SEARCH

SEARCH BY CITATION

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

The bacterial actin homologue MreB forms a helix underneath the cytoplasmic membrane and was shown to be essential in the morphogenesis of the rod-shaped cells. Additionally, MreB was implicated to be involved in DNA segregation. However, in our hands the mreBCD deletion strain (PA340-678) grew without apparent DNA segregation defect, suggesting that the reported chromosome segregation inhibition could be caused by a temporarily effect of MreB inhibition or depletion. To assess the involvement of MreB in DNA segregation during the transition from rod to sphere, we compared the effect of A22 and the PBP2 inhibitor mecillinam on the percentage of cells with segregated nucleoids and the number of oriC foci in wild-type Escherichia coli cells. Cells became spherical in the same time window during both treatments and we could not detect any difference in the chromosome or oriC segregation between these two treatments. Additionally, flow cytometric analyses showed that A22 and mecillinam treatment gave essentially the same chromosome segregation pattern. We conclude that MreB is not directly involved in DNA segregation of E. coli.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

Bacterial DNA segregation differs from its eucaryotic counterpart in that it does not possess a microtubule-based mitotic spindle. Bacteria also do not employ a condensation and decondensation cycle as DNA replication and segregation occurs simultaneously (Nanninga, 2001). In addition, the spatial scale at which movements of chromosomes have to be accomplished is 10 times smaller in bacteria than in the eucaryotic cell. These differences inspired models in which anchoring the duplicated bacterial origins of replication to the cytoplasmic membrane in combination with length growth (Jacob and Brenner, 1963), or in which the co-translational protein translocation of membrane associated proteins (Norris, 1995; Woldringh, 2002) was sufficient to drag the daughter chromosomes in the opposite direction in a growing cell.

The discovery of actin-like proteins in bacteria, such as the plasmid-encoded ParM protein, which actively segregates plasmids into the two daughter cells (see for a review Ebersbach and Gerdes, 2005), and the chromosome-encoded MreB protein involved in rod shape maintenance (Wachi et al., 1987; see for a review Carballido-Lopez, 2007), inspired a renewed search for an active and directed DNA segregation mechanism of the bacterial chromosome.

MreB assembles into filaments that are located as a helical structure underneath the cytoplasmic membrane (Jones et al., 2001; Figge et al., 2004; Kruse et al., 2005; Shih et al., 2005). These filaments are probably similar to actin filaments, because Thermotoga maritima MreB polymerizes in vitro into actin-like structures (van den Ent et al., 2001) and the in vivo polymerization rate of Caulobacter cresentus and Bacillus subtilis MreB is in the same order of magnitude as the growth rate of actin polymers (Defeu Soufo and Graumann, 2004; Kim et al., 2006). It was found that MreB depletion leads to spherical cells and eventually to lysis (Jones et al., 2001; Figge et al., 2004; Kruse et al., 2005). The spherical cells were reported to segregate their chromosomes in pairs (Kruse et al., 2003). Overexpression of mutated MreB proteins caused cell division inhibition, deviant MreB filament morphology, and induced severe localization defects of the nucleoid and of ori C and ter C chromosomal regions (Kruse et al., 2003).

In a screen for antibiotics (Iwai et al., 2002; 2004) A22 was found to cause cell elongation inhibition. A22-resistant cells appeared to contain a T158 to A mutation in C. cresentus MreB (Gitai et al., 2005) or a D21 to N mutation in Escherichia coli MreB (Kruse et al., 2006), suggesting that its primary target is MreB. Addition of A22 to C. cresentus cells resulted in depolymerization of MreB (Kim et al., 2006) and a block of the movement of newly replicated loci near the origin of replication has been reported. Other regions on the chromosome were not affected (Gitai et al., 2004; 2005). Depletion of MreB in B. subtilis led to a rapid defect in chromosome segregation, while replication origins failed to localize in a regulated bipolar fashion (Soufo and Graumann, 2003). These observations in which MreB appeared to be involved in the segregation of the origins of replication (oriCs) led to the suggestion that MreB provides the force and directionality for an active DNA-segregating mechanism (Kruse and Gerdes, 2005).

Remarkably when the lethality of the mreB deletion is suppressed, the defect in DNA segregations seems not to occur (Wachi et al., 1987; Formstone and Errington, 2005). The lethality of MreB deletion can be suppressed by overexpression of some cell division proteins, e.g. FtsZ, PBP1B and PBP3 (Wachi et al., 1987; Kruse et al., 2005). The mreBCD deletion strain PA340-678 and the MreB(A283P) mutant protein-expressing strain PA340-129 (Wachi et al., 1987) grow without any apparent growth rate defects, apart from being spherical. In B. subtilis MreB deletion strains are stable, provided that the cells are grown in the presence of high magnesium concentrations (Formstone and Errington, 2005), and grow without DNA segregation defects. The recently described MreB from cyanobacterium Anabena sp. PCC 7120 was also reported not to be involved in DNA segregation (Hu et al., 2007).

Given the apparent discrepancy in the published data, we wondered whether the defect in DNA segregation observed upon MreB depletion could be caused by the transition from rod to sphere. In E. coli the peptidoglycan transpeptidase penicillin-binding protein 2 (PBP2) is required for rod shape and diameter maintenance (Den Blaauwen et al., 2003). Inhibition of PBP2 by its specific antibiotic mecillinam (Park and Burman, 1973) results in spherical growth essentially indistinguishable from that of cells growing in the presence of the MreB inhibitor A22 (this article). We compared the percentage of cells with segregated nucleoids, the number or oriC regions per μm cell length and the average number of chromosome equivalents per cell during the transition from rod to sphere in A22- and in mecillinam-treated cells. Surprisingly, we found that DNA segregation, origin frequency and number of chromosome equivalents were indistinguishable in these cells after both treatments. The spherical cells have a slightly lower percentage of segregated nucleoids, a higher number of oriC regions per μm and a corresponding higher number of chromosome equivalents per cell compared with the rod-shaped cells. The shorter length axes of the spherical cells in which the origins have to be accommodated and the prolonged constriction period can explain the difference.

Based on these findings we conclude that MreB inhibition by A22 or deletion of the mreBCD operon does not directly affect chromosome segregation in E. coli and that the observed slight differences following the A22 and mecillinam treatment are the consequence of the transition from the rod to the sphere rather than a specific response to inactivation or the absence of MreB.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

To determine whether the inhibition of MreB affected nucleoid segregation and origin of replication segregation during the rod to sphere transition, these processes were analysed in two cultures that were forced to change shape by different methods. The transition from rod shape to spherical growth was achieved either by depolymerization of MreB by A22 (Kim et al., 2006) or by inhibition of PBP2 by mecillinam.

