SEARCH

SEARCH BY CITATION

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Staphylococcus aureus is a leading cause of hospital-associated and, more recently, community-associated infections caused by highly virulent methicillin-resistant strains (CA-MRSA). S. aureus survival in the human host is largely defined by the ability to evade attacks by antimicrobial peptides (AMPs) and other mechanisms of innate host defence. Here we show that AMPs induce resistance mechanisms in CA-MRSA via the aps AMP sensor/regulator system, including (i) the d-alanylation of teichoic acids, (ii) the incorporation of lysyl-phosphatidylglycerol in the bacterial membrane and a concomitant increase in lysine biosynthesis, and (iii) putative AMP transport systems such as the vraFG transporter, for which we demonstrate a function in AMP resistance. In contrast to the aps system of S. epidermidis, induction of the aps response in S. aureus was AMP-selective due to structural differences in the AMP binding loop of the ApsS sensor protein. Finally, using a murine infection model, we demonstrate the importance of the aps regulatory system in S. aureus infection. This study shows that while significant interspecies differences exist in the AMP–aps interaction, the AMP sensor system aps is functional and efficient in promoting resistance to a variety of AMPs in a clinically relevant strain of the important human pathogen S. aureus.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Staphylococcus aureus is a dangerous human pathogen that may cause severe diseases such as bacteraemia, toxic shock syndrome, scalded skin syndrome and endocarditis (Lowy, 1998). Traditionally, infections with S. aureus occurred exclusively in hospitalized and predisposed, e.g. immunocompromised, patients. However hyper-virulent strains of S. aureus have recently emerged that are resistant to antibiotics and may infect healthy adults outside the hospital setting (community-associated methicillin-resistant S. aureus, CA-MRSA), thus posing an even more severe threat to the public health system (Chambers, 2005). These strains are now by far the most common cause of skin and soft tissue infections reporting to the emergency department in the USA (Moran et al., 2006).

While the role of acquired immunity in prolonged staphylococcal infection is not well understood, the innate immune system clearly plays a major part in determining the outcome of an S. aureus infection (Komatsuzawa et al., 2006). Neutrophils (or polymorphonuclear leucocytes) form the central part of innate host defence, and their key role in combating S. aureus can be seen, for example in the significantly impaired defence to S. aureus infection in patients with chronic granulomatous disease (Lekstrom-Himes and Gallin, 2000). Neutrophils ingest invading bacteria and subsequently kill them by the combined activity of reactive oxygen species and antimicrobial proteins and peptides (Faurschou and Borregaard, 2003). Antimicrobial peptides (AMPs) form an evolutionarily conserved mechanism of innate host defence and are found in many groups of organisms, including amphibians, insects and other invertebrates. More recent research indicates that human AMPs have a much more important role in preventing infection than previously suspected (Hancock and Diamond, 2000). Notably, AMPs are also secreted by human epithelia and thus play a key role not only in eliminating invading S. aureus, but also in controlling colonization on the human skin and mucosal surfaces (Harder and Schroder, 2005).

The importance of AMPs in defending the human body from bacterial infection is reflected by the many mechanisms of resistance that human pathogenic bacteria have developed to cope with AMPs (Peschel and Sahl, 2006). These mechanisms include: alterations of the bacterial cell surface charge, which is aimed to decrease binding of the commonly cationic AMPs; proteolytic inactivation by secreted exoproteases; and AMP transporters that remove the AMPs from the bacterial cell and membrane.

Most likely because the constitutive production of molecules involved in resistance mechanisms represents a significant energetic burden to the bacteria, their expression is limited to times when AMPs are present. To that end, bacteria have regulatory mechanisms that sense the presence of AMPs and control the expression of resistance genes. In Gram-negative bacteria, a two-component system named PhoP/PhoQ senses cationic AMPs and, for example, controls the incorporation of aminoarabinose in lipid A, thereby preventing attachment of cationic AMPs (Bader et al., 2005). Very recently, we have discovered that the corresponding AMP sensing and gene regulatory task in the Gram-positive pathogen Staphylococcus epidermidis is performed by an unrelated three-component sensor/regulator, composed of a classical two-component histidine kinase/response regulator (ApsR, ApsS) and a third protein of unknown function (ApsX) (Li et al., 2007). The presence of similar genetic loci in other Gram-positive bacteria, including S. aureus, suggested that the aps system represents a widespread mechanism for AMP sensing and the regulation of AMP-resistance mechanisms. Therefore, here we investigated the role of the aps system in the induction of AMP-resistance mechanisms in S. aureus. We provide evidence for aps functionality in this important human pathogen in vitro and in vivo and describe significant differences compared with the prototype system of S. epidermidis.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Induction of AMP-resistance mechanisms in S. aureus MW2 is AMP-selective

To test whether AMPs induce resistance mechanisms in S. aureus, we used the interaction between human beta defensin 3 (hBD3) (Harder et al., 2001) and strain MW2, a prototype community-associated MRSA strain (Anonymous, 1999), as example. The AMP hBD3 was selected because it is a key component of innate host defence on human epithelia and a strong inducer of AMP-resistance mechanisms in S. epidermidis (Harder and Schroder, 2005; Li et al., 2007). We determined, by quantitative reverse transcription polymerase chain reaction (RT-PCR), the induction of three genes, dltB, vraF and mprF, representing the three main AMP-resistance mechanisms found to be under hBD3-inducible control in S. epidermidis (Li et al., 2007). The dlt operon is responsible for the d-alanylation of teichoic acids, a mechanism aimed to decrease the overall negative charge of the bacterial cell surface and thus the attraction of cationic AMPs (Peschel et al., 1999; Peschel, 2002); the MprF enzyme catalyses the lysinylation of phosphatidylglycerol, preventing the binding of cationic AMPs to the cytoplasmic membrane (Peschel et al., 2001). The vraFG genes code for a transporter also likely involved in AMP resistance (Li et al., 2007). Surprisingly, we did not detect induction of the dltB gene with hBD3, even when we increased the concentration to 100 μg ml−1, corresponding to 10 times that previously used for S. epidermidis (Fig. 1A). Further, there was no significant increase of mprF expression with increasing concentrations of hBD3, and significantly increased expression of vraF only at the high concentrations of 50 and 100 μg ml−1 hBD3. To rule out that this lack of induction was due to proteolytic degradation of hBD3 in our test system, we determined the stability of hBD3 under the tested conditions with S. aureus MW2. However, no differential induction of dltB with and without hBD3 was found even within short incubation times, at which no considerable degradation of hBD3 was observed (Fig. 1B and C). These findings indicated that hBD3 is a much weaker inducer of the aps response in S. aureus MW2 compared with S. epidermidis.

