SEARCH

SEARCH BY CITATION

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Streptomyces coelicolor GlnR is a global regulator that controls genes involved in nitrogen metabolism. By genomic screening 10 new GlnR targets were identified, including enzymes for ammonium assimilation (glnII, gdhA), nitrite reduction (nirB), urea cleavage (ureA) and a number of biochemically uncharacterized proteins (SCO0255, SCO0888, SCO2195, SCO2400, SCO2404, SCO7155). For the GlnR regulon, a GlnR binding site which comprises the sequence gTnAc-n6-GaAAc-n6-GtnAC-n6-GAAAc-n6 has been found. Reverse transcription analysis of S. coelicolor and the S. coelicolor glnR mutant revealed that GlnR activates or represses the expression of its target genes. Furthermore, glnR expression itself was shown to be nitrogen-dependent. Physiological studies of S. coelicolor and the S. coelicolor glnR mutant with ammonium and nitrate as the sole nitrogen source revealed that GlnR is not only involved in ammonium assimilation but also in ammonium supply. blast analysis demonstrated that GlnR-homologous proteins are present in different actinomycetes containing the glnA gene with the conserved GlnR binding site. By DNA binding studies, it was furthermore demonstrated that S. coelicolor GlnR is able to interact with these glnA upstream regions. We therefore suggest that GlnR-mediated regulation is not restricted to Streptomyces but constitutes a regulon conserved in many actinomycetes.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Nitrogen assimilation, the uptake and incorporation of inorganic nitrogen into the cell's metabolism, is an essential process in most bacteria (for review, see Merrick and Edwards, 1995). Assimilation of different nitrogen sources results in the synthesis of the two amino acids glutamate and glutamine, which act as the major intracellular nitrogen donors (Reitzer and Schneider, 2001). Two pathways, depending on nitrogen availability, are used for ammonium assimilation: the glutamate dehydrogenase (GDH) or the GS/GOGAT systems. GDH catalyses a reaction between ammonium and 2-oxoglutarate to directly build glutamate in an NADPH-dependent reaction under high-nitrogen concentrations. When the nitrogen supply is low, the second pathway, the GS/GOGAT system, mediates the formation of glutamine and glutamate with ATP-consumption. Glutamine synthetase (GS) assimilates ammonium and glutamate into glutamine; subsequently, the glutamate synthase (GOGAT) converts glutamine and 2-oxoglutarate to form two molecules of glutamate (Magasanik, 1982). The preferred inorganic nitrogen source is ammonium, which can either be taken up directly from the environment by ammonium transporters or be generated by deamination of amino acids. Another major route for obtaining ammonium as substrate for GS reaction is the reduction of nitrate via nitrite to ammonium by the enzymes nitrate reductase and nitrite reductase (Moir and Wood, 2001).

In order to respond to changes in nitrogen availability, bacteria have evolved complex transcriptional regulatory networks enabling the co-ordinated control of expression of genes involved in nitrogen metabolism. In enteric bacteria, the two-component system NtrB/NtrC regulates nitrogen assimilation. In response to nitrogen starvation, the sensor kinase NtrB phosphorylates NtrC, which subsequently activates transcription of at least six operons involved in nitrogen metabolism (for review, see Reitzer and Schneider, 2001). In Bacillus subtilis, two transcription factors, TnrA and GlnR, control gene expression in response to nitrogen availability (Schreier et al., 1989; Wray et al., 1996). TnrA works both as an activator and a repressor under nitrogen-restricted conditions. In contrast, GlnR acts as a repressor in cells grown in the presence of excess nitrogen.

Completely different regulatory systems developed in actinomycetes. These bacteria are widely distributed in terrestrial environments and are important producers of commercially important enzymes and therapeutic compounds. The genus Streptomyces produces 7600 bioactive microbial metabolites (Bérdy, 2005) and is characterized by the formation of a multiply branching mycelium that undergoes morphological differentiation ending in sporulation (Chater, 2001). Other actinomycetes, e.g. Mycobacterium tuberculosis and Corynebacterium diphteriae, which are non-sporulating and display a single-cell morphology, are important pathogens.

In Corynebacterium glutamicum, regulation of nitrogen assimilation is mediated by the transcriptional regulator AmtR belonging to the TetR repressor family (for review, see Burkovski, 2003). The repressor protein AmtR controls the transcription of at least 33 genes, many of them involved in nitrogen metabolism, in response to nitrogen availability (Beckers et al., 2005).

In Streptomyces coelicolor, the model organism for antibiotic producing streptomycetes, two genes encoding active GSs were found: glnA and glnII (Weisschuh et al., 2000). The regulation of the glnA gene encoding GSI is mediated by GlnR (Wray et al., 1991). GlnR, an OmpR-like response regulator, does not display any similarity to the B. subtilis GlnR regulator belonging to the MerR family (Brandenburg et al., 2002) of transcriptional regulators. By gel retardation assays, S. coelicolor GlnR was shown to bind to the upstream region of the amtB-glnK-glnD operon (Fink et al., 2002). amtB encodes a putative ammonium transporter, glnK a PII signal protein and glnD an adenylyl transferase (Hesketh et al., 2002). PII-like proteins are involved in transcriptional and post-translational regulation of components involved in nitrogen metabolism in many bacteria (Ninfa and Jiang, 2005). In S. coelicolor, the functions of the PII protein GlnK and the adenylyl transferase GlnD were elucidated by studies of S. coelicolor glnK and glnD null mutants. It was shown that GlnK is adenylylated by GlnD in response to low-nitrogen concentrations. But in contrast to the situation in other bacteria, the GlnK/GlnD proteins are not directly involved in the regulation of GS activity in S. coelicolor and their specific role remains unclear (Hesketh et al., 2002). By comparing the upstream regions of these two GlnR-regulated genes, glnA and amtB, a conserved GlnR-binding sequence was postulated (Fink et al., 2002).

In addition to Streptomyces and Corynebacterium, nitrogen assimilation was also studied in Mycobacterium tuberculosis. There, it was found that the GSI of M. tuberculosis is required for pathogenicity and thus is regarded as a potential pharmacological target for tuberculosis therapy (Tullius et al., 2003). However, the transcriptional regulation of glnA and nitrogen metabolism genes in Mycobacteria is poorly understood.

In this report we characterize the GlnR regulon and analyse in detail the impact of GlnR on the transcription of its target genes. We demonstrate that GlnR controls all the important routes for acquiring ammonium and for synthesizing the nitrogen donors glutamine and glutamate in S. coelicolor. Consequently, GlnR can be regarded as the central regulator of nitrogen metabolism. Moreover, evidence is provided that the GlnR regulation system is also present in Mycobacteria and several actinomycetes. Therefore, we suggest S. coelicolor as a model organism for the analysis of nitrogen regulation in actinomycetes.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Identification of 10 new GlnR target genes

Previous studies have shown that a chemically mutagenized, glutamine auxotrophic strain of S. coelicolor was only complemented with a locus carrying glnR (Wray et al., 1991). In contrast to the glutamine auxotrophic phenotype of the glnR mutant, a deletion of the glnA or the glnII gene induced no severe phenotype (Fink et al., 2002). Fink et al. (2002) found three upstream regions of S. coelicolor genes, glnA, amtB and SCO1863, which were bound by GlnR. These results led to the assumption that further genes are controlled by GlnR, which might be the cause of the glutamine auxotrophy of the glnR mutant.

In order to screen the genomic sequence of S. coelicolor M145 (Bentley et al., 2002) for new GlnR binding sites, the MAST/MEME tools were used (http://meme.sdsc.edu). The 44 bp sequences of the known GlnR binding sites upstream of glnA, amtB and SCO1863 were submitted to the search tool MEME. The obtained search matrix was used to screen a library of the upstream regions of all annotated S. coelicolor genes (http://streptomyces.org.uk) with the MAST tool. It was possible to identify 32 upstream regions of annotated genes containing a putative GlnR binding site with significant similarity to the consensus sequence published by Fink et al. (2002), including the distance between the 5mer sequences and the distance from the translational start point (between nucleotide −1 and −250 relative to the translational start site).