Immunodetection of MreB

To be able to localize endogenous MreB in E. coli, a His-tag version of MreB was constructed. Following, the protein was purified by Ni-resin affinity chromatography and the isolated protein was used to produce a polyclonal antiserum. The antibodies were subsequently affinity purified using the His-tagged MreB. The number of MreB molecules per average cell was determined in the wild-type LMC500 cells grown to steady state in minimal glucose medium at 28°C and in the wild-type MC1061 cells that were grown in rich medium at 37°C. The cell number was determined by particle counting and related to the optical density of the samples. Purified MreB and the two types of cells were applied to SDS-poly acrylamide gel-electrophoresis and blotting. The number of MreB molecules in an average cell grown in minimal medium and in rich medium was densitometricaly determined to be approximately 9000 and 15000, respectively, which amounted to 6400 molecules μm−3 and 9000 molecules μm−3 respectively.

To investigate the localization pattern of endogenous MreB, LMC500 and PA340 wild-type cells and PA340-678 mreBCD deletion cells were grown in minimal glucose medium at 28°C and in TY at 37°C. Next they were labelled with the affinity-purified antibodies against MreB. When viewed in the microscope, MreB formed a helix with a helical pitch of 0.64 ± 0.4 μm (n = 100; Fig. 1). No signal was observed in the MreB deletion cells, indicating that the antibodies were specific (Fig. 1; Fig. S1).

image

Figure 1. Immunofluorescence microscopy of the localization of MreB using affinity-purified polyclonal antiserum against MreB. A. LMC500 grown in GB1 at 28°C. Left is the phase contrast image. Right is the Cy3 immunofluorescence image. The bar equals 1 μm. B. Average fluorescence intensity in mreBCD deletion strain PA340-678 (solid line) and in its parental strain PA340 (dashed line).

Download figure to PowerPoint

A22 inhibits growth of mreBCD deletion (PA340-678) strain and of wild-type E. coli

To determine the concentration of A22 at which it inhibits cell elongation without affecting growth rate under our growth conditions, LMC500 and the mreBCD deletion strain PA340-678 and its parental wild-type strain PA340 were grown in the presence of various A22 concentrations. A concentration of 100 μg ml−1 of A22 reduced the growth rate of the cells immediately, whereas 50 μg ml−1 of A22 inhibited growth after 2 mass doublings (MD) in the presence of A22 in all three strains (Fig. S2). As the growth rate of the MreB deletion strain was virtually identical as compared with its parental wild-type strain, it was concluded that at concentrations of 50 μg ml−1 or more A22 affected other processes (as yet unknown) in addition to disturbing the MreB localization. As the growth rate was not affected at low A22 concentrations, we used an as low as possible A22 concentration (10–20 μg ml−1) for all experiments, which is about three to six times the minimal inhibitory concentration (MIC) for A22 (Iwai et al., 2004).

A22 but not mecillinam inhibits MreB polymerization

To verify that mecillinam did not affect MreB, the localization of MreB was studied in cells that were grown in the presence of mecillinam. LMC500 cells were grown to steady state in minimal glucose medium at 28°C and diluted 1:4 in pre-warmed medium containing either A22 (final concentration 10 μg ml−1) or mecillinam (final concentration 2 μg ml−1) and growth was continued for 3 MD (1 MD = 80 min). Samples for immunofluorescence microscopy were harvested after 0.5, 1, 2 and 3 MD. After 0.5 MD in the presence of A22 all MreB appeared to be partly diffusely localized in the cytosol and partly membrane bound, whereas no helical filaments could be observed (Fig. 2A). However, in the mecillinam-treated cells clear helical structures could be observed even after treatment for 3 MD (Fig. 2B). After 2 MD of growth in the presence of mecillinam cells are spherical (Figs 3 and 4). It can be concluded that the transition from rod to sphere due to the inhibition of PBP2 by mecillinam does not affect the polymerization or localization of MreB, whereas the A22-induced transition from rod to sphere causes loss of normal MreB localization.

image

Figure 2. The MreB localization pattern in LMC500 cells grown in GB1 at 28°C in the presence of 10 μg ml−1 A22 and 2 μg ml−1 mecillinam for 3 MD. The typical MreB localization pattern is lost in the cells treated with A22 (A), whereas it is not affected in cells grown in the presence of mecillinam (B). Left images are phase contrast and right are the Cy3 immunofluorescence images. The images contain a collection of representative cells. The bar equals 1 μm.

Download figure to PowerPoint

image

Figure 3. Nucleoid morphology during transition from rod to sphere of LMC500 cells grown to steady state in GB1 at 28°C. Cells were grown in the presence of 10 μg ml−1 A22 (A) and 2 μg ml−1 mecillinam (B) and harvested after 0 (untreated control), 0.5 (40 min), 1 (80 min) and 2 (160 min) MD. The phase contrast image and the DAPI fluorescence were recorded simultaneously and contain a collection of representative cells. The bar equals 1 μm.

Download figure to PowerPoint

image

Figure 4. Length (solid lines) and diameter (dashed lines) of LMC500 grown in GB1 at 28°C in the presence of 10 μg ml−1 A22 (triangles) and 2 μg ml−1 mecillinam (circles) for 2 MD (1 MD = 80 min). The means were slightly offset in order to avoid the overlapping bars.

Download figure to PowerPoint

Morphology and nucleoid segregation of the A22- and the mecillinam-treated cells are similar

Phase contrast images were taken after growth of wild-type cells in the presence of A22 and mecillinam for 0.5, 1 and 2 MD. The images show that the morphology of the A22- and the mecillinam-treated cells is indistinguishable and that the transition from rod to sphere occurs at the same time scale (Figs 3 and 4). This suggests that, although the antibiotics affect different proteins, they likely affect the same process.

Subsequently, the cells were stained with DAPI to visualize the nucleoids. As observed by microscopy, no striking difference could be seen between the A22- and the mecillinam-treated cells, both exhibiting wild-type nucleoid organization (Fig. 3). From each sample (500 cells) the percentage of cells with properly segregated nucleoids was determined by visual inspection. The percentage of segregated nucleoids decreased slightly from about 33% (0 MD) to about 28% (2 MD) in both the A22- and in the mecillinam-treated cells (Fig. 5). Because of the change in morphology from rod to sphere, the cells become shorter and fatter (Figs 3 and 4). As a result segregated nucleoids are more difficult to observe by fluorescence microscopy due to the shorter length axes of the cells. As the observed slight decrease in the percentage of cells with segregated nucleoids occurred in the A22- as well as in the mecillinam-treated cells, we assume this decrease to be associated with the transition from rod to sphere and therefore a indirect consequence of inhibition of MreB or PBP2 function.

image

Figure 5. Chromosome segregation in LMC500 grown in GB1 at 28°C in the presence of 10 μg ml−1 A22 (black bars) or 2 μg ml−1 mecillinam (white bars). The cells were grown for 0.5 (40 min), 1 (80 min) and 2 (160 min) MD in the presence of both antibiotics, and the percentage of cells with segregated chromosomes was compared with the untreated control (grey bar). The chromosomes were visualized with DAPI and the microscopic images were analysed. The segregated chromosomes were visible as two distinct fluorescent bodies; the unsegregated chromosomes were visible as one fluorescent body. Subsequently, the number of cells with segregated chromosomes in each sample was scored in 500 cells (in triplicate). The means with standard deviations are shown in the graph.