image

Figure 1. Induction of AMP-resistance mechanisms in S. aureus MW2 by AMPs. A. Relative transcription level of the dLtB, mprF and vraF genes upon addition of increasing concentrations of the AMP hBD3, quantitative RT-PCR. B. Stability of the hBD3 peptide under the conditions used in the assay performed in (A) and (C) with S. aureus MW2. C. Relative transcription levels (by quantitative RT-PCR) of the dLtB gene in S. aureus MW2 with and without addition of 20 μg ml−1 hBD3 at different incubation time points. D. Relative transcription levels (by quantitative RT-PCR) of the dLtB gene in S. aureus MW2 upon addition of different AMPs at 2 μMol l−1. In (A) and (D), **P < 0.01, ***P < 0.001. Calculations of statistical significance are versus the corresponding data without addition of AMP.

Download figure to PowerPoint

Prompted by the severely impaired induction of the dltB, vraF and mprF genes with hBD3 in S. aureus compared with S. epidermidis, we determined dltB expression under the influence of a series of AMPs at 2 μmol l−1 (which corresponds to ∼10 μg ml−1 for hBD3) (Fig. 1D). In addition to hBD3, the uncharged gramicidin and the anionic dermcidin and, notably, the cationic peptides histadin and magainin II failed to induce dltB expression. Among the peptides that we tested, only indolicidin, melittin, nisin and the human AMP LL-37 induced a significant increase in dltB expression. These results demonstrate that induction of the aps system in S. aureus MW2 is different from S. epidermidis and much more selective than described for that bacterium (Li et al., 2007).

Cationic AMPs induce AMP-resistance mechanisms and a concomitant metabolic adaptation in S. aureus MW2

To determine the gene regulatory response to cationic AMPs in S. aureus MW2, we selected the AMP indolicidin, an AMP of the cathelicidin family, because it showed the most significant influence on the expression of the dltB gene and in contrast to melittin, which also led to strong dltB induction, is of mammalian origin (Selsted et al., 1992) (Fig. 1D). We used whole-genome microarrays specific for the MW2 genome and analysed changes in gene expression with and without addition of 5 μg ml−1 (∼2 μMol l−1) indolicidin during mid-logarithmic growth (Table 1).

Table 1.  Gene regulatory responses upon addition of indolicidin in S. aureus wild-type and apsS deletion strains.
Gene numberGene product nameWild-type with/without indolicidinapsS with/without indolicidinWild-type/apsS (without indolicidin)Wild-type/apsS (with indolicidin)
  • a.

    Changes by a factor greater than 2 are in boldface.

MW0814d-alanylation of teichoic acids    
d-alanine-activating enzyme (DltA)2.16a1.150.861.61
MW0815Protein DltB2.911.250.912.13
MW0816d-alanyl carrier protein (DltC)3.031.140.992.33
MW0817Protein DltD precursor2.731.210.851.92
Lysinylation of phosphatidylglycerol    
MW1247Lysyltransferase (MprF or FmtC)4.901.281.285.00
Lysine biosynthesis (from aspartate)    
MW1281Aspartokinase (LysC)3.032.241.161.56
MW1282Aspartate-semialdehyde dehydrogenase (Asd)2.401.761.271.72
MW1283Dihydrodipicolinate synthase (DapA)2.301.861.201.49
MW1284Dihydrodipicolinate reductase (DapB)2.351.841.201.54
MW1285Tetrahydrodipicolinate N-acetyltransferase (DapD)2.451.751.061.49
ABC transporter (VraFG)    
MW0623Bacitracin transport ATP binding protein VraF14.171.061.8525.00
MW0624ABC transporter permease protein (VraG)13.511.021.4520.00
VraRS regulator and adjacent transporter    
MW1824Two-component response regulator VraR2.375.380.860.38
MW1825Two-component sensor protein VraS2.885.920.890.43
MW1826Transporter (similar to B. subtilis YvqF)4.1010.340.930.37
MW1827Hypothetical protein3.9910.270.880.34
ABC transporter    
MW2620Bacitracin transport ATP binding protein VraD9.843.761.183.13
MW2621ABC transporter permease protein VraE12.025.321.162.63
MW2622Hypothetical protein7.063.691.492.04
ABC transporter    
MW1871Hypothetical protein2.2312.690.590.10
MW1872ABC transporter ATP binding protein3.4315.460.550.12
MW1873Hypothetical protein2.8533.130.780.07
MW1874ABC transporter ATP binding protein4.1426.810.680.10
MW1875Transcriptional regulator, GntR family3.2423.210.710.10

The most pronounced changes under the influence of indolicidin comprised the upregulation of established mechanisms of AMP resistance. All genes in the dlt operon were upregulated about 3-fold. The mprF gene was upregulated about 5-fold. In addition, increased activity of the MprF enzyme was confirmed on the translational level: the relative portion of lysyl-phosphatidylglycerol (L-PG) in phospholipids was significantly higher, and that of phosphatidylglycerol accordingly significantly lower, upon addition of indolicidin to cells of S. aureus MW2 (Fig. 2A). Furthermore, we observed upregulation of the transcription of genes encoding the biosynthesis of lysine from aspartic acid via the diaminopimelic acid pathway (Fig. 2B). This metabolic change is most likely caused by the increased requirement for lysine due to its increased incorporation in phospholipids by the MprF enzyme.