For functional analysis of these putative GlnR binding sites, electrophoretic mobility shift assays (EMSAs) with purified GlnR were conducted. For the purification of the 29 kDa GlnR protein, the fusion gene Strep–glnR was cloned into the expression vector pJOE2775 under the control of a rhamnose-inducible promoter, allowing the expression of active GlnR with an N-terminal StrepII-tag in Escherichia coli Xl1blue. The Strep–GlnR protein was stably purified using StrepTactin gravity flow columns and the purity was verified using SDS-PAGE analysis (data not shown). The investigation of GlnR's ability to bind to the 32 putative binding sites was performed with agarose EMSA. Therefore, 250 bp DNA fragments containing the putative GlnR binding sites were amplified and labelled with Cy5 via PCR. Each DNA fragment was mixed with purified Strep–GlnR and incubated at 24°C. To verify the specificity of the GlnR–DNA interaction, an excess of unlabelled, specific or non-specific DNA was added to the protein–DNA incubation mixture.

As positive controls, EMSAs with the glnA, amtB and SCO1863 upstream regions previously shown to promote GlnR binding (Fig. 1A, lanes1, 2, 9) were performed. As a negative control, the glnR upstream region which does not interact with GlnR (Fink et al., 2002) was used (data not shown).

image

Figure 1. DNA binding by GlnR. Agarose EMSA with Strep–GlnR protein and putative GlnR binding sites. A. 55 and 1450 nM of purified GlnR protein were incubated with 2 ng of 250 bp, Cy5-labelled PCR fragments containing the upstream regions of glnA (lane 1), amtB (lane 2), glnII (lane 3), gdhA (lane 4), nirB (lane 5), ureA (lane 6), SCO0255 (lane 7), SCO0888 (lane 8), SCO1863 (lane 9), SCO2195 (lane 10), SCO2400 (lane 11), SCO2404 (lane 12) and SCO7155 (lane 13). The shifts were verified to be specific by adding 500-fold excess of specific and non-specific DNA (non-labelled). B. 5–1500 nM of purified GlnR protein were incubated with 2 ng of 250 bp, Cy5-labelled PCR fragments containing the upstream regions of glnA (lane 1), amtB (lane 2), glnII (lane 3), gdhA (lane 4), nirB (lane 5), ureA (lane 6). Measured DNA binding affinities (Kd) are indicated. C = complexed DNA; F = free DNA.

Download figure to PowerPoint

In these assays Strep–GlnR interacted specifically with 10 of the 32 identified putative binding sites (Fig. 1A). Four newly identified GlnR target genes are directly (glnII) or putatively (gdhA, nirB and ureA) involved in nitrogen assimilation. The other target genes encode proteins of diverse or unknown functions (SCO0255, SCO0888, SCO2195, SCO2400, SCO2404 and SCO7155) (Table 1).

Table 1.  Annotated functions of GlnR target genes. Thumbnail image of

To determine the different affinities of GlnR for the upstream regions of the genes involved in nitrogen metabolism quantitative EMSAs were performed. Thereby, the apparent equilibrium dissociation constants Kd were defined by incubating the DNA fragments with increasing amounts of purified GlnR protein. In this way it was found that purified GlnR bound glnA with an apparent Kd of ∼190 nM, glnII with Kd of ∼294 nM, amtB with Kd of ∼292 nM, gdhA with Kd of ∼163 nM and ureA with Kd of ∼413 nM (Fig. 1B). However, the GlnR affinity to the binding site upstream of nirB was much lower and the Kd-value is not in the same range as shown for the other binding sites. It was not possible to obtain a complete shift of the fragment using GlnR concentrations of up to 1500 nM (Fig. 1B).

GlnR interacts with the binding box gTnAc-n6-GaAAc-n6

By comparing the upstream sequences of 10 new and three known GlnR target genes, we were able to generate a detailed consensus sequence: gTnAc-n6-GaAAc-n6-GtnAC-n6-GAAAc-n6 (Fig. 2A). In order to narrow down the GlnR binding region, two fragments containing parts of the GlnR binding site of the glnA upstream region were synthesized by PCR. Both fragments consist of a non-specific, 88 bp scaffold derived from the plasmid pGEM T-Easy and a specific part of the conserved motif: binding fragment-2 contains the complete 44 bp binding motif gTnAc-n6-GaAAc-n6-GtnAC-n6-GAAAc-n6 and binding fragment-1 contains a 22 bp stretch with the conserved motif gTnAc-n6-GaAAc. EMSAs showed that both fragment-1 and fragment-2 were specifically shifted by GlnR, indicating that the motif gTnAc-n6-GaAAc-n6 includes one GlnR binding box (Fig. 2B).

image

Figure 2. Analysis of the GlnR binding motif. A. Comparison of the upstream regions of the GlnR target genes and identification of the GlnR binding motif. Conserved 5mer sequences are indicated by shaded boxes. Conserved nucleotides are in bold letters. Lower case letters indicate that 7–8 nucleotides are identical; capital letters indicate that 9–13 nucleotides are identical; Nx = distance to the translational start point. B. Identification of the minimal GlnR binding site by agarose EMSA with Strep–GlnR protein and conserved binding boxes. Fifty-five nanomolar and 1450 nM of purified GlnR protein were incubated with 2 ng of a 110 bp, Cy5-labelled PCR fragment containing the minimal GlnR binding fragment (1) and with 2 ng of a 132 bp, Cy5-labelled PCR fragment containing the complete GlnR binding site of the upstream region of glnA (2). The shifts were verified to be specific by adding 500-fold excess of specific and non-specific DNA (non-labelled). Conserved 5mer sequences in bold letters.

Download figure to PowerPoint

In order to determine the precise location of the GlnR binding sites, DNase I protection assays were performed. Three of the upstream regions containing a binding site were chosen to verify experimentally GlnR binding to the proposed regions: the glnA and the nirB upstream regions with two GlnR binding boxes highly similar to the consensus sequence and the gdhA upstream region with one highly conserved GlnR binding box and a second one with weak similarity to the gTnAc-n6-GaAAc-n6 motif. 5′-labelled DNA fragments, containing the glnA, gdhA or nirB upstream region were complexed with GlnR and DNase I footprinting experiments were performed as described in Experimental procedures. The analysis of both strands of the glnA upstream region revealed a protection area between nucleotides −88 and −140 relative to the translational start site of glnA (Fig. 3A and B). The protected 52 bp sequence corresponds to both proposed GlnR binding boxes, which are located between nucleotides −90 and −133 (Fig. 3D). The protection area is interrupted by a prominent sensitive region at position −118. The affinity of GlnR to the region between nucleotides −118 and −140 is significantly higher than to the region between nucleotides −118 and −88 as protection was obtained by lower amounts of GlnR (Fig. 3A).

image

Figure 3. DNase I footprint analysis of GlnR DNA complexes. A. The non-coding strand of the glnA upstream regulatory region is shown. Lane 1 = G and A sequencing ladder; lane 2 = DNase I hydrolysis in the absence of GlnR; lane 3 = hydrolysis in the presence of 0.25 μM GlnR; lane 4 = 0.5 μM GlnR; lane 5: 1 μM GlnR; lane 6 = 2 μM GlnR; lane 7 = 4 μM GlnR. Sequence positions relative to the first nucleotide of the AUG translation initiation codon are indicated at the left margin. Black bars depict regions of DNase I protection. B. Analysis of the glnA coding strand. Lanes 1–7 correspond to the legend given in A. Black arrows indicate regions of enhanced DNase I cleavage in presence of GlnR. C. Analysis of the gdhA coding strand. Lanes 1–5 correspond to the legend given in A. D. Protected sequence stretches in the upstream regions of glnA and gdhA. Sequence positions are given relative to the first nucleotide of the AUG translation initiation codon. Black bars indicate regions of DNase I protection. Letters in bold show conserved nucleotides of the GlnR binding motif.