Download figure to PowerPoint

Origin region segregation is not affected by the transition from rod to sphere

Because of reports on the specific involvement of MreB in origin segregation in E. coli (Kruse et al., 2003; 2006; Kruse and Gerdes, 2005), we studied this process in the presence of A22 and mecillinam. In fast growing cells (MD of 45 min) mKO–LacI was expressed from an arabinose inducible promoter on a plasmid, which contained a lacI operator array near oriC at 84.2 min on the chromosome (Gordon et al., 1997). MKO is an orange fluorescent protein (Karasawa et al., 2004). The cells were treated with A22 or mecillinam for 23 (0.5 MD), 45 (1 MD) and 90 min (2 MD) in each case. The expression of mKO–LacI was induced for 20 min before the cells were harvested. Fluorescence microscopy images of the cells (Fig. 6) show that distinct fluorescence foci can be discriminated in all samples. Moreover, the foci look similar in the A22- and in the mecillinam-treated cells. The number of foci per μm cell length was determined in all samples (Fig. 7). At 0.5 MD and 1 MD of growth the number of foci in the presence of A22 or mecillinam was the same as in the control cells of the same strain without antibiotic treatment. After 2 MD of treatment, the number of foci per μm cell length in the A22- or mecillinam-treated cells was 20% increased in comparison with the control cells. This is to be expected because due to their spherical shape, the A22- and the mecillinam-treated cells have become much shorter and fatter (length 3.32 ± 0.61 μm and diameter 1.52 ± 0.10 μm) compared with the control cells (length 4.85 ± 0.94 μm and diameter 1.17 ± 0.04 μm). Inhibition of MreB does not affect the rate of DNA synthesis (Kruse et al., 2006). Thus, if the A22-treated cells have the same DNA replication pattern as the control cells they have to accommodate the same number of origins (foci) along a much shorter cell length. This explains the increase in the average number of foci per μm cell length in the spherical cells. In conclusion, we could not observe any effect of A22 or mecillinam on the number of near-origin regions and therefore also not on their ability to segregate.

image

Figure 6. LacO foci visualized by the binding of mKO–LacI in LMC1426pSA053 cells grown in TY at 28°C in the presence of A22 or mecillinam. Expression of mKO–LacI was induced with 0.1% arabinose 20 min before harvesting the cells. Upper panel shows the control for the A22-treated cells in the second panel. Third panel shows the control for the mecillinam-treated cells. Because of the slow maturation rate of mKO (see also legend of Fig. 7) a control culture was grown in addition to the A22 as well as to the mecillinam experiment. The cells were treated with inhibitor for 0.5 (23 min), 1 (45 min) and 2 (90 min) MD. The images contain a collection of representative cells. The bar equals 1 μm.

Download figure to PowerPoint

image

Figure 7. Number of mKO–LacI foci per μm cell length of LMC1426pSA053 cells grown in TY at 28°C in the presence of A22 or mecillinam. The number of foci per μm cell length is plotted as a function of A22 (A) or mecillinam (B) incubation time and the number of mass doublings (MD) is indicated. Expression of mKO–LacI was induced with 0.1% arabinose 20 min before harvesting the cells. The control cells were only arabinose induced (black bars) and the A22 or mecillinam cells (white bars) were grown in the presence of inhibitor for 0 (0 min – untreated control), 0.5 (23 min), 1 (45 min) and 2 (90 min) MD as well as in the presence of 0.1% arabinose 20 min before the harvest of the cells. The difference in total number of foci per μm cell length in the A22-treated cells compared with the mecillinam-treated cells as well as their controls is a result of the very slow maturation of mKO of more than 7 days (to be published elsewhere) and reflects the fact that the samples were images after 2 and 4 days of mKO maturation respectively.

Download figure to PowerPoint

The number of chromosome equivalents is similar in cells treated with either A22 or mecillinam

In order to determine the numbers of origins of replication per cell in wild-type LMC500 cells flow cytometry analysis was applied. Cells were grown in minimal medium at 28°C in the absence and presence of both antibiotics (A22 and mecillinam). The cells were treated with rifampicin (to stop new rounds of DNA replication) and cephalexin (to stop further cell division). The flow cytometry analysis of the number of origins (genome equivalents) in treated samples showed essentially no differences between the A22- and the mecillinam-treated cells for 1 and 2 MD (Fig. 8). Control cells that were not treated with A22 nor with mecillinam were expected to contain either two or four origins based on the DNA replication cycle of LMC500 cells (see Fig. 2B in Den Blaauwen et al., 2006). Due to the transition from rod to sphere, the cells became shorter and fatter (Figs 3 and 4). Consequently, the synthesis of new cell poles takes more time as is illustrated by the increase in the number of constricting cells (i.e. duration of the cell division time) in the A22- and in the mecillinam-treated cells compared with the untreated cells (35% and 60% increase respectively). Because the A22 treatment does not affect the rate of DNA replication (Kruse et al., 2006), the number of cells in the culture that have reinitiated DNA replication in already segregated nucleoids increases correspondingly to the increase in cell division time. This explains the increase in the number of cells with four chromosome equivalents in the A22- and in the mecillinam-treated cells that have become spherical after 2 MD of treatment (Fig. 8).

image

Figure 8. Number of chromosome equivalents in single cells analysed by flow cytometry in exponentially growing LMC500 cells (control) and LMC500 cells grown for 1 (A) and 2 (B) MD (1 MD = 80 min) in the presence of 10 μg ml−1 A22 or 2 μg ml−1 mecillinam. Cells were grown in minimal medium (GB1), at 28°C. Number of chromosome equivalents was plotted against the relative cell number. In average 100 000 cells per treatment were measured. All samples were treated with rifampicin and cephalexin for 4 h. Prior to the measurement DNA was stained with ethidium bromide.

Download figure to PowerPoint

In summary, these results strongly suggest that the observed difference in the number of origins compared with the untreated cells is the consequence of the transition from the rod to the sphere rather than a specific response to the A22 treatment.

