-Rad protein assay dye with BSA as a standard, and 100 µl of the nodule crude extract was used for the β-glucuronidase assays as described (Reeve et al., 1999).

Primer extension analysis

Total RNA was prepared as described by MacLellan et al. (2005) from S. meliloti strains RCR2011 and RCR2011 PhoB3::TnV (RmP559) containing a pOT1 plasmid carrying the full-length katA coding region along with 400 nucleotides upstream and from P. aeruginosa strain PAO1 carrying the P. aeruginosa katA promoter sequences in pFUS1. Briefly, overnight cultures of S. meliloti RCR2011 were used to inoculate 100 ml volumes of LBmc, phosphate-free MOPS-buffered minimal medium described by Bardin et al. (1996) and MOPS minimal medium containing 2 mM phosphate. Cultures were grown with shaking at 30°C to an OD600 of 0.4–0.6. Parallel LBmc cultures were induced with 1 mM H2O2 20 min before harvesting. The P. aeruginosa culture was grown in phosphate-free MOPS-buffered minimal medium. Without delay, cultures were supplemented with a 1/10 volume of cell stop solution (Maclellan et al., 2005) and immediately centrifuged to pellet cells. Cell pellets were flash frozen in liquid nitrogen and stored at 80°C until use. Thawed pellets from 50 ml of culture were resuspended in 960 µl of RNase-free water, split into 2 volumes of 480 µl each. Cells were lysed by the addition of an equal volume of hot phenol buffer (Maclellan et al., 2005) at room temperature, the suspension was vortexed vigorously, and heated at 95°C for 1 min. The lysed cell suspension was centrifuged at room temperature for 10 min at high speed to pellet debris and the aqueous supernatant was subjected to two phenol:chloroform extractions (using a 1:1 ratio of buffered phenol and chloroform) and one final chloroform extraction. Nucleic acids were precipitated by addition of 1/10 volume of 3 M Na acetate (pH 5.2) and two volumes of isopropyl alcohol, on ice for 30 min. DNA was removed by digestion with RNase-free DNase I and RNA was recovered after phenol/chloroform extraction by precipitation as described above.

To identify the transcriptional start site of S. meliloti a 26-mer oligonucleotide primer (5′-CCGGCGGTGGTGGTGAT CGTCGGACG-3′) complementary to nucleotide positions 10–35 of the protein coding region, and for P. aeruginosa, a 26-mer extension primer (GGTCTTCTCTTCCATTTACTCT CTCC) complementary to nucleotide positions −11 to +15 was end-labelled with [γ-32P]-ATP (Amersham) by using T4 polynucleotide kinase (New England Biolabs) at 37°C for 45 min, followed by the removal of unincorporated label through Qiagen oligopurification column. In a typical primer extension reaction, ∼40 µg of total RNA was supplemented with 2 × 105 cpm of end-labelled primer, 4 µl of 5× reverse transcriptase buffer, 0.8 µl of dNTP mixture containing all four nucleotides (25 mM each) and RNase-free water up to 16 µl. The mixture was heated at 65°C in a water bath for 10 min, allowed to cool down slowly to room temperature and then placed on ice. The annealed mixture was supplemented with 2 µl of 100 mM dithiothreitol (DTT) and 1 µl of RNaseOUT (Invitrogen) and was incubated at 50°C for 2 min before adding 1 µl (200 units) of SuperScript III reverse transcriptase (Invitrogen) and a further incubation at 50°C for 50 min. The reaction was stopped with an equal volume of formamide containing 2× loading dye. The primer extension product was loaded onto an 8% acrylamide-7 M urea sequencing gel and run alongside a sequencing ladder generated by using the same primer with plasmid template pTH1790 (PCR product of primer ML2630, 5′-CCCAAGCTTGACATCCGCGAGGA TGGAACGCACCTG-3′ and primer ML2496, 5′-GCTCTA GAGATCACTCGGCCGCCGTGCTGATCGTG-3′ containing S. meliloti katA and upstream promoter sequences, cloned into HindIII and XbaI sites in pBluescript vector) and the Sequenase Version 2.0 DNA Sequencing kit (Amersham). For P. aeruginosa pTH1791 [PCR product of forward primer: CGTAGAAGCTGCCGAATAAGGC and reverse primer: CGCTGAAGTCGATGGTCAACTG containing P. aeruginosa katA and upstream promoter sequences, cloned into pGEM-T vector (Promega)] was used as a sequencing template.

Overexpression and purification of PhoB

Sinorhizobium meliloti PhoB protein coding region was PCR amplified using primers ML1636 (Forward) CGAGTTAC CATATGTTGCCGAAGATTGCCG and ML1637 (reverse) CGTAAGCTTGCTCTCCAGCGAATAGCCC and cloned into NdeI and HindIII restrictions sites of pET21a vector (Novagen). The resulting plasmid, pTH825, was transformed into BL21(DE3)pLysS to give E. coli strain J841. Culture was grown in LB containing 100 µg ml−1 ampicillin and 30 µg ml−1 chloramphenicol at 37°C until OD600 = ∼0.5–0.6 and induced by addition of 0.3 mM IPTG for 3 h at 30°C. Protein was purified onto Ni-NTA resin (Qiagen) according to manufacturer's instructions. Eluted fractions containing purified protein were pooled and dialysed against 50 mM Hepes pH 8.0, 300 mM NaCl, 10% glycerol and 1 mM DTT. The purity of the protein was verified by SDS-PAGE and quantified using the Bio-Rad Dye Reagent.

Electrophoretic mobility shift assay

The basic gel shift protocol was based on the methods of Garner and Revzin (1981). The DNA probe for S. meliloti was derived from a 182 bp PCR product of primers ML3167 (CAACATGATAGGAAAATCTTATCG) and ML3168 (ATCA CATCCCTCCTGTTTCGATG), and for P. aeruginosa, probe was prepared from 188 bp PCR product of forward primer (ATTGGATTGTAGGAGGGCTGTCATTC) and reverse primer (CTCTCTCCTCAACGGCTAACGTGC). These PCR products were labelled at both ends with [γ-32P]-ATP using T4 polynucleotide kinase and were subsequently purified through Qiagen PCR purification column to remove unincorporated label. Protein–DNA binding reaction mixtures contained approximately 6000 cpm DNA probe in a final volume of 15 µl of DNA-binding buffer (20 mM Hepes pH 8.0, 5 mM Mg-Acetate, 50 mM KCl, 0.5 mM EDTA, 2 mM DTT, 200 µg ml−1 BSA, 100 ng of poly(dI-dC) and 4% glycerol). Purified PhoB (50–100 ng) was added, and the reaction mixtures were incubated on ice for 10 min followed by 20 min incubation at 25°C. The reaction mixtures were resolved through a 5% non-denaturing polyacrylamide gel in 0.5× TBE at room temperature. Following electrophoresis, the probes were detected either using a Storm820 phosphorimager (Amersham Pharmacia) or through autoradiography.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

This project was funded by an NSERC Research grant to T.M.F. R.Z. was funded by Genome Canada through the Ontario Genomics Institute. We are grateful to Professors Junichi Kato and Hisao Ohtake for supplying the P. aeruginosa strains. We thank Christian Baron and Qing Yuan for using their A. tumefaciences strain and equipment. We appreciate Herb Schellhorn for his E. coli catalase gene fusions strain and discussion. We thank Dick Morton for performing the in silico analysis and James Imlay for insightful discussion. We thank Adrian Rybak for technical assistance and an anonymous reviewer for suggestions regarding the sensitivity of P2 cells to H2O2.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References