Download figure to PowerPoint

The gdhA upstream region contains one highly conserved GlnR binding box between nucleotides −58 and −79. Protection is initiated within this 20 bp sequence region extending upstream to position −88 at higher protein concentrations. Moreover, hypersensitive sites became detectable in the DNA region adjacent to the protection area (nucleotide −61; nucleotide −95) (Fig. 3C, indicated by arrows). The presence of such hypersensitive sites suggests that binding of GlnR induces changes in the three-dimensional structure of the DNA.

The protection area in the nirB upstream region also corresponds to both proposed GlnR binding boxes although significantly higher protein amounts were necessary to obtain protection (data not shown).

These results confirm the deduced consensus sequence for the GlnR binding site, which was generated by sequence comparison.

GlnR activates glnA and glnII transcription

The two GS genes glnA and glnII are both characterized by a GlnR binding site in their upstream regions. Previous studies (Fink et al., 2002) showed that chromosomal integration of a second copy of glnR influenced only GSI activity. To analyse the effect of strong overexpression of glnR on glnA, as well as on glnII expression, glnR was cloned under the control of the thiostrepton-inducible promoter tipA in the multicopy plasmid pGM190, generating pGM–glnR. This plasmid was introduced via protoplast transformation into S. coelicolor M145. As a control, the empty plasmid pGM190 was also transferred into Scoelicolor M145. The strains were grown in liquid, complex S-medium for 3 days and were then induced with 12.5 μg ml−1 thiostrepton. Samples were taken after 12, 24 and 36 h, and GSI and GSII expression was tested in Western blot analysis with specific antibodies. In the control strain S. coelicolor-pGM, only a low level of GSI and no GSII protein was detected. In contrast, the strain containing pGM–glnR showed an increased amount of GSI and a strongly increased abundance of GSII (Fig. 4). These results revealed that an increase of GlnR results in a higher expression of glnA and glnII.

image

Figure 4. Influence of glnR overexpression on glnA and glnII expression. Western blot analysis of GSI and GSII in S. coelicolor/pGM and S. coelicolor/pGM–glnR. Ten micrograms of protein was used for 15% SDS-PAGE and transferred to a nitrocellulose membrane. Antibody detection was performed with anti-GSI- or anti-GSII-specific antibodies and ECL detection reagents.

Download figure to PowerPoint

GlnR can also act as a transcriptional repressor

To study the impact of GlnR on the expression of its 13 target genes, semiquantitative reverse transcription PCR (RT-PCR) was performed using RNA isolated from S. coelicolor M145 and the glnR mutant S. coelicolor FS55 (Wray et al., 1991). The strains were grown for 4 days in complex S-medium, transferred to minimal N-Evans medium containing 5 mM NaNO3 and finally cultivated for 5 h. For each reverse transcription reaction, 3 μg of RNA was used and the resulting cDNA was taken for PCR analysis. Internal primers for the 13 GlnR-regulated genes and the hrdB control were generated; the primers were used at a concentration of 2 μM for PCR.

The RT-PCR experiments confirmed that GlnR enhanced the transcription of glnA and glnII, as glnA and glnII signals were clearly reduced in the glnR mutant FS55 compared with M145. The same effect was observed for nirB and amtB, indicating GlnR's function in activating the transcription of these genes, too. In contrast, GlnR apparently repressed transcription of ureA, gdhA, SCO0255, SCO0888 and SCO2404. For transcription of the genes SCO2195, SCO2400 and SCO7155, no significant difference between M145 and the glnR mutant was detectable. Transcription of SCO1863 was detected neither in FS55 nor in M145 (Fig. 5A).

image

Figure 5. Transcriptional studies of S. coelicolor M145 and S. coelicolor FS55. A. RT-PCR analysis of GlnR target genes in M145 and FS55. Three micrograms of RNA was used for reverse transcription. cDNA was diluted 1:2 and 1:10 and used for PCR analysis. Sequences corresponding to the genes regulated by GlnR were amplified with internal primers (2 μM). Lane 1 = genes activated by GlnR, lane 2 = genes repressed by GlnR and lane 3 = no GlnR influence on transcription. hrdB was used as control. B. Transcriptional studies of S. coelicolor M145 under different physiological conditions. RT-PCR analysis of GlnR target genes in M145 grown in S-medium (left) and N-Evans (right). Three micrograms of RNA was used for reverse transcription. cDNA was diluted 1:2 and 1:10 and used for PCR analysis. Sequences corresponding to the genes regulated by GlnR were amplified with internal primers (2 μM). Lane 1 = genes activated by GlnR, lane 2 = genes repressed by GlnR and lane 3 = no GlnR influence on transcription. hrdB was used as control.

Download figure to PowerPoint

To study the regulatory effects of GlnR in more detail, transcription levels for its target genes were analysed under different nitrogen conditions in the M145 strain. M145 was grown in liquid, nitrogen-rich S-medium or minimal N-Evans medium supplemented with 5 mM NaNO3 as the sole nitrogen source. RNA was isolated after 4 days of incubation and 3 μg of each RNA sample was used for RT-PCR. Transcription of the GlnR targets glnA, glnII, amtB and nirB was induced in nitrogen-limiting N-Evans medium. In contrast, gdhA, ureA, SCO0255, SCO0888, SCO2400 and SCO2404 transcription was repressed. No changes in SCO2195 and SCO7155 levels were observed and transcription of SCO1863 was not detectable at all (Fig. 5B).

glnR expression depends on the nitrogen status of the cell

Additionally, the results obtained from the RT-PCRs raised the question whether expression of the GlnR protein itself is dependent on the nitrogen status of the cell or whether glnR is constitutively expressed and the regulation of its target genes depends on modification of GlnR. The RT-PCR analysis clearly showed that no glnR mRNA was detectable after growth in complex, nitrogen-rich S-medium, whereas glnR transcription was induced in nitrogen-limiting N-Evans (Fig. 5B). It can therefore be concluded that transcription of glnR depends on the nitrogen concentration and ultimately modulates the transcription of the target genes.

S. coelicolor FS55 is not a glutamine auxotroph but is impaired in ammonium assimilation and nitrite reduction

RT-PCR analysis (Fig. 5A) revealed that GlnR regulates two important genes required for providing intracellular ammonium: the putative ammonium transporter amtB and the nitrite reductase nirB, which reduces nitrite into ammonium. These results suggested that the GlnR-mediated control mechanism is not merely restricted to the utilization of ammonium but is also involved in ammonium supply.

To analyse the impact of GlnR on the ammonium supply, the growth of S. coelicolor FS55 and M145 on different nitrogen sources was tested. Dilutions (10−2−10−6) of spore suspensions of FS55 and M145 were plated onto N-Evans agar containing 100 mM NH4Cl or NaNO3 as the sole nitrogen source. After 3 days of incubation, growth was monitored. The glnR mutant was able to grow on NH4Cl-containing N-Evans but showed a slight growth retardation compared with M145. In contrast, when NaNO3 was the nitrogen source, no growth of the glnR mutant was observed. The M145 strain, however, could use NH4Cl as well as NaNO3 as the sole nitrogen source and grew without apparent problems (Fig. 6A). This result suggested that FS55 is not able to reduce nitrate via nitrite to ammonium.

image

Figure 6. Ammonium and nitrate utilization by S. coelicolor M145 and FS55. A. Growth of S. coelicolor M145 and S. coelicolor FS55 on ammonium or nitrate as the sole nitrogen source. Spore suspensions (109) of the strains diluted 10−2−10−6 were plated on N-Evans with 100 mM NH4Cl or NaNO3 and incubated for 3 days at 30°C. B. Griess-Ilosvay assay for nitrite detection in culture supernatants of S. coelicolor M145 and S. coelicolor FS55. Three millilitres of supernatant from the culture was incubated with Griess-Ilosvay reagent for 1 min. M145 showed no change in colour after treatment with Griess-Ilosvay reagent; the pink colour is due to antibiotic production. The FS55 supernatant turned red. − = without Griess-Ilosvay reagent, + = with Griess-Ilosvay reagent.