GFP–MreB can replace MreB

To be able to follow in vivo the fate of the MreB polymers after the addition of A22, a GFP–MreB fusion was constructed. First, it was established that the fusion was able to complement an MreB deletion strain and was therefore functional. For this purpose the mreBCD operon deletion strain PA340-678 (Wachi et al., 1987), which exhibits round cell morphology, was transformed with plasmid pTB016 (expressing GFP–MreB under control of a weakened trc promoter) and plasmid pMEW1 (encoding mreC and mreD under control of constitutively expressed lacUV5 promoter), resulting in strain LMC2308. The cells containing both plasmids grew in TY as normal rods with an occasional rod-shaped cell with forked poles (data not shown). Addition of 10 μM isopropyl-β-d-thiogalactopiranoside (IPTG) to cells growing in TY to produce more GFP–MreB resulted in cells with normal rod shape morphology. The cells had an average cell length of 4.87 ± 1.16 μm and average diameter of 1.12 ± 0.08 μm (n = 635), which is very similar to that of the wild-type parental strain PA340 (average length is 4.46 ± 0.86 μm and average diameter is 0.91 ± 0.05 μm; n = 430). Hence, the combination of both plasmids restored the rod shape of the cells completely, indicating that GFP–MreB was functional (Fig. 9B).

image

Figure 9. Effect of A22 on the localization pattern of MreB in cells grown in rich medium (TY) at 28°C. A. PA340 cells (wild type) were grown in the presence of 10 μg ml−1 A22 and harvested after 0 (untreated control), 5 and 80 min for immunolocalization of MreB. B. LMC2308 cells [PA340-679 cells (mreBCD deletion strain)] transformed with pTB016 (expressing GFP–MreB) and pMew1 (expressing mreC and mreD) were grown to steady state with constant induction with 10 μM IPTG. Subsequently they were grown in the presence of 20 μg ml−1 A22 and harvested after 0, 5 and 80 min for GFP fluorescence imaging. The images contain a collection of representative cells. The bar equals 1 μm.

Download figure to PowerPoint

Subsequently, the LMC2308 cells were grown in rich medium at 28°C (MD time was 48 min) in the presence of 10 μM IPTG and 20 μg ml−1 A22. The cells were grown at higher than standard (10 μg ml−1) concentration of A22 because otherwise the cells did not change morphology, possibly due to the slight overexpression of the GFP–MreB. The cells were harvested for fixation and fluorescence microscopy after 0, 5, 10, 15, 20, 40 and 80 min. Within 5 min of growth in the presence of A22, GFP–MreB localization was mostly diffuse in the cytosol and detached from the cytoplasmic membrane; partly however, it remained at the membranes. The same behaviour of MreB after treatment with A22 was observed in the immunofluorescence-labelled cells. Occasionally, GFP–MreB formed extremely bright fluorescent rod-shaped structures in the cytosol (Fig. 9B). Immunofluorescence labelling of the parental PA340 cells grown in the presence of A22 for 5 min showed patches and bands of MreB slightly more diffuse than in the control samples. After 80 min of A22 treatment the MreB signal was diffuse in the cytosol (Fig. 9A), suggesting that A22 interferes with the normal MreB filament formation. When the GFP–MreB was expressed in the wild-type strain LMC500 without A22 treatment, we could occasionally observe a cell with a similar bright GFP–MreB filament as shown in Fig. 9B. Therefore, we concluded that the extreme bundling of GFP–MreB is an intrinsic property of GFP–MreB and that it is stimulated by A22. Interestingly, formation of similar filaments was observed after expression of GFP–MreB in B. subtilis (Soufo and Graumann, 2003) and in fission yeast (Srinivasan et al., 2007). Summarizing, the MreB localization experiments in the presence of A22 suggest that the depolymerization of MreB by A22 can result in a variety of MreB structures and patterns that most likely depend on the balance between cytosol and membrane bound MreB (see Discussion).

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

Nucleoid and origin segregation are not affected by the transition from rod to sphere

Rod-shaped cells that had been forced to grow as spheres either by inhibiting PBP2 or because of pbpA, rodA or mreB mutations appeared to grow normallyprovided that sufficient cell division proteins were present (Wachi et al., 1987; Vinella et al., 1993; Kruse et al., 2005). Nevertheless, defects in nucleoid segregation and oriC segregation upon inhibition of MreB by A22 have been extensively described (Kruse et al., 2003; 2006; Kruse and Gerdes, 2005). This contrasted with our observation that the mreBCD deletion strain PA340-678 grew with no apparent defect in DNA segregation. We questioned whether an alternative way to produce the rod to sphere transition would have comparable effects. Therefore, we inhibited cell elongation by two different procedures either by the MreB inhibitor A22 or by the PBP2 inhibitor mecillinam. The transition from rod to sphere occurred basically in the same time window and it resulted in a virtually identical morphology in both cases. After antibiotic treatment for 1 or 2 MD, the percentage of cells with segregated nucleoids was determined. The two treatments resulted in comparable numbers of cells with properly segregated chromosomes. Apparently, DNA segregation in E. coli is not affected by inhibition of MreB function by A22.

As a subsequent step, we determined whether the segregation of the oriC region was affected by the transition from rod to sphere. Cells that contained a lacO array cassette, inserted in the chromosome near the origin of replication (oriC region at 84.2 min of the E. coli chromosome), were transformed with a plasmid that expressed the fluorescent mKO–LacI fusion protein that binds to lacO. The number of lacO foci per μm cell length was determined during the transition from rod to sphere in cells treated either with A22 or with mecillinam. No significant difference in the number of foci per μm cell length could be observed in the A22-treated cells as compared with the mecillinam treated cells. Additionally, flow cytometric analysis of the number of chromosomes equivalents showed no difference between A22 and mecillinam treatment. We conclude therefore that inhibition of MreB by A22 does not specifically affect chromosome segregation or oriC segregation in E. coli and that the observed differences between the treated and control samples are the effect of an adaptation to the transition from the rod to the spherical shape.

An alternative explanation for the reported oriC segregation defect

What could be the cause of the discrepancy between published E. coli data and ours? A striking observation is that all reported cases of origin segregation defects in E. coli occur after inhibition of the MreB in wild-type strains (Kruse et al., 2003; 2006), but not in MreB deletion strains (Kruse et al., 2003). In addition, all previously reported cases are based on the parS/GFP-ParB reporter system. The partition system of P1 plasmids is composed of two proteins, ParA and ParB, and the cis-acting site parS (Ebersbach et al., 2006). Normally, ParA is binding to ParB that is bound to its ParS recognition sequence on the low-copy-number P1 plasmid to assist its segregation into the bacterial daughter cells. However, at low ParB levels, ParA removes or disassembles ParB from the partitioning complex (Bouet and Funnell, 1999). The sequence of parS is the DNA binding site for ParB. Insertion of parS near oriC allows the monitoring of origin segregation by following GFP-ParB foci as we monitor the mKO–LacI foci.

With respect to MreB it can be assumed that the majority of the molecules are in the helical polymer and that very few will be free in the cytosol (Fig. 8) as the critical concentration for (T. maritime) MreB polymerization is in the range of 3 nM (Esue et al., 2006). Conversely, a major part of the molecules will likely be in the cytosol upon inhibition of MreB. MreB and ParA belong to a superfamily of polymerizing ATPases (Bork et al., 1992). GFP–MreB even behaves ParA-like in the presence of A22 by forming rod-like structures in the cytosol (Fig. 9 and Srinivasan et al., 2007). It is therefore plausible that, as ParA homologue, the cytoplasmic MreB molecules might bind to GFP-ParB and prevent their binding to parS. This would reduce the number of foci and suggest an oriC segregation problem. The fact that removal of the MreB inhibitor A22 resulted in an almost instantaneous reappearance of neatly segregated foci (Kruse et al., 2006) is more readily explained by the rebinding of GFP-ParB molecules to already segregated parS sites rather than by a profound and very rapid segregation of these parS sites just because MreB is allowed to re-polymerize as helical filament.