image

Figure 2. AMP-dependent alterations in phospholipid and lysine biosynthesis of S. aureus MW2. A. Percentages of the three phospholipid types of S. aureus (L-PG; PG, phosphatidylglycerol; DPG, diphosphatidylglycerol) in wild-type S. aureus MW2 and isogenic aps-deletion strains with (+) and without (–) addition of inducing AMP (5 μg ml−1 indolicidin). Phospholipids were isolated as described in Experimental procedures, separated by thin-layer chromatography, visualized by staining with 5% H2SO4, and phospholipid spots were quantified by photo-digital densitometry. Data are means ± SEM of three independent measurements. *P < 0.05, ***P < 0.001, versus wild type (–). B. Influence of inducing AMP (5 μg ml−1 indolicidin) on lysine biosynthesis in S. aureus MW2. The diaminopimelate pathway of lysine biosynthesis from aspartate, the most common way to synthesize lysine in bacteria, is shown. Enzymes in black are known to be present in S. aureus MW2 based on the genome sequence (Baba et al., 2002), and those that were found to be induced are in grey-shaded boxes.

Download figure to PowerPoint

Further regulatory changes upon addition of indolicidin included the increased transcription of four transporter systems that may be involved in AMP resistance. The vraFG ABC transporter genes, which are situated next to the apsRSX regulatory system, and the vraDE ABC transporter genes, were strongly upregulated (about 10- to 15-fold). Two other ABC transporters systems were upregulated to a lower degree. The microarray results were confirmed by quantitative RT-PCR experiments with the dltB, vraF and mprF genes (Fig. 3). Taken together, these findings demonstrate that the gene regulatory response to the cationic AMP indolicidin in S. aureus comprises the upregulation of known and putative AMP-resistance mechanisms and, simultaneously, a metabolic adaptation to respond to the increased need for structural components of molecules involved in AMP resistance.

image

Figure 3. Aps-dependent induction of AMP resistance mechanisms. Relative transcription levels of AMP-induced genes in wild-type S. aureus MW2, isogenic aps-deletion, complemented and control strains, with and without addition of inducing AMP (5 μg ml−1 indolicidin). *P < 0.05, **P < 0.01, ***P < 0.001, samples without peptide.

Download figure to PowerPoint

The vraFG transporter is involved in AMP resistance

The VraDE and VraFG transporters are similar to bacitracin-resistance transporters, underpinning their likely involvement in the resistance to AMPs. Specifically, our previous and current data on aps control in S. epidermidis and S. aureus suggest that the VraFG transport system contributes to AMP resistance. To investigate this hypothesis, we produced an isogenic deletion mutant of the vraFG genes in strain MW2 and determined minimal inhibitory concentration (MIC) values to a series of AMPs (Table 2). Our results indicate an important role of the vraFG transporter in promoting resistance to cationic AMPs, but not the anionic dermcidin.

Table 2.  MICs (mg ml−1) of S. aureus wild-type MW2 and apsS and vraFG-deletion and complemented mutants to AMPs.
 MW2apsSapsS (pTXapsS)vraFGvraFG (pRBvraFG)
  1. ND, not determined.

hBD30.1020.0260.0640.032> 1.280
Nisin0.0320.0080.0120.0080.024
Indolicidin0.0960.0160.0320.0080.096
LL-370.2050.019ND0.013ND
Dermcidin1.2801.2801.2801.2801.280

The S. aureus MW2 aps system controls AMP resistance

To investigate whether the aps system of S. aureus is involved in mediating the gene regulatory response to cationic AMPs and determining altered resistance to AMPs, we constructed an isogenic deletion mutant of the apsS sensor in the CA-MRSA strain MW2. Using a variety of cationic AMPs and the anionic AMP dermcidin, MIC values (Table 2) and survival of the wild-type and isogenic apsS mutant strains in killing assays were determined (data not shown). We found significantly reduced resistance of the apsS mutant strain compared with the wild-type strain towards all cationic peptides, but not the anionic dermcidin, indicating that the aps system of S. aureus MW2 is involved exclusively in regulating resistance to cationic AMPs. Of note, we observed aps-dependent killing with all tested cationic AMPs, including hBD3, demonstrating that induction of and susceptibility to AMP-resistance mechanisms are clearly distinguished features of the AMP–bacteria interaction, inasmuch as the spectrum of AMPs to which aps-controlled target mechanisms provide resistance is broader than that of aps inducers.

Most of the AMP-induced gene regulatory response is mediated by aps

To determine the role of the aps system in the induction of gene regulatory changes in S. aureus to indolicidin and define the S. aureus aps regulon, we performed whole-genome microarray analysis with the MW2 apsS deletion and wild-type strain with or without addition of indolicidin (Table 1). As a main result of these experiments, we were able to distinguish two sets of cationic AMP (indolicidin)-regulated genes in S. aureus: those under aps control and those under the control of a yet-undefined regulatory mechanism. The first group contains the dlt genes, mprF, vraFG, and the lysine biosynthesis operon. Analysis of phospholipids by thin-layer chromatography with the apsS mutant compared with the isogenic S. aureus MW2 wild-type strain confirmed that the MprF-catalysed incorporation of L-PG is regulated by aps (Fig. 2A). The second group contains the aforementioned ABC transporter operons. The ABC transporter vraDE genes appear to be under the control of both aps and an unidentified regulator. Further, the MW1871–1875 ABC transporter operon is under positive control by cationic AMPs via an unknown mechanism, but under negative control by aps. Microarray results were confirmed by quantitative RT-PCR of wild-type and apsS mutant, and apsS-complemented and control strains (Fig. 3).