Download figure to PowerPoint

In order to investigate whether nitrite reduction is blocked in FS55, a Griess-Ilosvay reaction was performed. With this reaction the presence of nitrite is visualized by the appearance of a red colour after adding the Griess-Ilosvay reagent to the culture supernatant. M145 and FS55 were grown for 4 days in S-medium, transferred to minimal N-Evans medium containing 5 mM NaNO3 and cultivated for 12 h. Three millilitres of supernatant of the culture was incubated with 100 μl of Griess-Ilosvay reagent for 1 min. The FS55 supernatant turned intensely red, demonstrating that nitrite had accumulated. This result showed that the mutant strain is able to reduce nitrate to nitrite, but subsequently the nitrite reduction step is blocked, probably by the lack of activation of nirB. In contrast, the M145 supernatant showed no change in colour after incubation, demonstrating that nitrate was completely reduced to ammonium (Fig. 6B). The slight pink colour in the M145 supernatant is due to the production of the red-pigmented antibiotics actinorhodin and undecylprodigiosin (Rudd and Hopwood, 1980).

glnA upstream regions of different actinomycetes contain a GlnR binding site

GlnR binding sites upstream of glnA were identified in three different Streptomyces strains: S. coelicolor, S. scabies and S. avermitilis (Reuther and Wohlleben, 2007). In order to analyse whether GlnR-mediated regulation of GSI activity occurs in the same way in other actinomycetes, first, comparisons of the glnA upstream regions of representative actinomycetes for which the complete genome sequence is available were performed: Bifidobacterium longum, Corynebacterium glutamicum, Frankia sp. EAN1, Mycobacterium bovis, Mycobacterium tuberculosis, Nocardia farcinica, Nocardioides sp. JS614, Propionibacterium acnes, Rhodococcus sp. RHA1, S. coelicolor and S. avermitilis. The glnA upstream regions of almost all tested strains contain a conserved GlnR binding site (gTnAc-n6-GaAAc-n6-GtnAC-n6-GAAAc-n6) (Fig. 7A), demonstrating that the GlnR binding site upstream of the glnA gene is a conserved motif in actinomycetes. The only species which was found not to possess a GlnR binding box was C. glutamicum. It appears that C. glutamicum regulates glnA expression independently of GlnR, illustrating the exceptional position of C. glutamicum with respect to nitrogen metabolism.

image

Figure 7. GlnR-like proteins and GlnR binding boxes of different actinomycetes. A. Comparison of the glnA upstream regions of different actinomycetes based on the consensus sequence of the S. coelicolor M145 GlnR binding site: SCO, S. coelicolor; SAV, Streptomyces avermitilis; BLO, Bifidobacterium longum; FRA, Frankia sp. EAN1; MBO, Mycobacterium bovis; MTU, Mycobacterium tuberculosis; NFA, Nocardia farcinica; NOC, Nocardioides sp. JS614; PAC, Propionibacterium acnes; RHO, Rhodococcus sp. RHA1; CGL, Corynebacterium glutamicum. Conserved 5mer sequences are indicated by shaded boxes. Conserved nucleotides are in bold letters. −10 region = putative promoter region. B. Alignment of the winged helix–turn–helix motif of GlnR-like proteins from different actinomycetes: SCO, S. coelicolor, SAV, Streptomyces avermitilis; BLO, Bifidobacterium longum; FRA, Frankia sp. EAN1; MBO, Mycobacterium bovis; MTU, Mycobacterium tuberculosis; NFA, Nocardia farcinica; NOC, Nocardioides sp. JS614; PAC, Propionibacterium acnes; RHO = Rhodococcus sp. RHA1. α1 = helix 1, α2 = helix 2 and α3 = the DNA recognition helix. C. EMSA with Strep–GlnR protein and the glnA upstream regions of different actinomycetes. Fifty-five nanomolar and 1450 nm of purified GlnR protein were incubated with 2 ng of 60 bp, Cy5-labelled PCR fragments of the glnA promoters from P. acnes, N. farcinica, B. longum, N. sp. JS614, R. sp. RHA1 and F. sp. EAN1 containing the GlnR binding site and with 2 ng of a 132 bp, Cy5-labelled PCR fragment of the glnA upstream region from Mycobacterium tuberculosis containing the GlnR binding site. The shifts were verified to be specific by adding 500-fold excess of specific and non-specific DNA (non-labelled).

Download figure to PowerPoint

GlnR homologues are widely distributed among actinomycetes

In addition to the presence of the glnA gene with its conserved upstream region, blast analysis revealed that actinomycetes are also characterized by a highly conserved GlnR-like protein (62–82% identity). GlnR belongs to the OmpR-like regulator family (Wray and Fisher, 1993) which is characterized by three α-helices. The first helix resembles a structural core and supports the attachment of the antiparallel β-sheet to the winged-helix motif. The α2-loop-α3 region forms the helix–turn–helix motif. Helix α2 corresponds to the positioning helix and helix α3 functions as the recognition helix interacting with the major groove of DNA (Martinez-Hackert and Stock, 1997).

The winged helix–turn–helix motifs of the GlnR-like proteins of B. longum, Frankia sp. EAN1, M. bovis, M. tuberculosis, N. farcinica, Nocardioides sp. JS614, P. acnes, Rhodococcus sp. RHA1, S. coelicolor and S. avermitilis were compared using ClustalX. This motif, necessary for DNA binding, is highly conserved among the investigated actinomycetes (Fig. 7B). In particular, the proposed DNA recognition helix α3 is completely identical in all the compared sequences. This finding suggests that S. coelicolor M145 GlnR is able to interact with several GlnR binding sites of different actinomycetes and indicates that the GlnR regulation system is highly conserved among actinomycetes.

GlnR of S. coelicolor binds to glnA upstream regions of different actinomycetes

In order to support the hypothesis that GlnR-mediated regulation is not restricted to Streptomyces strains, we cloned several actinomycete glnA upstream regions to test them for their ability to bind GlnR. For the glnA upstream region of Mycobacterium tuberculosis, a 132 bp DNA fragment consisting of a non-specific 88 bp scaffold derived from the plasmid pGEM T-Easy and the putative GlnR binding site was amplified. The glnA upstream regions of Bifidobacterium longum, Frankia sp. EAN1, Nocardia farcinica, Nocardioides sp. JS614, Propionibacterium acnes and Rhodococcus sp. RHA1 were generated via PCR, resulting in 60 bp oligonucleotides encompassing the putative GlnR binding sites.

The DNA fragments were labelled with Cy5 via PCR and used for EMSAs. For protein-binding studies, Strep–GlnR purified from E. coli (see above) was incubated with the different DNA fragments and analysed on polyacrylamide gels (5%), as well as on agarose gels (2%). All tested glnA upstream regions were specifically shifted by GlnR of S. coelicolor M145, indicating that the GlnR–DNA interaction is highly conserved in actinomycetes (Fig. 7C). To verify the specificity of the GlnR interaction, a 500-fold excess of either unlabelled, specific or non-specific DNA was added.

Based on the fact that S. coelicolor GlnR interacted with glnA upstream regions of different actinomycetes and that GlnR-like proteins were found in these strains, one can speculate that these bacteria contain, in their genomic sequences, further GlnR binding sites for GlnR-mediated regulation. To prove this, the upstream regions of homologues of the GlnR target genes in the different actinomycetes were screened for putative GlnR binding sites. The analysis revealed that a conserved GlnR binding site is present in most of the genes likely to be involved in nitrogen metabolism. All amtB and nirB upstream regions include a putative GlnR binding site. glnII, found in Frankia sp. EAN1, also exhibits a GlnR binding site. gdhA exists in all screened actinomycetes, and a GlnR binding site in front of the gene was detectable in four strains: Frankia sp. EAN1, M. tuberculosis, P. acnes and Rhodococcus sp. RHA1. The ureA gene was found in B. longum, Frankia sp. EAN1, M. tuberculosis and Rhodococcus sp. RHA1. Two of these ureA genes, from Frankia sp. EAN1 and M. tuberculosis, also possess a GlnR binding site, presumably for GlnR-dependent regulation (Table 2).