Inhibition of cell elongation and division affect DNA segregation

In E. coli inhibition of bulk DNA segregation by A22 has been reported for DAPI-stained cephalexin filaments, i.e. in rod-shaped cells (Kruse et al., 2006). Cephalexin inhibits the cell division specific peptidoglycan transpeptidase PBP3 (Adam et al., 1991). The combination of A22 and cephalexin (Kruse et al., 2006) will inhibit elongation as well as division, respectively, which is virtually identical to the inhibition of cell growth. As cell growth is a prerequisite for DNA segregation (Van Helvoort and Woldringh, 1994) the combination of both antibiotics will inevitably inhibit this process.

The images of the inhibited DNA segregation (e.g. Fig. 1 in Kruse et al., 2006) show cells that are filled with completely expanded DNA, which is reminiscent of the images of cells with run-away DNA synthesis (see Fig. 6 in Bernander et al., 1989). It is feasible that the cells treated with the combination of cephalexin and A22 are inhibited in growth as well as in division, whereas their DNA replication continues unhindered, thus causing cells to become filled up with DNA seemingly mimicking a DNA segregation defect.

Arrangement of A22-inhibited MreB

We also tried to assess the effect of A22 on the arrangement of MreB in fixed cells and living cells. For that purpose we constructed a GFP–MreB that was able to restore the rod shape of an mreBCD deletion strain, provided that MreC and MreD were also expressed in trans. Despite this apparent functionality, the GFP–MreB fusion also showed the odd behaviour of collapsing in very bright rod-shaped structures in the cell after treatment with A22 and in a minor fraction of the cells growing in rich medium without any A22 treatment. Similar structures of a functional GFP–MreB in B. subtilis (Fig. 3 in Defeu Soufo and Graumann, 2004) and in fission yeast (Srinivasan et al., 2007) have been published. However, we never observed endogenous E. coli MreB to form these filament-like structures by immunofluorescence microcopy. This indicates that there can be differences in the behaviour of fluorescent protein fusions to MreB and the behaviour of endogenous MreB despite their ability to support rod shape growth.

We noticed that A22 did not fully dislocate MreB from the membrane into the cytoplasm (Fig. 9). The immunostained endogenous MreB as well as the cells that expressed GFP–MreB as sole MreB source showed a combination of cytosolic MreB and membrane-bound MreB. This is in contrast to the reported complete absence of MreB polymers in the presence of A22 in C. cresentus (Kim et al., 2006). Overall it seems that one should be cautious to extrapolate data from one organism to another organism in the case of MreB. A clear common denominator is the requirement of these proteins for cell elongation. Apparently, the loss of an intact helical structure of MreB in the presence of A22 causes the loss of the cytosolic communication with the predominantly periplasmic peptidoglycan-synthesizing machinery (a.o. PBP2). This notion is supported by the virtually identical time scale at which cells change from rod to sphere after the addition of either A22 or mecillinam.

It should be emphasized that our experiments bear on the putative role of MreB in DNA segregation in E. coli. Because of the potential differences between MreBs from various bacterial species we do not wish to extrapolate our conclusions to C. cresentus or B. subtilis, although in the latter case some controversy exists (Formstone and Errington, 2005; Defeu Soufo and Graumann, 2006). In any case if one would wish to identify a dedicated ‘protein machine’ for E. coli DNA segregation, MreB does not seem an appropriate candidate.

Experimental procedures

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

Bacterial strains and growth conditions

Escherichia coli K12 cells were grown to steady state in glucose minimal medium containing 6.33 g of K2HPO4·3H2O, 2.95 g of KH2PO4, 1.05 g of (NH4)2SO4, 0.10 g of MgSO4·7H2O, 0.28 mg of FeSO4·7H2O, 7.1 mg of Ca(NO3)2·4H2O, 4 mg of thiamine, 4 g of glucose and 50 μg of required amino acids per litre pH 7.0 at 28°C or in rich medium [10 g of bactotryptone, 5 g of yeast extract, 5 g of NaCl, 15 mmol NaOH per litre (TY)]. LMC500 requires Lys for growth in minimal medium (Table 1). Spherical growth was achieved by specific inhibition of MreB by A22 (Iwai et al., 2004) at 10–20 μg ml−1 or of PBP2 (Sykes and Bonner, 1985) by 2 μg ml−1 mecillinam (Park and Burman, 1973; Den Blaauwen et al., 2003) and further growth for 0.5 up to 3 MD in the presence of the antibiotic before harvesting the cells for phase contrast imaging and immunofluorescence labelling. LMC1426 contains the lacO array cassette at 1 min from oriC in the chromosome (Gordon et al., 1997) transformed with the mKO–lacI fusion plasmid pSA053. LMC1426 was grown in TY at 28°C to an OD450 of 0.5 and subsequently the expression of mKO–LacI was induced for 20 min with 0.1% arabinose. Cells were fixed and harvested for fluorescence microscopy imaging as described below.

Table 1.  Bacterial strains and plasmids.
Strain/plasmidRelevant characteristicReference/source
E. coli strain
 BL21(DE3)/pLysSF, ompT, hsdsB (rB, mB), gal, dcm(DE3), CmRNovagen
 LMC500 (MC4100)F, araD139, Δ(argF-lac)U169deoC1, flbB5301, ptsF25, rbsR, relA1, rpslL150, lysA1Taschner et al. (1988)
 PA340F, argH1, thr-1, leuB6, gdH1, hisG1, gltB3, thi-1, lacY1, gal-6, Xyl-7, ara-14, Mtl-2, malA1, rspL9, tonA2Wachi et al. (1987)
 PA340-129PA340 gltB+mreB-129Wachi et al. (1987)
 PA340-678PA340 gltB+Δmre-678Wachi et al. (1987)
 LMC2308PA340-678 pTB016, pMEW1This work
 LMC1426SG102 = SG101 Kan-R [Tn7-lacOcassette in attTn784Gordon et al. (1997)
 DH5αSupE44,ΔlacU169 (φ80lacZΔM15) hsdR17, recA1, endA1, gyrA96, thi-1, relA1Hanahan (1983)
 MC1061FlD(araA-leu)7697 araD139 D(codB-lac)3=Dlac74 galK16 galE15 mcrA0 relA1 rpsL150 spoT1 mcrB9999 hsdR2Casadaban and Cohen (1980)
Plasmid
 pRMV1pET28a vector with NheI–BamHI mreB PCR product inserted expressing (his)6-MreBThis work
 pSA053Plasmid derivative of pSA052 expressing mKO–LacIThis work
 pSA052Basis vector with pBad arabinose-inducible promoter, mKO and adjusted multiple cloning site for C-terminal fusions to mKO (pBad-mKO-MCS)This work
 pGEMmKO#1Cloning vector based on pGEM-T with mKO clone containing 2 for expression in E. coli-improved codonsThis work
 pTB016pTHV038 (Den Blaauwen et al., 2003) with EcoRI–HindIII PCR fragment of mreB encoding GFPmut2-(x)23-MreB, AmpRThis work
 pMEW1pMW218 with KpnI–HindIII fragment from pMEG1 with the mreC and mreD genes, KmRM. Wachi

Absorbance was measured at 450 nm with a 300-T-1 spectrophotometer (Gilford Instrument Laboratories). Cell numbers were monitored using an electronic particle counter (orifice 30 μm). Cultures were considered to be in steady state of growth when the ratio between optical density and number of cells remained constant over time (Fishov et al., 1995).