Differences in induction by cationic AMPs between S. aureus and S. epidermidis are due to structural changes in the ApsS sensor

The aps system is composed of three components, ApsS, ApsR and ApsX (Li et al., 2007). The protein that interacts with AMPs is ApsS. Specifically, a single, 9-amino-acid extracellular loop of ApsS with a high density of negative charges is responsible for AMP binding and induction. Interestingly, the amino acid composition of this loop differs significantly between S. aureus and S. epidermidis. Whereas the overall similarity between the ApsS proteins of S. aureus and S. epidermidis is 70%, this loop only shows 33% similarity (Fig. 4A). For example, a serine residue found in the ApsS extracellular loop of S. epidermidis is replaced by a proline in S. aureus. As proline residues cause bends in polypeptides, this probably leads to significant changes in the structure of the S. aureus versus the S. epidermidis AMP binding loop. To confirm the hypothesis that the differences in induction of dltB expression between S. aureus and S. epidermidis are due to differences in ApsS, we complemented the apsS mutant of S. aureus MW2 with apsS of S. epidermidis and determined expression under the influence of different concentrations of hBD3. The S. aureus apsS mutant with heterologously expressed S. epidermidis apsS showed increased dltB expression upon addition of hBD3 (Fig. 4B) similar to the S. epidermidis wild type (Li et al., 2007), demonstrating that ApsS is responsible for the differences in induction seen between S. aureus and S. epidermidis. In a control experiment, complementation with the S. aureus apsS gene did not result in significant changes in hBD3 inducibility (data not shown). Moreover, to pinpoint the differences in induction to the AMP interaction loop of ApsS, we constructed a plasmid that expressed a hybrid protein consisting of the ApsS protein of S. aureus with the extracellular loop of S. epidermidis. This plasmid restored apsS inducibility by hBD3 in the MW2 apsS mutant (Fig. 4B), demonstrating that the differences in AMP induction are due to the structural changes compared with S. epidermidis in this part of the S. aureus ApsS protein.

image

Figure 4. The extracellular loop of the ApsS sensor protein is responsible for the specificity of AMP induction. A. Alignment of ApsS sequences of S. aureus MW2 and S. epidermidis (RP62A), showing conserved amino acid positions in black, similar in orange, and divergent in red. The extracellular loop known to interact with AMPs (Li et al., 2007) is boxed. B. Relative transcription levels (by quantitative RT-PCR) of the dltB gene in the S. aureus MW2 aps mutant strain with heterologous complementation by the apsS gene of S. epidermidis, or the S. aureus apsS hybrid gene with the extracellular loop derived from S. epidermidis, in comparison with the S. aureus MW2 wild-type strain. *P < 0.05, **P < 0.01, ***P < 0.001; all versus the corresponding values without addition of hBD3. Values from samples without hBD3 addition were set to 100% to compare data from different experiments. Statistical analysis was performed on the raw data.

Download figure to PowerPoint

The aps system is important for S. aureus virulence in vivo

To investigate whether control of AMP-resistance mechanisms by the aps system is important for S. aureus survival during infection, we compared the wild-type and apsS-deletion strains in a peritoneal infection model. Progression of disease was measured by determining the bacterial load in the kidneys after death. We detected a significantly reduced infectivity of the apsS mutant strain (Fig. 5), indicating that the aps system contributes to pathogen survival during S. aureus infection.

image

Figure 5. Murine infection model. S. aureus strains were grown to mid-exponential phase, washed twice with sterile PBS, resuspended in PBS at 1 × 108 cfus per 100 μl, and each mouse was injected intraperitoneally with 2 × 108 cfus of live S. aureus in 0.2 ml PBS. Control animals received 0.2 ml PBS only. After inoculation, animal health and disease advancement were monitored every 3 h for the first 24 h, then every 8 h for up to 72 h. At the time of death, two kidneys were removed, weighed, homogenized and the cfu per 100 mg kidney were determined. The horizontal line represents the mean. *P < 0.05 versus wild-type.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Sensing AMPs and reacting with effective countermeasures is important for the survival especially of commensal microorganisms living on human mucosal and epithelial surfaces, where AMPs represent a key mechanism of host defence (Harder and Schroder, 2005). Therefore, AMP sensors that control the expression of target AMP-resistance mechanisms, such as the Gram-negative PhoP/PhoQ system discovered in Salmonella typhimurium (Miller et al., 1989; Bader et al., 2005), and the Gram-positive aps system discovered in S. epidermidis (Li et al., 2007), have been proposed as targets for antimicrobial drug development due to their pivotal role in host–pathogen interaction (Brodsky and Gunn, 2005). An aps homologue of S. aureus has been described previously to be important for vancomycin resistance (Kuroda et al., 2000), partially via control of the vraFG transporter genes (Meehl et al., 2007). The system was named graRS, failing to recognize its three-component nature. In addition, a recent study has investigated the graRS regulon in S. aureus strain SA113 (Herbert et al., 2007). However, the detailed in vitro and in vivo roles of aps in Gram-positive bacteria other than the relatively innocuous S. epidermidis have not been analysed. Therefore, we determined here whether and to what extent aps controls AMP resistance and the expression of resistance mechanisms in S. aureus, specifically in the hyper-virulent community-associated MRSA strain MW2, and whether control by aps is crucial for pathogen success during infection.

First, we investigated whether AMP-resistance mechanisms in S. aureus are inducible by AMPs. To our surprise, we found that common AMP-resistance mechanisms, which are under inducible control in S. epidermidis (Li et al., 2007), were not inducible by the important human epithelial AMP hBD3 in S. aureus, or only to a very limited degree. Subsequently, we analysed a series of peptides and found that AMPs can be grouped into inducers and non-inducers of AMP-resistance mechanisms in S. aureus. There was no clear correlation of inducer function with the intensity of positive charge or secondary structure type. Rather, we found that functionality of an AMP as an inducer is determined by the ApsS extracellular AMP-sensing loop in a molecular interaction that certainly warrants further investigation.