Table 2.  GlnR binding sites in the upstream regions of putative GlnR target genes in different actinomycetes.
 gInAamtBgInllgdhAnirBurea
  1. +, GinR binding site present; −, GinR binding site absent; blank, gene not present.

S. coelicolor++++++
B. longum++  
Frankia sp. EAN 1++++++
M. tuberculosis++ +++
N. farcinica++ + 
P. acnes+  +  
Rhodococcus sp. RHA1++ ++

In addition to Frankia sp. EAN1, the pathogenic strain M. tuberculosis constitutes the only actinomycete in which all essential nitrogen metabolism genes contain GlnR binding sites in the upstream regions (Table 2). Taking into consideration that the mycobacterial GSI represents a pathogenicity factor, the analysis of GlnR-mediated regulation is of great importance.

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

GlnR is a global nitrogen regulator in Streptomyces coelicolor

In order to investigate whether GlnR has a more global role in nitrogen regulation than concluded from previous studies (Fink et al., 2002), the genomic sequence of S. coelicolor M145 was screened with the MAST/MEME tool for further GlnR binding sites. The identified putative binding sites were analysed in agarose EMSAs for specific GlnR binding. Thus, in addition to glnA, amtB and SCO1863, 10 new GlnR target genes were identified: glnII, gdhA, nirB, ureA, SCO0255, SCO0888, SCO2195, SCO2400, SCO2404 and SCO7155. This indicates that GlnR controls important genes involved in nitrogen uptake and regulation (operon amtB-glnK-glnD), reduction or cleavage of nitrogen sources (nirB and ureA), and synthesis of the central metabolic nitrogen donors glutamine and glutamate (glnA, glnII and gdhA) (Fig. 8).

image

Figure 8. Main routes for utilizing ammonium and assimilating ammonium into glutamine and glutamate. GlnR-controlled gene products indicated by black arrows.

Download figure to PowerPoint

Regulators with a comparable target spectrum in nitrogen control were found in Bacillus subtilis. There, the MerR-like transcription factors TnrA and GlnR (Wray et al., 1996) control a number of genes. TnrA regulates the expression of genes involved in ammonium transport (nrgAB; Wray et al., 1994), nitrate and nitrite assimilation (nasABCDEF; Nakano et al., 1995; 1998), and urea degradation (ureABC; Wray et al., 1997). Furthermore, TnrA regulates the expression of the genes involved in the biosynthesis of glutamate (gltAB; Belitsky et al., 2000) and glutamine (glnRA; Wray et al., 1996), as well as its own transcription (Fisher, 1999; Robichon et al., 2000). The B. subtilis repressor GlnR controls the expression of glnRA (Schreier et al., 1989), ureABC (Wray et al., 1997) and tnrA (Zalieckas et al., 2006).

Two of the newly identified genes in S. coelicolor, SCO2195 and SCO7155, are not associated with any known function. Interestingly, the unknown gene SCO2195 is located close to glnA (SCO2198), represents a small protein (71 amino acids), and has a high arginine content (18.3%). In Rhizobium leguminosarum a small protein, GstI (63 amino acids), interacts with glnII mRNA and inhibits its translation (Spinosa et al., 2000). The corresponding gene, gstI, is located upstream of glnII. Both gstI and glnII are regulated by the same transcription factor, NtrC (Carlson et al., 1987). Although SCO2195 shows no sequence homology to GstI, it also demonstrates a protein of small size and the high arginine content indicates the possibility of an interaction with RNA. Furthermore, SCO2195 is also, like glnA and glnII, regulated by GlnR. Therefore, one can speculate that SCO2195 has functions similar to those of GstI.

It is unclear whether six of the newly identified GlnR target genes (SCO0255, SCO0888, SCO2195, SCO2400, SCO2404 and SCO7155) are involved in nitrogen metabolism, and consequently the role of GlnR-mediated regulation in these cases is not obvious: SCO0255 encodes for a transcriptional regulator protein, SCO0888 for a putative NADPH-dependent FMN reductase, and SCO2400 for a putative membrane protein. SCO2404 encodes for a putative ABC transporter sugar-binding protein, indicating a possible GlnR-dependent link between carbon and nitrogen metabolism. Rigali et al. (2006) recently showed a direct association between carbon and nitrogen metabolism and S. coelicolor differentiation via a novel type of metabolic regulator, DasR, which senses the nutritional state of the environment.

Whether GlnR is also integrated into such regulatory networks remains to be determined.

GlnR activates or represses transcription of several genes

Fink et al. (2002) have shown that GlnR activates the transcription of the GSI-encoding gene glnA. By comparing the transcription levels of all GlnR target genes in S. coelicolor M145 and in the glnR mutant strain, we confirmed a weak GlnR-mediated activation of transcription for glnA and an activating effect for the transcription of glnII, amtB and nirB. Besides its function as an activator, GlnR also represses gene transcription, as shown for five GlnR target genes, gdhA, ureA, SCO0255, SCO0888 and SCO2404, whose expression was clearly decreased in M145 in a glnR-dependent manner.

These results were confirmed by RT analysis of M145 growing under different physiological conditions. Transcription of glnA, glnII, amtB and nirB was induced under nitrogen-limiting conditions, presumably owing to GlnR activation. Transcription of gdhA, ureA, SCO0255, SCO0888, SCO2400 and SCO2404 was repressed under nitrogen-limiting conditions and induced in complex medium with a sufficient nitrogen supply, supporting the idea that GlnR acts as repressor for these genes.

The GlnR-mediated activation of glnA and glnII (GSs), as well as the repression of gdhA (GDH), in response to nitrogen limitation is reasonable. These three gene products are involved in ammonium assimilation and the synthesis of the nitrogen donors glutamine and glutamate. Under N-limiting conditions, only the GSs are able to assimilate ammonium, while the GDH, with its relatively high Km (1 mM), is ineffective in ammonium assimilation in cells starved of nitrogen (Merrick and Edwards, 1995).

This dual repressor/activator function was also described for other OmpR-like regulators. OmpR, e.g. controls the transcription of E. coli ompF and ompC, two genes encoding porin proteins. Under conditions of high osmolarity, OmpR represses ompF and activates ompC transcription (Mizuno et al., 1988). The global nitrogen regulator TnrA (Bacillus subtilis) was shown to exhibit a dual repressor/activator function, too (Yoshida et al., 2003). TnrA only exerts its regulatory function under nitrogen-limiting conditions. It activates its own expression (Fisher, 1999; Robichon et al., 2000) and also the transcription of various genes involved in the uptake and reduction of nitrogen sources (Wray et al., 1994; Nakano et al., 1998) but represses the transcription of the dicistronic glnRA operon, encoding the GlnR regulator and a GS, as well as the gltAB operon, encoding a glutamate synthase (Yoshida et al., 2003).

Moreover, the expression pattern of S. coelicolor glnR itself was investigated: We showed that glnR transcription depends on nitrogen availability. The glnR gene was repressed at high nitrogen concentrations and induced in response to nitrogen limitation. Similar results were also obtained by van Wezel et al. (2000). Using reporter gene analysis with the glnR promoter region they showed that glnR promoter-activity was detectable with 0.1 mM ammonium while the presence of 10 mM ammonium resulted in a repression of the glnR promoter-activity.

Also dependent on nitrogen conditions is the transcription of the nitrogen regulatory genes glnR and tnrA of B. subtilis. In the presence of excess nitrogen GlnR represses its own expression as well as tnrA transcription (Brown and Sonenshein, 1996; Wray et al., 2000). Currently, we know that the transcriptional regulation of S. coelicolor glnR itself is dependent on nitrogen availability. What the signals are and how they are exerting their action will be the subject of future work.