Plasmid construction

To construct the His–MreB fusion, the coding sequence was amplified from the E. coli chromosome using the following primers: mreB1 (which introduced an NdeI restriction site overlapping with the mreB initiation codon 5′-GGAATTCCATATGTTGAAAAAATTTCGTGGC-3′) and mreB2 (which contains a BamHI restriction site 5′-CGCGGATCCATTACTCTTCGCTGAACAGGT-3′). The PCR product was digested with NdeI and BamHI and cloned into the vector pET28a (Novagen) to yield plasmid pRMV1.

MKO (Karasawa et al., 2004) was PCR amplified from pmKO1-S1 (SANBIO b.v.) using the primer pair BgNcoI mKO Fw (CAGATCTAGCCATGGTGAGTGTGATTAAACC AGAGATG) and mKO EcXbHiXh Rv (TCTCGAGAAGCTTATCTAGAGAATTCG GAATGAGCTACTGCATCTTCTACC). The PCR product was directly cloned into pGEM®-T Vector (Promega) and was confirmed by sequencing (AMC DNA sequencing facility, Amsterdam). One of the sequenced clones pGEMmKO#1 contained two silent mutations improving the codon usage Gln136(CAA-CAG) and Asp141(GAT-GAC). pSA052 was obtained by subcloning mKO from pGEMmKO#1 into EcoRI and NcoI sites of pBAD/myc-HisA (Invitrogen) and pSA053 (bearing the mKO–LacI fusion) was consequently created by subcloning the EcoRI–SalI fragment of pSG20 (lacI) (Gordon et al., 1997) into the corresponding sites of pSA052.

For the localization studies, E. coli MreB was expressed as N-terminal GFP fusion protein. A linker consisting of 23 amino acids separated the GFP and the N-terminus of the MreB protein. Genomic DNA or plasmid DNA was PCR amplified using pfu DNA polymerase (Stratagene, La Jolla) and the following primers: MreBF: 3′-GCG GAA CGA ATT CAA CAA CAA CGT TGG TAA AGT AAG CGG ATT TTC TTT TCC GCC CC-5′ and MreBR 3′-CCT GTG GCC AAG CTT ACT CTT CGC TGA ACA GGT CGC CGC CG-5′. PCR fragments were digested with EcoRI/HindIII and ligated into cleaved pTHV038 vector. This vector is a pTRC99A with a weakened promoter as described by Chen et al. (1999) in which GFPmut2 (Cormack et al., 1996) has been cloned (Table 1). Cells of various strains were transformed and produced GFP–MreB without induction with IPTG if not specifically mentioned.

Expression and purification of wild-type His–MreB

Escherichia coli strain BL21(DE3)/pLysS was transformed with the plasmid pRMV1 that expresses His–MreB. This strain was grown at 37°C in LB supplemented with 50 μg ml−1 kanamicin and chloramphenicol to an optical density at 600 nm of 0.4, and expression of the protein was induced with 1 mM IPTG. Growth was continued for 3 h. Cells were harvested by centrifugation and re-suspended in ice-cold buffer A (20 mM TrisHCl, 500 mM NaCl, 5 mM Imidazole, pH 7.8). The bacteria were lysed by sonication and centrifugated for 30 min at 20.000 g at 4°C (Sorvall SA-300 rotor). The His-tagged protein recovered in the supernatant was purified by Ni-affinity chromatography using His-Bind resin (Novagen) equilibrated with buffer A. The protein was eluted with a stepwise increasing concentration of imidazole ranging from 50 to 200 mM in a 20 mM TrisHCl and 500 mM NaCl, pH 7.8, buffer. Integrity and purity of the protein was checked by sodium dodecyl sulphate 12% polyacrylamide electrophoresis (SDS-12%PAGE). Protein was quantified by the method of Bradford with a commercial assay kit (Bio-Rad). The fraction eluted at 200 mM had the highest purity (> 98%). This fraction was used for rabbit immunization and antibody production.

Quantification of the number of MreB molecules per cell

For the quantification of MreB, exponential cultures of E. coli MC1061 grown in LB at 37°C were collected at an optical density at 600 nm of 0.2–0.3 and cultures of LMC500 were grown to steady state in GB1 at 28°C and collected at an optical density at 450 nm of 0.2. A portion was fixed with formaldehyde for particle counting, and another portion was centrifuged, re-suspended in lysis buffer and heated to 100°C for 5 min. Quantification was determined by SDS-PAGE and immunoblotting. The gel included extracts from independently grown and harvested cultures in triplicate and a series of standards with known amounts of purified His-tagged MreB. The blots were developed by the BM-Chemoluminescence blotting substrate (POD) from Roche, and the amount of MreB in the cell extracts was densitometricaly determined using the bands that contained a concentration range of purified MreB for calibration.

Fixation and permeabilization

Cells were fixed in 2.8% formaldehyde (FA) and 0.04% glutaraldehyde (GA) in growth medium for 15 min at room temperature. The cells were collected at 8000 g, for 5 min, washed once in PBS (140 mM NaCl, 27 mM KCl, 10 mM Na2HPO4·2H2O, 2 mM KH2PO4 pH 7.2) and re-suspended in water for imaging. For immunolabelling the fixed cells were re-suspended in 0.1% Triton X-100 in PBS and incubated for 45 min at room temperature. All subsequent centrifugations were performed at 4500 g. The cells were washed three times in PBS and incubated in PBS containing 100 μg ml−1 lysozyme and 5 mM EDTA for 45 min at room temperature. Finally the cells were washed three times in PBS.

Immunolocalization experiments

Non-specific binding sites were blocked by incubating the cells in 0.5% (w/v) blocking reagents (Boehringer) in PBS for 30 min at 37°C. Incubation with affinity-purified polyclonal antibodies against MreB diluted in blocking buffer was carried out for 60 min at 37°C. The cells were washed three times with PBS containing 0.05% (v/v) Tween-20. Incubation with secondary antibodies, Donkey anti-rabbit conjugated with Cy3 (Jackson), diluted in blocking buffer was carried out for 30 min at 37°C. The cells were washed again three times in PBS, 0.05% Tween-20. The cells were washed once in PBS and re-suspended in PBS.