The AMP-induced gene regulatory response in S. aureus was similar to that detected in S. epidermidis (Li et al., 2007), but included additional ABC transporter systems potentially involved in the removal of AMPs from the cell. Most AMP-inducible AMP-resistance mechanisms, including the dlt, mprF and vraFG genes, were found to be under aps control. However, the relative degree of upregulation was different compared with S. epidermidis. While the dlt operon was the most strongly upregulated target in S. epidermidis (Li et al., 2007), S. aureus MW2 controlled expression of the mprF and, especially, vraFG genes in response to AMPs in a more pronounced way, indicating significant differences in the aps regulons of the two species. Furthermore, the transcriptional profiling experiments revealed the presence of at least one additional yet-undefined mechanism of AMP sensing that regulates a series of ABC transporters probably involved in AMP resistance, including VraDE. Moreover, upregulation of lysine biosynthesis via the diaminopimelic acid pathway, the most common way of producing lysine in bacteria (Patte, 1994), indicated that the MprF-catalysed production of L-PG is accompanied by a metabolic shift to respond to the altered lysine requirements. The strong influence of aps in strain MW2 on the expression of mprF contrasts findings by Herbert et al. (2007), who did not discover regulation of mprF by aps (graRS) in S. aureus strain SA113. Thus, there appear to be strain-specific differences in the aps regulon among S. aureus strains. These may be linked to the known deficiency of strain SA113 in the important global regulator agr (Vuong et al., 2000) and the interaction of aps (graRS) with a series of global regulators described in that study (Herbert et al., 2007).

Initially described as important for resistance to the antibiotic vancomycin (Kuroda et al., 2000), the role of the VraFG transporter in AMP resistance has remained speculative. We demonstrate here for the first time that the VraFG transporter is involved in promoting resistance to AMPs. Interestingly, VraFG only conferred resistance to cationic AMPs, similar to the other main AMP-resistance mechanisms regulated by aps, thus underpinning the specificity of the aps gene regulatory response and target mechanisms for cationic AMPs.

Finally, we demonstrate efficiency of the S. aureus MW2 aps system in facilitating resistance to a variety of cationic AMPs and pathogen survival during infection. Notably, the aps system mediated increased protection also from those peptides that were not, or only weak inducers of the system, indicating that induction and susceptibility to resistance mechanisms are unrelated features of the AMP–pathogen interaction. Taken together, while our study indicates significant interspecies differences in AMP induction and regulation of target mechanisms, it shows that the aps system is functional in S. aureus and particularly CA-MRSA, and has a crucial role during infection, thus establishing physiological importance in a key Gram-positive pathogen.

Experimental procedures

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Bacterial strains, growth conditions and chemicals

The bacteria and plasmids used are listed in Table 3. Escherichia coli DH5α and S. aureus RN4220 were used for cloning experiments. RN4220 was also used as a gateway strain prior to propagation of plasmids into target S. aureus strains. Bacteria were routinely grown in tryptic soy broth (TSB, Oxoid) medium with 0.25% glucose broth or agar plates at 37°C, unless otherwise indicated. Antibiotics were used at the following concentrations: ampicillin, 100 μg ml−1; chloramphenicol, 10 μg ml−1; and tetracycline, 12.5 μg ml−1. For microarray experiments, overnight cultures were diluted 1:100 into 50 ml of TSB and incubated at 37°C with shaking at 180 r.p.m. until grown to an OD600 of 2.5–3.0 (mid-logarithmic growth phase). Cultures were then split into two equal volumes, and cells were washed twice in 10 mM sodium phosphate buffer (pH 6.5) with 100 mM NaCl and resuspended in the same buffer. To one sample, the AMP indolicidin was added to a final concentration of 5 μg ml−1. Samples were incubated at 37°C for 1 h. Dermcidin (in its active, processed form, DCD-1 l) and hBD3 were synthesized by the Peptide Synthesis Unit, Research Technologies Branch, NIAID. Gramicidin D and nisin were purchased from Sigma. All other AMPs were purchased from GenScript Corporation.

Table 3.  Bacterial strains and plasmids used in this study.
Strains/plasmidsRelevant genotype and propertySource/reference
Strain
 S. aureus
  RN4220Derived from NCTC8325-4; r- m+Kreiswirth et al. (1983)
  MW2CA-MRSA standard wild-type strain, clinical isolateAnonymous (1999)
  MW2 apsSapsS gene-deletion mutant of MW2This study
  MW2 vraFGvraFG gene-deletion mutant of MW2This study
 E. coli
  DH5αendA1 recA1 gyrA96 thi-1 hsdR17(rK- mK+) relA1 supE44 (lacZYA-argF)U169 F-φ80 dlacZ M15 deoR phoAλ-Commercial (Invitrogen)
Plasmid
 pKOR1cmR and ampR, temperature-sensitive vector for allelic replacement via lambda recombination and ccdB selectionBae and Schneewind (2006)
 pKOR1apsSVector for allelic replacement of apsSThis study
 pKOR1vraFGVector for allelic replacement of vraFGThis study
 pTX15A staphylococcal expression vector that harbours a xylose-inducible promoterPeschel et al. (1996)
 pTX16Derived from pTX15 by deletion of the lipase gene downstream of the xylose-inducible promoter.Peschel et al. (1996)
 pTXapsSDerived from pTX15 by insertion of the MW2 apsS gene between the BamHI and MluI sites in place of the lipase gene fragmentThis study
 pTXapsS(Se loop)Derived from pTX15 by insertion of the hybrid apsS gene between the BamHI and MluI sitesThis study
 pT181mcspT181 (Khan et al., 1981) with multiple cloning site of pUC19 (PvuII fragment) cloned in NdeI siteSeeber et al. (1990)
 pTapsS(Se)pT181mcs with S. epidermidis apsS gene (under control of its natural promoter)Li et al. (2007)
 pRB473E. coli/Staphylococcus shuttle cloning plasmid, cmR and ampRBruckner (1997)
 pRBvraFGDerived from pRB473 by insertion of the MW2 vraF and vraG genesThis study