GlnR is essential for assimilatory nitrite reduction

The essential substrate in nitrogen assimilation is ammonium. Ammonium is used by the GSs (encoded by glnA and glnII) and the GDH (encoded by gdhA). The GSs convert ammonium and glutamate to glutamine, while the GDH catalyses the amination of 2-oxoglutarate by ammonium to produce glutamate (Merrick and Edwards, 1995). Therefore, the supply of intracellular ammonium has to be ensured and that is why other nitrogen sources must be converted into the substrate ammonium. One possibility for this conversion is the reduction of nitrate via nitrite into ammonium in a nitrate and nitrite reductase dependent reaction.

RT-PCR analysis revealed a GlnR-mediated control of nitrite reductase (nirB) expression, which indicated that GlnR is involved not only in ammonium assimilation but also in ammonium supply. This was confirmed by physiological studies as the glnR mutant – in contrast to M145 – could not grow when supplied with nitrate. Therefore, expression of at least one gene required for nitrate reduction had to be impaired. To test which step of assimilatory nitrate reduction is defective, the Griess-Ilosvay reaction assay was performed. This experiment showed that the glnR mutant accumulated nitrite, indicating that the nitrite reductase and not the nitrate reductase reaction is blocked.

In contrast to nitrate, when ammonium was the sole nitrogen source, growth of the glnR mutant strain was observed, but it was reduced in comparison to the growth of M145. This phenotype is consistent with the RT-PCR analysis of the glnR mutant. There was only a weak signal for amtB transcription, indicating that the ammonium transporter was synthesized at a low level. However, ammonium uptake can also be mediated by passive diffusion (Detsch and Stülke, 2003) and does not only depend on the ammonium transporter AmtB; this fact explains why the mutant strain is still capable of growth.

The results of the glnR mutant growth experiments using nitrate or ammonium as the sole nitrogen source contradict previous publications in which this mutant was described as being glutamine auxotrophic (Wray et al., 1991). We could show that the glnR mutant strain was only glutamine auxotrophic when growing in the presence of nitrate because of an inability to reduce nitrite into ammonium, which is subsequently required to synthesize glutamine and glutamate. No glutamine auxotrophy phenotype was observed if the glnR mutant was growing in the presence of ammonium. Ammonium uptake and assimilation in the glnR mutant is still possible, although at a low level.

Recently, we were successful in generating a glnR deletion strain where glnR was exchanged by an aac(3)IV antibiotic resistance cassette (Y. Tiffert and J. Reuther, unpublished). Physiological characterization of this glnR mutant strain revealed a similar phenotype as we described for the FS55 strain: Nearly no growth on nitrate and a delayed growth on ammonium (data not shown). These results argue that GlnR affects ammonium uptake and assimilation but is additionally essential for nitrite reduction.

GlnR interacts with a 22mer binding box

The first consensus sequence for GlnR binding (GGTCAC-n5-CGAAAC-n5)2 was defined by comparing the binding sites upstream of glnA, amtB and SCO1863 (Fink et al., 2002). By performing computational studies and analysing the upstream regions of 13 GlnR target genes, it was possible to generate a reduced GlnR binding box sequence: gTnAc-n6-GaAAc-n6. The specific GlnR binding to the predicted binding box sequence was confirmed by DNase I footprinting analysis for the upstream regions of glnA, nirB and gdhA. For the glnA upstream sequence two regions with different GlnR binding affinities were detected. These distinct regions correspond to two conserved GlnR binding boxes. In the nirB upstream region the protected sequence stretch also contains two GlnR binding boxes. In the gdhA upstream region one predicted conserved binding box was protected from DNase I cleavage. One might speculate that the interaction of GlnR with one GlnR binding box results in a repression of gene expression (e.g. gdhA) while the recognition and binding of two boxes activates transcription of the GlnR target genes (e.g. glnA and nirB).

One binding box consists of two conserved 5mer sequences each followed by stretches of six variable nucleotides. The second 5mer sequence, GaAAc, is more highly conserved than the first 5mer, gTnAc. The molecular organization of the GlnR binding box is similar to that of the OmpR binding box defined by Yoshida et al. (2006). Each OmpR binding box consists of two OmpR binding subsites defined as the a-site and the b-site. OmpR specifically phosphorylated at a conserved aspartate residue (D-55 in OmpR; Delgado et al., 1993) has a higher affinity for the conserved b-site than for the upstream a-site. One OmpR dimer binds to the complete binding box composed of the a-site and the b-site. A similar binding model can be proposed for GlnR: One GlnR dimer may bind to the GlnR binding box gTnAc-n6-GaAAc-n6. The highly conserved GaAAc-n6 sequence resembles the b-site, whereas the less-conserved gTnAc-n6 sequence corresponds to the a-site. This model suggests that two GlnR dimers bind to the complete GlnR binding site gTnAc-n6-GaAAc-n6-GtnAC-n6-GAAAc-n6 (a-b-a-b), consisting of two binding boxes (Fig. 2A). Additionally, the affinity of GlnR binding might also be regulated by phosphorylation, as GlnR contains a conserved aspartate residue (D-50) at the possible phosphorylation site, as well as a tyrosine residue corresponding to OmpR T-83 (Fink et al., 2002). However, there is no evidence for the presence of a sensor kinase which might phosphorylate GlnR. GlnR represents an orphan regulator with no co-localized sensor-kinase-encoding gene (Wray and Fisher, 1993).

GlnR is involved in nitrogen control in other actinomycetes

Transcriptional nitrogen regulation was mainly studied in two genera of actinomycetes: in Corynebacterium and Streptomyces. AmtR of Corynebacterium glutamicum is a transcriptional repressor and controls the expression of at least 33 genes, including glnA; many of these genes are involved in nitrogen metabolism (Beckers et al., 2005). The AmtR binding motif was described by Jakoby et al. (2000) as ATCTATAGn1−4ATAG. This binding motif was not detectable in any glnA upstream region in the tested actinomycetes, pointing out that AmtR-mediated regulation is restricted to Corynebacterium and is not a widespread mechanism within actinomycetes.

As a transcriptional activator and a repressor, GlnR of S. coelicolor controls important pathways for nitrogen assimilation and supply and is likely to be involved in the regulation of other metabolic processes (Wray and Fisher, 1993; Fink et al., 2002; Reuther and Wohlleben, 2007; this work). Here we obtained first hints that GlnR has a central role in the nitrogen regulation of most actinomycetes. (i) All screened actinomycetes except C. glutamicum have a conserved GlnR binding site upstream of glnA. (ii) S. coelicolor GlnR binds specifically to the glnA upstream regions of different actinomycetes. (iii) Conserved GlnR binding sites were also identified in the upstream regions of additional nitrogen metabolism genes in different actinomycetes. (iv) Actinomycetes with the GlnR binding site upstream of glnA also contain a conserved GlnR homologue. The putative DNA recognition domains in all GlnR homologues are identical. Proof of the functional equivalence of GlnR proteins was recently provided by Yu et al. (2006). They showed that the actinomycete Amycolatopsis mediterranei possesses a GlnR-like protein which controls glnA transcription. The A. mediterranei glnR gene is able to complement an S. coelicolor glnR mutant, showing that the two glnR genes encode homologous regulators.

These results support the idea that actinomycetes have developed a specific regulatory mechanism for the transcriptional control of nitrogen assimilation. This system seems to be highly conserved in different actinomycetes although these bacteria exhibit diverse lifestyles and morphologies, from the single-celled pathogen M. tuberculosis to the soil bacterium S. coelicolor with its mycelium-like growth. In M. tuberculosis, several genes involved in nitrogen metabolism are known to contribute to virulence. An M. tuberculosis strain with a deletion of glnA (which encodes a GS) was avirulent (Tullius et al., 2003), and the level of extracellular GS for different strains of mycobacteria correlates with virulence (Raynaud et al., 1998). It is conceivable that nitrogen metabolism genes of Mycobacterium are under the control of a GlnR-homologous regulator, as demonstrated for the glnA gene by the binding of S. coelicolor GlnR to the M. tuberculosis glnA upstream region.