Microscopy and image analysis

Cells were immobilized on 1% agarose in water slabs-coated object glasses as described by Koppelman et al. (2004) and photographed with a CoolSnap fx (Photometrics) CCD camera mounted on an Olympus BX-60 fluorescence microscope through a UPLANFl 100x/1.3 oil objective (Japan). Images were taken using the public domain program ‘Object-Image2.19 by Norbert Vischer (University of Amsterdam, http://simon.bio.uva.nl/object-image.html), which is based on NIH Image by Wayne Rasband. In all experiments the cells were first photographed in the phase contrast mode, then with the Cy3 (U-MNG, ex. 530–550 nm), or with the GFP 488 filter (U-MNB, ex. 470–490 nm). The two photographs were stacked, the length and diameter of the cells were determined from the phase contrast images and the localization and intensity of the fluorescence signal was analysed in the fluorescence images of bacteria as described (Den Blaauwen et al., 2003). All marking was performed with non-destructive vector overlay with the program Object-Image, which can be downloaded free from: http://simon.bio.uva.nl.

Flow cytometry

To determine the number of origins per cell by flow cytometry LMC500 cells were grown in GB1 medium. Transition of the cells from rod to sphere was induced by treating the cells with A22 (10 μg ml−1) or mecillinam (2 μg ml−1) respectively. After 1 and after 2 MD the number of origins per cell was determined by flow cytometry in culture samples incubated with 300 μg ml−1 rifampicin (to prevent initiation of chromosome replication) and with 3.4 μg ml−1 cephalexin (to stop further cell division) for the analysis by flow cytometry. The flow cytometry was performed basically as described by Løbner-Olesen et al. (1989), using the Bryte (Bio-Rad) flow cytometer.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

The authors thank M. Wachi for the gift of PA340, PA340-129, PA340-678 and pMew1, and A. Wright for the gift of SG102. We thank N.O.E. Vischer for writing the object image macros for image analysis. This work was supported by a European FP6 STREP Grant ‘COBRA’ LSHM-CT-2003-503335 (A. Karczmarek), a Molecule to Cell Grant 805.47.200 (S. Alexeeva) and a Vernieuwingsimpuls Grant 016.001.024 (T. den Blaauwen) both of the Netherlands Organization for Scientific Research (N.W.O.).