Microarray experiments

Total RNA was isolated using an RNeasy Mini Kit (Qiagen) as recommended in a standard protocol. In brief, cell pellets were washed with RNase-free water, resuspended in 700 μl of RLT buffer supplemented with,-mercaptoethanol (10 μl β-mercaptoethanol per 1 ml RLT). The bacterial suspension was transferred to a 2 ml FastPrep lysing tube (Q-BioGene). The cells were lysed in a Bio101 high-speed homogenizer (Savant Instruments), at the following setting: speed, 6.0; time, 20 s. The lysate was incubated on ice for 5 min and centrifuged at 15 000 r.p.m. at 4°C for 15 min. The supernatant was collected and diluted with 500 μl of 100% ethanol. Samples were mixed and transferred to an RNeasy mini column. RNA isolation was performed according to the manufacturer's instructions. Remaining DNA was removed using RNase-free DNase I (Amersham Biosciences). Removal of contaminant DNA was confirmed by PCR. The reaction product was cleaned up with an RNeasy mini column. cDNA was synthesized and labelled according to the manufacturer's suggestions for Affymetrix antisense genome arrays (Affymetrix) as described (Li et al., 2007). A gel shift assay with NeutrAvidin (Pierce Biotechnology) was performed to estimate the labelling efficiency based on the instructions from Affymetrix. Biotinylated S. aureus cDNA was hybridized to custom Affymetrix GeneChips (RMLChip 3) with 96% coverage of genes from MW2 (2534 probe sets of 2632 ORFs) and scanned according to standard GeneChip protocols (Affymetrix). Each experiment was replicated at least three times. Affymetrix GeneChip Operating Software (GCOS v1.4, http://www.affymetrix.com) was used to perform the preliminary analysis of the custom chips at the probe-set level. Subsequent data analysis was performed as described (Li et al., 2007). To be included in the final gene list, gene expression must have been changed at least 2-fold for one of the treatments. The complete set of microarray data was deposited in NCBIs Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo/) and is accessible through GEO Series accession number GSE8400.

Construction of isogenic apsS, vraFG-deletion mutant strains and complementation plasmids

To delete the apsS or vraFG genes in S. aureus MW2, ∼1 kb DNA fragments, upstream and downstream of apsS or vraFG respectively, were PCR amplified from the chromosomal DNA of S. aureus MW2 using the primers listed in Table 4. PCR products were digested with BamHI, and then mixed together and ligated by T4 DNA ligase (Roche). The ligation product with attB sites at the two ends was used for recombination with plasmid pKOR1, yielding plasmid pKOR1apsS or pKOR1vraFG respectively. The resulting plasmid was transferred via electroporation first to S. aureus RN4220 and then to S. aureus MW2. Allelic replacement mutations were selected as described by Bae and Schneewind (2006). The proper integration was verified by analytical PCR and sequencing of the genomic DNA at the borders of the PCR-derived regions. For genetic complementation of the apsS mutant, the apsS gene was PCR amplified from MW2 genomic DNA using the primers listed in Table 4 and cloned into the BamHI and MluI sites of BamHI/MluI-digested pTX15. For heterologous complementation with the S. epidermidis apsS gene, the previously described plasmid pTapsS (S. epidermidis) was used (Li et al., 2007), in which S. epidermidis apsS is cloned in the plasmid pT181mcs with its natural promoter. For construction of the apsS hybrid expression plasmid, the primer pairs p1–p2 and p3–p4 (Table 4) were used to generate 238 and 1003 bp PCR fragments respectively from MW2 genomic DNA, resulting in the incorporation of 27 bp corresponding to the S. epidermidis apsS extracellular loop. Purified PCR products of p1–p2 and p3–p4 were hybridized by overlap extension PCR using primer pair p5–p6 and cloned into the BamHI and MluI sites of BamHI/MluI-digested pTX15. For genetic complementation of the vraFG mutant, the vraFG genes were PCR amplified with the primers listed in Table 4; the PCR product was digested with EcoRI and BamHI, and cloned into EcoRI/BamHI-digested plasmid pRB473.

Table 4.  Oligonucleotides used in this study.
NameDNA sequence (5′−3′)
  • a.

    Underlined bases correspond to those encoding the S. epidermidis ApsS extracellular loop sequence.

For the construction of the apsS-deletion mutant
SaHKatt1ggggacaagtttgtacaaaaaagcaggctggtatgtttatcgtcatccccttgg
SaHKrev1gcaagtcacgtcgactgttggtaaggggatccactgtcag
SaHKatt2ggggaccactttgtacaagaaagctgggtgaacgcctaggtgcatatggcacacctg
SaHKrev2catgagccatggatccttttcctacttttgtttcg
For the construction of the apsS complementation and hybrid plasmids
HKSaBamggatagtgcaatcggatccaaagtaggaaaaggatatatggc
HKSaMlugtaacaaaacgcgtgtttaaaatgacaaatttgtcacttccg
p1gttagtgataatacgttaacagtaaatgtgaatcg
p2tacactttcaactgaaatctcataatcgattagactaatga
p3gattatgagatttcagttgaaagtgtattttatattgtttca
p4catctatcttattataacgttgaagctgcattg
p5gtaggaaaaggatataggatccatgaataatttg
p6ctaagtaacaaaacgcgtgtttaaaatgacaaattt
For the construction of the vraFG-deletion mutant and complementation plasmid
VraFGatt1ggggacaagtttgtacaaaaaagcaggctgtctttagtaatggtgcctgcaacgcccg
VraFGrev1gtagagtagtggattcggatccacgaactatactgg
VraFGatt2ggggaccactttgtacaagaaagctgggtgattcatggctttgaagttgactgccgg
VraFGrev2cttaacttcggatcctttaggctttggcacttgtatcttc
VraFGEcocatgcgttttgttacttagaattcatacatcaatgcagc
VraFGBamccagtatagttcgtggatccgaatccactactctac
For quantitative RT-PCR
GyrB-Fcaaatgatcacagcatttggtacag
GyrB-probeaatcggtggcgactttgatctagcgaaag
GyrB-Rcggcatcagtcataatgacgat
DltB-Ftgtttataggttatggctattatgaacgtt
DltB-probeaacatccgccacgttggcaaaatg
DltB-Rtgtaatcacaatgctaagtgctgttg
MprF-Fagacgtgccatcatctttgct
MprF-probeacagtggcgacattcttcacttacgcttcatt
MprF-Rtgctctacggaaagctacaataagc
VraF-Fcacaagaagtgttgcgagatatcaat
VraF-probeagcaataaactcgccttcttcaatag
VraF-Rccagatccagagggacccata

Quantitative RT-PCR

Oligonucleotide primers and probes (Table 4) were synthesized by Sigma. Probes for quantitative RT-PCR were used to continuously monitor formation of PCR products during PCR. cDNA was synthesized from total RNA using the SuperScript III first-strand synthesis system (Invitrogen) according to the manufacturer's instructions. The resulting cDNA and negative control samples were amplified with TaqMan Universal PCR Master Mix (Applied Biosystems). Reactions were performed in a MicroAmp Optical 96-well reaction plate using a 7700 Sequence Detector (Applied Biosystems). Standard curves were determined for each gene, by use of purified chromosomal template DNA at concentrations of 0.005–50 ng ml−1. All RT-PCR experiments were performed in triplicate, with gyrB RNA used as a control.