Therefore, we suggest S. coelicolor as a model organism for studying the regulation of nitrogen metabolism in Mycobacteria and other actinomycetes.

Experimental procedures

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Bacterial strains, plasmids and growth conditions

Strains and plasmids used in this study are listed in Table 3, primers in Tables 4–8.

Table 3.  Strains and plasmids used in this work.
Strains/plasmidsGenotypeReference
E. coli Xl1bluerecA1 hsdR17 relA1 lac[F′ lacqZM15Tn10(Tetr)]Bullock et al. (1987)
S. coelicolor M145 parental strainS. coelicolor A3(2), plasmid freeKieser et al. (2000)
S. coelicolor FS55glnR mutant strain of S. coelicolor M145, chemically mutagenizedWray et al. (1991)
SC/pGMS. coelicolor M145 with pGM190, kanr, tsrrThis work
SC/pGM–glnRS. coelicolor M145 with pGM–glnR, kanr, tsrrThis work
pGEM T-EasyCloning vectorPromega
pDRIVETA-cloning vectorQiagen
pDRIVE–glnRStrep–glnR fragment cloned into pDRIVEThis work
pJOE2775pBR322-derived vector with Prham expression cassette and C-terminal (His)6-tagVolff et al. (1996)
pYT9pJOE2775 with PCR amplified Strep–glnR cloned NdeI-HindIIIThis work
pGM190Streptomyces-E. coli shuttle vector, tsr, aphII, pSG5 derivate tipA promoterG. Muth (unpublished)
pGM–glnRpGM190 with PCR amplified Strep–glnR cloned NdeI-EcoRIThis work
Table 4.  Primers used for amplification of S. coelicolor M145 upstream regions.
OligonucleotideSequence (5′[RIGHTWARDS ARROW]3′)
  1. Underlined nucleotides indicate no homology to the template; used for PCR labelling.

lin_glnAupAGCCAGTGGCGATAAGCCACGATCCGATTGCTTGCC
lin_glnAlowAGCCAGTGGCGATAAGCCAGCTCCTCCTACTCCCGA
lin_amtBupAGCCAGTGGCGATAAGGCCAGGTCATTCGGAGGCCG
lin_amtBlowAGCCAGTGGCGATAAGCGGCGTCTCCTCGTCGTTGG
lin_glnIIupAGCCAGTGGCGATAAGCTGCTGCGCGGCTACGACGA
lin_glnIIlowAGCCAGTGGCGATAAGGGGGCCACATCCTTCGGGGT
lin_gdhAupAGCCAGTGGCGATAAGGTCAACGGCCAGATTCTGCG
lin_gdhAlowAGCCAGTGGCGATAAGCTTTCTGGCACGGCGGGCAC
lin_nirBupAGCCAGTGGCGATAAGACGGCGTCGATCCAGCCGGC
lin_nirBlowAGCCAGTGGCGATAAGGGCACCGAGCGTGCGGTGCG
lin_ureAupAGCCAGTGGCGATAAGAGCACCGGGGGCCGGACCCG
lin_ureAlowAGCCAGTGGCGATAAGTTACCACCTCACAGGGCATC
lin_SCO0255upAGCCAGTGGCGATAAGAGCGTGCGGGCGGGGAGCGC
lin_SCO0255lowAGCCAGTGGCGATAAGGACCGCCGCAGGCAGTTCCG
lin_SCO0888upAGCCAGTGGCGATAAGGTCGGCGCGCAGGCAGGGCT
lin_SCO0888lowAGCCAGTGGCGATAAGGAGTACTCCCACTGCTGGAA
lin_SCO2400upAGCCAGTGGCGATAAGCCCGACCACGTGTGTGCTGA
lin_SCO2400lowAGCCAGTGGCGATAAGGACGCGGGAAGGTTAAGTTC
lin_SCO2404upAGCCAGTGGCGATAAGACCTGCGGGAACTCACGCTG
lin_SCO2404lowAGCCAGTGGCGATAAGGGTCATCATCCTTGAGGTGA
lin_SCO1863upAGCCAGTGGCGATAAGCGAATGAGTGCCGCTTGTGT
lin_SCO1863lowAGCCAGTGGCGATAAGAAGCAGAATTTAAGAATTCT
lin_SCO2195upAGCCAGTGGCGATAAGGTGTGAAGTCCCGCACAAGT
lin_SCO2195lowAGCCAGTGGCGATAAGCGTGGAGGTCCCCCCTCGGT
lin_SCO7155upAGCCAGTGGCGATAAGAACGAGGCCGGAACCGGGGC
lin_SCO7155lowAGCCAGTGGCGATAAGGGGGGCTCATTTCGGTGTCG
lin_glnRupAGCCAGTGGCGATAAGGCCACATGACCCGGCGGTCG
lin_glnRlowAGCCAGTGGCGATAAGCACCTGCCTGGGACGGTTTG
lin_metBupAGCCAGTGGCGATAAGATGTCCAGCTCCTCCTCGCGG
lin_metBlowAGCCAGTGGCGATAAGCGAGGGTAGCCGTGCGGAAC
Table 5.  Oligonucleotides used as templates for amplification of actinomycete glnA upstream regions.
OligonucleotideSequence (5′[RIGHTWARDS ARROW]3′)
NocardioidesACGCACGGCCAGTTTCTCGACCGTATCCGGTTTGTTTCCGGCATGTAACAGG
P. acnesAGTTCGTATGAGTTGCTCGACCGTCACTGTTGTGTTTCGAGCGTGTAACAGG
RhodococcusCGCGTAACACGGGCGAAACAAAAGGTTGACCAGCGGGCAACACCAAGTCCTT
N. farcinicaCACGAAACATTCTCGTAACCCAAGTTTCGAGCCGGCGAAACGCGCGATTTTA
Frankia EAN1ACGGTAACATCTCGGAAACAACCCGGTGATATCCCCAGTACGCCATGCGGTC
B. longumCGTGTAACACCGGCGAAACACAGGCTTGATTGCTGGGAAACACCGGCTACTT
Table 6.  Primers used for amplification of actinomycete glnA upstream regions.
OligonucleotideSequence (5′[RIGHTWARDS ARROW]3′)
  1. Underlined nucleotides indicate no homology to the template; used for PCR labelling.

lin_nocardioides_upAGCCAGTGGCGATAAGCCTGTTACATGCCGGAAACA
lin_nocardioides_lowAGCCAGTGGCGATAAGACGCACGGCCAGTTTCTCGA
lin_p.acnes_upAGCCAGTGGCGATAAGCCTGTTACACGCTCGAAACA
lin_p.acnes_lowAGCCAGTGGCGATAAGAGTTCGTATGAGTTGCTCGA
lin_rhodococcus_upAGCCAGTGGCGATAAGCGCGTAACACGGGCGAAACA
lin_rhodococcus_lowAGCCAGTGGCGATAAGAAGGACTTGGTGTTGCCCGC
lin_b.longum_upAGCCAGTGGCGATAAGCACGAAACATTCTCGTAACC
lin_b.longum_lowAGCCAGTGGCGATAAGTAAAATCGCGCGTTTCGCCG
lin_frankia ean1_upAGCCAGTGGCGATAAGACGGTAACATCTCGGAAACA
lin_frankia ean1_lowAGCCAGTGGCGATAAGGACCGCATGGCGTACTGGGG
lin_n.farcinica_upAGCCAGTGGCGATAAGCGTGTAACACCGGCGAAACA
lin_n.farcinica_lowAGCCAGTGGCGATAAGAAGTAGCCGGTGTTTCCCAG
Table 7.  Primers used for amplification of the M. tuberculosis glnA upstream region and GlnR-binding fragment-1 and fragment-2 of the S. coelicolor M145 glnA upstream region.
OligonucleotideSequence (5′[RIGHTWARDS ARROW]3′)
  1. Underlined nucleotides indicate no homology to the template; used for PCR labelling.