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information
  • Adam, M., Damblon, C., Jamin, M., Zorzi, W., Dusart, V., Galleni, M., et al. (1991) Acyltransferase activities of the high-molecular-mass essential penicillin-binding proteins. Biochem J 279: 601604.
  • Bernander, R., Merryweather, A., and Nordstrom, K. (1989) Overinitiation of replication of the Escherichia coli chromosome from an integrated runaway-replication derivative of plasmid R1. J Bacteriol 171: 674683.
  • Bork, P., Sander, C., and Valencia, A. (1992) An ATPase domain common to prokaryotic cell cycle proteins, sugar kinases, actin and hsp70 heat shock proteins. Proc Natl Acad Sci USA 89: 72907294.
  • Bouet, J.Y., and Funnell, B.E. (1999) P1 ParA interacts with the P1 partition complex at parS and an ATP-ADP switch controls ParA activities. EMBO J 18: 14151424.
  • Carballido-Lopez, R. (2007) The bacterial actin-like cytoskeleton. Microbiol Mol Biol Rev 70: 888909.
  • Casadaban, M.J., and Cohen, S.N. (1980) Analysis of gene control signals by DNA fusion and cloning in Escherichia coli. J Mol Biol 138: 179207.
  • Chen, J.C., Weiss, D.S., Ghigo, J.-M., and Beckwith, J. (1999) Septal localization of FtsQ, an essential cell division protein in Escherichia coli. J Bacteriol 181: 521530.
  • Cormack, B.P., Valdivia, R.H., and Falkow, S. (1996) FACS-optimized mutants of the green fluorescent protein (GFP). Genes Dev 173: 3338.
  • Defeu Soufo, H.J., and Graumann, P.L. (2004) Dynamic movement of actin-like proteins within bacterial cells. EMBO Rep 5: 789794.
  • Defeu Soufo, H.J., and Graumann, P.L. (2006) Dynamic localization and interaction with other Bacillus subtilis actin-like proteins are important for the function of MreB. Mol Microbiol 62: 13401356.
  • Den Blaauwen, T., Aarsman, M.E.G., Vischer, N.O.E., and Nanninga, N. (2003) Penicillin binding protein PBP2 of Escherichia coli localizes preferentially in the lateral wall and at mid cell in comparison with the old cell pole. Mol Microbiol 47: 539547.
  • Den Blaauwen, T., Aarsman, M.E.G., Wheeler, L., and Nanninga, N. (2006) Pre-replication assembly of E. coli replisome components. Mol Microbiol 62: 695708.
  • Ebersbach, G., and Gerdes, K. (2005) Plasmid segregation mechanisms. Annu Rev Genet 39: 453479.
  • Ebersbach, G., Ringgaard, S., Moller-Jensen, J., Wang, Q., Sherratt, D.J., and Gerdes, K. (2006) Regular cellular distribution of plasmids by oscillating and filament-forming ParA ATPase of plasmid pB171. Mol Microbiol 61: 14281442.
  • Van Den Ent, F., Amos, L.A., and Lowe, J. (2001) Prokaryotic origin of the actin cytoskeleton. Nature 413: 3944.
  • Esue, O., Wirtz, D., and Tseng, Y. (2006) GTPase activity, structure, and mechanical properties of filaments assembled from bacterial cytoskeleton protein MreB. J Bacteriol 188: 968976.
  • Figge, R.M., Divakaruni, A.V., and Gober, J.W. (2004) MreB, the cell shape-determining bacterial actin homologue, co-ordinates cell wall morphogenesis in Caulobacter crescentus. Mol Microbiol 51: 13211332.
  • Fishov, I., Zaritsky, A., and Grover, N.B. (1995) On microbial states of growth. Mol Microbiol 15: 789794.
  • Formstone, A., and Errington, J. (2005) A magnesium-dependent mreB null mutant: implications for the role of mreB in Bacillus subtilis. Mol Microbiol 55: 16461657.
  • Gitai, Z., Dye, N., and Shapiro, L. (2004) An actin-like gene can determine cell polarity in bacteria. Proc Natl Acad Sci USA 101: 86438648.
  • Gitai, Z., Dye, N.A., Reisenauer, A., Wachi, M., and Shapiro, L. (2005) MreB actin-mediated segregation of a specific region of a bacterial chromosome. Cell 120: 329341.
  • Gordon, G.S., Sitnikov, D., Webb, C., Teleman, A., Straight, A., Losick, R., et al. (1997) Chromosome and low copy plasmid segregation in E. coli: visual evidence for distinct mechanisms. Cell 90: 11131121.
  • Hanahan, D. (1983) Studies on transformation of Escherichia coli with plasmids. J Mol Biol 166: 557580.
  • Hu, B., Yang, G., Zhao, W., Zhang, W., and Zhao, J. (2007) MreB is important for cell shape but not for chromosome segregation of the filamentous cyanobacterium Anabaena sp. PCC 7120. Mol Microbiol 63: 16401652.
  • Iwai, N., Nagai, K., and Wachi, M. (2002) Novel S-benzylisothiourea compound that induces spherical cells in Escherichia coli probably by acting on a rod-shape-determining protein(s) other than penicillin-binding protein 2. Biosci Biotechnol Biochem 66: 26582662.
  • Iwai, N., Ebata, T., Nagura, H., Kitazume, T., Nagai, K., and Wachi, M. (2004) Structure-activity relationship of S-benzylisothiourea derivatives to induce spherical cells in Escherichia coli. Biosci Biotechnol Biochem 68: 22652269.
  • Jacob, F., and Brenner, S. (1963) [On the regulation of DNA synthesis in bacteria: the hypothesis of the replicon.] C R Hebd Seances Acad Sci 256: 298300.
  • Jones, L.J.F., Carbadillo-López, R., and Errington, J. (2001) Control of cell shape in bacteria: helical, actin-like filaments in Bacillus subtilis. Cell 104: 913922.
  • Karasawa, S., Araki, T., Nagai, T., Mizuno, H., and Miyawaki, A. (2004) Cyan-emitting and orange-emitting fluorescent proteins as a donor/acceptor pair for fluorescence resonance energy transfer. Biochem J 381: 307312.
  • Kim, S.Y., Gitai, Z., Kinkhabwala, A., Shapiro, L., and Moerner, W.E. (2006) Single molecules of the bacterial actin MreB undergo directed treadmilling motion in Caulobacter crescentus. Proc Natl Acad Sci USA 103: 1092910934.
  • Koppelman, C.M., Aarsman, M.E., Postmus, J., Pas, E., Muijsers, A.O., Scheffers, D.J., et al. (2004) R174 of Escherichia coli FtsZ is involved in membrane interaction and protofilament bundling, and is essential for cell division. Mol Microbiol 51: 645657.
  • Kruse, T., and Gerdes, K. (2005) Bacterial DNA segregation by the actin-like MreB protein. Trends Cell Biol 15: 343345.
  • Kruse, T., Moller-Jensen, J., Lobner-Olesen, A., and Gerdes, K. (2003) Dysfunctional MreB inhibits chromosome segregation in Escherichia coli. EMBO J 22: 52835292.
  • Kruse, T., Bork-Jensen, J., and Gerdes, K. (2005) The morphogenetic MreBCD proteins of Escherichia coli form an essential membrane-bound complex. Mol Microbiol 55: 7889.
  • Kruse, T., Blagoev, B., Lobner-Olesen, A., Wachi, M., Sasaki, K., Iwai, N., et al. (2006) Actin homolog MreB and RNA polymerase interact and are both required for chromosome segregation in Escherichia coli. Genes Dev 20: 113124.
  • Løbner-Olesen, A., Skarstad, K., Hansen, F.G., Von Meyenburg, K., and Boye, E. (1989) The DnaA protein determines the initiation mass of Escherichia coli K-12. Cell 57: 881889.
  • Nanninga, N. (2001) Cytokinesis in prokaryotes and eukaryotes: common principles and different solutions. Microbiol Mol Biol Rev 65: 319333.
  • Norris, V. (1995) Hypothesis: chromosome separation in E. coli involves autocatalytic gene expression, transertion and membrane domain formation. Mol Microbiol 15: 785787.
  • Park, J.T., and Burman, L. (1973) FL-1060: a new penicillin with a unique mode of action. Biochem Biophys Res Commun 51: 863868.
  • Shih, Y.L., Kawagishi, I., and Rothfield, L. (2005) The MreB and Min cytoskeletal-like systems play independent roles in prokaryotic polar differentiation. Mol Microbiol 58: 917928.
  • Soufo, H.J., and Graumann, P.L. (2003) Actin-like proteins MreB and Mbl from Bacillus subtilis are required for bipolar positioning of replication origins. Curr Biol 13: 19161920.
  • Srinivasan, R., Mishra, M., Murata-Hori, M., and Balasubramanian, K. (2007) Filament formation of the Escherichia coli actin-related protein, MreB, in fission yeast. Curr Biol 17: 266272.
  • Sykes, R.B., and Bonner, D.P. (1985) Discovery and development of the monobactams. Rev Infect Dis 7: S579S593.
  • Taschner, P.E.M., Huls, P.G., Pas, E., and Woldringh, C.L. (1988) Division behaviour and shape changes in isogenic ftsZ, ftsQ, ftsA, pbpB, and ftsE cell division mutants of Escherichia coli during temperature shift experiments. J Bacteriol 170: 15331540.
  • Van Helvoort, J.M.L.M., and Woldringh, C.L. (1994) Nucleoid partitioning in Escherichia coli during steady-state growth and upon recovery from chloramphenicol treatment. Mol Microbiol 13: 577583.
  • Vinella, D., Joseleau-Petit, D., Thévenet, D., Bouloc, P., and D'Ari, R. (1993) Penicillin-Binding Protein 2 inactivation in Escherichia coli results in cell division inhibition, which is relieved by FtsZ overexpression. J Bacteriol 175: 67046710.
  • Wachi, M., Doi, M., Tamaki, S., Par, W., Nakajima-Iijima, S., and Matsuhashi, M. (1987) Mutant isolation and molecular cloning of mre genes, which determine cell shape, sensitivity to mecillinam, and amount of penicillin-binding proteins in Escherichia coli. J Bacteriol 169: 49354940.
  • Woldringh, C.L. (2002) The role of co-transcriptional translation and protein translocation (transertion) in bacterial chromosome segregation. Mol Microbiol 45: 1729.

Supporting Information

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

Fig. S1. Western blot analysis of affinity purified antiserum against MreB. Total cell extracts of PA340 and the mreBCD depletion strain PA340-678 cells were incubated with unpurified antiserum (A) or affinity purified antiserum (B).

Fig. S2. Growth of wild type (A) LMC500 cells in the presence of a series of A22 concentrations. LMC500 was grown in GB1 at 28°C with 0 (empty diamonds), 2 (diamonds), 5 (empty triangles), 20 (triangles), 30 (empty circles) 40 (circles), 50 (empty squares), and 100 (squares) µg/ml A22. Growth of PA340 (B) and mreBCD depletion strain PA340-678 cells in a presence of 0 (diamonds), 10 (circles), 50 (triangles) of 100 (squares) µg/ml A22. PA340 cells were grown in TY at 28°C.

FilenameFormatSizeDescription
MMI_5777_sm_FiguresS1-S2.pdf165KSupporting info item

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.