Killing assays

Killing assays were performed as described before (Lai et al., 2007). In brief, S. aureus cells were grown to exponential growth phase (OD600, 2.5–3.0), cultures were harvested, washed twice with 10 mM sodium phosphate buffer (pH 6.5) with 100 mM NaCl, and resuspended in the same buffer. The cells were diluted to a final concentration of 106 cells in each sample. The bacteria were exposed to a range of AMP concentrations and incubated at 37°C for 3 h, and appropriate dilution series of the samples were plated on TSB agar plates. The samples were incubated at 37°C for 24 h, and surviving S. aureus cells were counted.

Determination of MICs

Staphylococcus aureus cells were grown to mid-log phase; cultures were harvested, washed twice with 10 mM sodium phosphate buffer (pH 6.5) with 100 mM NaCl, and resuspended in LB medium. The cells were diluted using Luria–Bertani (LB) media to a final concentration of 105 ml−1 in each sample. The bacteria were exposed to a range of AMP concentrations and incubated at 37°C with shaking at 180 r.p.m. for at least 12 h, after which OD600 was measured. The MIC was defined as the concentration at which the OD600 was reduced by 50%.

Peptide degradation assay

Staphylococcus aureus MW2 cells were grown to exponential growth phase (OD600, 2.5–3.0); cultures were harvested, washed twice with 10 mM sodium phosphate buffer (pH 6.5) with 100 mM NaCl, and resuspended in the same buffer. The bacteria were exposed to 50 μg ml−1 hBD3 and incubated at 37°C. At different incubation time points, 1 ml of the culture was collected, and supernatants were lyophilized. Degradation was analysed on 15% Tricine SDS-PAGE gels.

Isolation and detection of membrane phospholipids

Staphylococcus aureus MW2 and apsS-deletion mutant overnight cultures were diluted 1:100 into 50 ml of TSB and incubated at 37°C with shaking at 180 r.p.m. until grown to an OD600 of 2.5–3.0 (mid-logarithmic growth phase). Cultures were then split into two equal volumes, and cells were washed twice in 10 mM sodium phosphate buffer (pH 6.5) with 100 mM NaCl and resuspended in the same buffer. To one sample, indolicidin was added to a final concentration of 5 μg ml−1. Samples were incubated at 37°C for 1 h, cultures were harvested, washed once in sodium acetate buffer (20 mM, pH 4.5), and cells were extracted as a wet pellet using a modified Bligh and Dyer method (1959). The cell pellets were resuspended in chloroform–methanol–water (10:20:8, v/v) at 4°C, and four times their weight of glass beads (Sigma) was added to the mixture. The cells were disrupted by vortexing three times for 2 min at 4°C. After centrifugation at 4000 r.p.m. for 15 min, the mixture was filtered and divided into two phases by adding chloroform and water to a final concentration of chloroform–methanol–water of 20:20:18. After settling (24 h), the lower phase was collected, roto-evaporated under reduced pressure, and dissolved in chloroform–methanol (2:1, by volume). Equal amounts of lipid extracts were spotted onto silica 60 F254 HPTLC plates (Merck) and developed with chloroform–methanol–water (65:25:4, by volume). Phospholipids were stained with 5% H2SO4.

Animal experiments

CD1 Swiss female mice were obtained from Charles River Laboratories and were between 4 and 6 weeks of age at the time of use. All animals were housed and maintained under pathogen-free conditions at the Rocky Mountain Laboratory animal facility. The study protocols were reviewed and approved by the Animal Use Committee at Rocky Mountain Laboratories, NIAID, National Institutes of Health (NIH). S. aureus strains were grown to mid-exponential phase, washed twice with sterile PBS, then resuspended in PBS at 1 × 108 cfus per 100 μl, and each mouse was injected intraperitoneally with 2 × 108 cfus of live S. aureus in 0.2 ml PBS. Control animals received 0.2 ml PBS only. After inoculation, animal health and disease advancement were monitored every 3 h for the first 24 h, then every 8 h for up to 72 h. Animals were euthanized immediately if showing signs of respiratory distress, mobility loss, or inability to eat and drink. At the time of death, the kidneys were removed, weighed, homogenized and serially diluted in PBS. Dilution series of the samples were plated on TSB agar plates. The samples were incubated at 37°C for 24 h, and the cfu counts per 100 mg kidney were determined.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

This work was supported by the Intramural Research Program of the NIAID, NIH.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  • Anonymous (1999) From the centers for disease control and prevention. Four pediatric deaths from community-acquired methicillin-resistant Staphylococcus aureus – Minnesota and North Dakota, 1997–99. JAMA 282: 11231125.
  • Baba, T., Takeuchi, F., Kuroda, M., Yuzawa, H., Aoki, K., Oguchi, A., et al. (2002) Genome and virulence determinants of high virulence community-acquired MRSA. Lancet 359: 18191827.
  • Bader, M.W., Sanowar, S., Daley, M.E., Schneider, A.R., Cho, U., Xu, W., et al. (2005) Recognition of antimicrobial peptides by a bacterial sensor kinase. Cell 122: 461472.
  • Bae, T., and Schneewind, O. (2006) Allelic replacement in Staphylococcus aureus with inducible counter-selection. Plasmid 55: 5863.
  • Bligh, E.G., and Dyer, W.J. (1959) A rapid method of total lipid extraction and purification. Can J Biochem Physiol 37: 911917.
  • Brodsky, I.E., and Gunn, J.S. (2005) A bacterial sensory system that activates resistance to innate immune defenses: potential targets for antimicrobial therapeutics. Mol Interv 5: 335337.
  • Bruckner, R. (1997) Gene replacement in Staphylococcus carnosus and Staphylococcus xylosus. FEMS Microbiol Lett 151: 18.
  • Chambers, H.F. (2005) Community-associated MRSA – resistance and virulence converge. N Engl J Med 352: 14851487.
  • Faurschou, M., and Borregaard, N. (2003) Neutrophil granules and secretory vesicles in inflammation. Microbes Infect 5: 13171327.
  • Hancock, R.E., and Diamond, G. (2000) The role of cationic antimicrobial peptides in innate host defences. Trends Microbiol 8: 402410.
  • Harder, J., and Schroder, J.M. (2005) Antimicrobial peptides in human skin. Chem Immunol Allergy 86: 2241.
  • Harder, J., Bartels, J., Christophers, E., and Schroder, J.M. (2001) Isolation and characterization of human beta-defensin-3, a novel human inducible peptide antibiotic. J Biol Chem 276: 57075713.
  • Herbert, S., Bera, A., Nerz, C., Kraus, D., Peschel, A., Goerke, C., et al. (2007) Molecular basis of resistance to muramidase and cationic antimicrobial peptide activity of lysozyme in staphylococci. PLoS Pathog 3: e102.
  • Khan, S.A., Carleton, S.M., and Novick, R.P. (1981) Replication of plasmid pT181 DNA in vitro: requirement for a plasmid-encoded product. Proc Natl Acad Sci USA 78: 49024906.
  • Komatsuzawa, H., Ouhara, K., Yamada, S., Fujiwara, T., Sayama, K., Hashimoto, K., and Sugai, M. (2006) Innate defences against methicillin-resistant Staphylococcus aureus (MRSA) infection. J Pathol 208: 249260.
  • Kreiswirth, B.N., Lofdahl, S., Betley, M.J., O'Reilly, M., Schlievert, P.M., Bergdoll, M.S., and Novick, R.P. (1983) The toxic shock syndrome exotoxin structural gene is not detectably transmitted by a prophage. Nature 305: 709712.
  • Kuroda, M., Kuwahara-Arai, K., and Hiramatsu, K. (2000) Identification of the up- and down-regulated genes in vancomycin-resistant Staphylococcus aureus strains Mu3 and Mu50 by cDNA differential hybridization method. Biochem Biophys Res Commun 269: 485490.
  • Lai, Y., Villaruz, A.E., Li, M., Cha, D.J., Sturdevant, D.E., and Otto, M. (2007) The human anionic antimicrobial peptide dermcidin induces proteolytic defence mechanisms in staphylococci. Mol Microbiol 63: 497506.
  • Lekstrom-Himes, J.A., and Gallin, J.I. (2000) Immunodeficiency diseases caused by defects in phagocytes. N Engl J Med 343: 17031714.
  • Li, M., Lai, Y., Villaruz, A.E., Cha, D.J., Sturdevant, D.E., and Otto, M. (2007) Gram-positive three-component antimicrobial peptide-sensing system. Proc Natl Acad Sci USA 104: 94699474.
  • Lowy, F.D. (1998) Staphylococcus aureus infections. N Engl J Med 339: 520532.
  • Meehl, M., Herbert, S., Gotz, F., and Cheung, A. (2007) Interaction of the GraRS two-component system withthe VraFG ABC transporter to support vancomycin-intermediate resistance in Staphylococcus aureus. Antimicrob Agents Chemother 51: 26792689.
  • Miller, S.I., Kukral, A.M., and Mekalanos, J.J. (1989) A two-component regulatory system (phoP phoQ) controls Salmonella typhimurium virulence. Proc Natl Acad Sci USA 86: 50545058.
  • Moran, G.J., Krishnadasan, A., Gorwitz, R.J., Fosheim, G.E., McDougal, L.K., Carey, R.B., and Talan, D.A. (2006) Methicillin-resistant S. aureus infections among patients in the emergency department. N Engl J Med 355: 666674.
  • Patte, J.C. (1994) Biosynthesis of threonine and lysine. In Escherichia coli and Salmonella. Cellular and Molecular Biology. Neidhardt, F.C. (ed.). Washington, DC: American Society for Microbiology, pp. 528541.
  • Peschel, A. (2002) How do bacteria resist human antimicrobial peptides? Trends Microbiol 10: 179186.
  • Peschel, A., and Sahl, H.G. (2006) The co-evolution of host cationic antimicrobial peptides and microbial resistance. Nat Rev Microbiol 4: 529536.
  • Peschel, A., Ottenwalder, B., and Gotz, F. (1996) Inducible production and cellular location of the epidermin biosynthetic enzyme EpiB using an improved staphylococcal expression system. FEMS Microbiol Lett 137: 279284.
  • Peschel, A., Otto, M., Jack, R.W., Kalbacher, H., Jung, G., and Gotz, F. (1999) Inactivation of the dlt operon in Staphylococcus aureus confers sensitivity to defensins, protegrins, and other antimicrobial peptides. J Biol Chem 274: 84058410.
  • Peschel, A., Jack, R.W., Otto, M., Collins, L.V., Staubitz, P., Nicholson, G., et al. (2001) Staphylococcus aureus resistance to human defensins and evasion of neutrophil killing via the novel virulence factor MprF is based on modification of membrane lipids with 1-lysine. J Exp Med 193: 10671076.
  • Seeber, S., Kessler, C., and Gotz, F. (1990) Cloning, expression and characterization of the Sau3AI restriction and modification genes in Staphylococcus carnosus TM300. Gene 94: 3743.
  • Selsted, M.E., Novotny, M.J., Morris, W.L., Tang, Y.Q., Smith, W., and Cullor, J.S. (1992) Indolicidin, a novel bactericidal tridecapeptide amide from neutrophils. J Biol Chem 267: 42924295.
  • Vuong, C., Saenz, H.L., Gotz, F., and Otto, M. (2000) Impact of the agr quorum-sensing system on adherence to polystyrene in Staphylococcus aureus. J Infect Dis 182: 16881693.