lin_mycoglnAupAGCCAGTGGCGATAAGCAGTAACGTCTGCGCAACACGGGGTTGACTGACGGGCAATATCGGAATTCGCGGCCGCCT
lin_upglnA1boxupAGCCAGTGGCGATAAGGGTTAACTTCTGCGAAACAAATGAATTCGCGGCCGCCT
lin_upglnA2boxenupAGCCAGTGGCGATAAGGGTTAACTTCTGCGAAACAAATGGGTCACGCCCGAGAAATCACCGAATTCGCGGCCGCCT
lin_pGEMT-easy_lowAGCCAGTGGCGATAAGCATCCAACGCGTTGGGAGCT
Table 8.  RT primers used for amplification of S. coelicolor M145 genes.
OligonucleotideSequence (5′[RIGHTWARDS ARROW]3′)
rt_hrdB1 (as control)GAGTCCGTCTCTGTCATGGCG
rt_hrdB2 (as control)TCGTCCTCGTCGGACAGCACG
rt_glnA1GGGACAAGACCCTCAACATC
rt_glnA2CTTGTAGCGGACCTTGTAAC
rt_amtB1TCCTGGTCTTCCAGCTGATG
rt_amtB2TTGCCGATGACGAGGATCAC
rt_glnII1ACCTGGAGAACTGCCTGAAG
rt_glnII2TGATGATCGCGTCGTAACCC
rt_gdhA1ACGCGGAGGTCATGCGGTTC
rt_gdhA2TGGTGATCCGCCGGTACTGG
rt_nirB1CGTACGACACGCTGGTCCTG
rt_nirB2CGTACCGCCTTCGACAACCC
rt_ureA1GAGGTCGTCGCGCTGATCAC
rt_ureA2GGGATGCCCTCCATGACCTC
rt_SCO02551ACTCCTGGCAGCGTTCCAAG
rt_SCO02552GAACCCGTCAGTGCCTGTTC
rt_SCO08881TCCGCATCCTTGCGCTCGTC
rt_SCO08882CCCTCGAACAGCTGCACCTC
rt_SCO24001CACGCCCTGCCACGAACTCC
rt_SCO24002CACCCTCGTCGAGGGCTTCC
rt_SCO24041CTGAAGGCGGGCAAGAAGGG
rt_SCO24042TGCTTGGAGCGGACGACCAG
rt_SCO18631TGTCGCTCCTCGACTGGAAG
rt_SCO18632TGGTTGACCCGGATCATCTC
rt_SCO21951CAGGCCGCGCCCGTTCGCCC
rt_SCO21952ATTCTCAGGGGCGGCCGGCGAC
rt_SCO71551AGATCGTCGAGCAGGGTGAG
rt_SCO71552CCAGCGCGAGTTCCTGGAAG
rt_glnR1GACGACGTACTGCTCGACAC
rt_glnR2TCGGCCTTCTCGGACTTATC

Streptomyces coelicolor M145 was cultivated on R2YE agar (Kieser et al., 2000) for regeneration and on MS agar (Kieser et al., 2000), supplemented with 40 mM glutamine for S. coelicolor FS55, for generating spore suspensions. For liquid growth, nitrogen-rich S-medium (peptone, yeast extract, K2HPO4, KH2PO4, glycine, glucose, MgSO4; total nitrogen: 185 mM) (Okanishi et al., 1974) and the nitrogen-limited, minimal medium N-Evans were used (Fink et al., 2002). 10 mM nitrate in N-Evans was substituted for 5 mM (RT-PCR experiments, Griess-Ilosvay reaction) or 100 mM nitrate or ammonium (growth behaviour of S. coelicolor FS55 and M145 on agar plates). For N-Evans agar plates, 16 g Agar-Agar (Roth) was added. If necessary, 25 μg ml−1 kanamycin or 12.5 μg ml−1 thiostrepton was added.

Escherichia coli was cultivated at 37°C in LB medium or on LB Agar (Miller, 1972). Ampicillin (150 μg ml−1) or kanamycin (50 μg ml−1) was added, if necessary.

Manipulation of S. coelicolor M145 and E. coli was performed as described by Kieser et al. (2000) and Sambrook et al. (1989) respectively.

Genomic DNA isolation

After spore inoculation, the S. coelicolor M145 strain was grown for 4 days in S-medium and genomic DNA preparation was performed with the NucleoSpin® Tissue Kit (Macherey-Nagel).

Protein expression in E. coli

For expression in E. coli, glnR was amplified with primers 5′-TGTGGAGCCACCCGCAGTTCGAAAAAAGTTCTCTGCTGCTCCTG and 5′-GAATTCTCACACCTTGGATGACCTT, adding a sequence encoding an N-terminal StrepII-tag using Taq polymerase (Qiagen), and subcloned into the pDRIVE cloning vector (Qiagen). After digestion with NdeI and HindIII, Strep–glnR was cloned into pJOE2775 under the control of the Prham promoter, resulting in pYT9. Gene expression was induced with 0.2% rhamnose for 12 h.

Cells were harvested; washed with a solution of 50 mM Tris, 100 mM NaCl and 10 mM β-mercaptoethanol, pH 8; and broken by French press (American Instruments) with three consecutive passages at 700 p.s.i. In order to prevent proteolytic degradation, the CompleteTM protease inhibitor cocktail (Roche) was added. Cell debris and membrane fractions were separated from the soluble fraction by centrifugation (45 min; 15 000 r.p.m.; 4°C). Purification of Strep–GlnR tagged proteins from the soluble fraction was performed at 7°C with StrepTactin Superflow gravity flow columns (IBA), according to the manufacturer's instructions.

Protein expression in S. coelicolor M145

For the expression of glnR in S. coelicolor M145, the Strep–glnR fragment was excised from pDRIVE with NdeI and EcoRI and inserted into the shuttle plasmid pGM190 under the control of the PtipA promoter, resulting in pGM–glnR. Gene expression was induced with 12.5 μg ml−1 thiostrepton for 12, 24 or 36 h.

After growth in S-medium, the cells were harvested; washed with a solution of 50 mM Tris, 100 mM NaCl and 10 mM β-mercaptoethanol, pH 8; and disrupted (6500 r.p.m., 1× 20–30 s) with a Precellys Homogenizer (Peqlab). To prevent proteolytic degradation, the CompleteTM protease inhibitor cocktail (Roche) was added. Cell debris and membrane fractions were separated from the soluble fraction by centrifugation (15 min; 13 000 r.p.m.; 24°C). Protein concentration was determined by performing Bradford assays.

Western blot analysis

SDS-PAGE was carried out using 15% polyacrylamide gels with Tris-glycine buffer as described by Laemmli (1970). Proteins were transferred onto a nitrocellulose membrane by semidry electroblotting (25 mM Tris, 150 mM Glycine, 20% methanol, pH 9.2) for 30 min at 400 mA. The membrane was incubated for 1 h with anti-GSI or anti-GSII specific polyclonal antibodies generated in rabbits (SEQLAB) and diluted in TBST buffer (10 mM Tris, 150 mM NaCl, 0.05% Tween 20). Antibody binding was detected using an anti-rabbit IgG horse-radish-peroxidase-conjugated antiserum (Bio-Rad) and the ECL detection solution (GE Healthcare).

Electrophoretic mobility shift assay

DNA fragments containing the different S. coelicolor M145 upstream regions were amplified with Taq polymerase (Qiagen) using genomic DNA of S. coelicolor M145 and primers listed in Table 4.

With the templates noted in Table 5 and the primers of Table 6, the different actinomycete glnA upstream regions were amplified.

For the amplification of the glnA upstream region of Mycobacterium tuberculosis, as well as for the GlnR-binding fragment-1 and binding fragment-2 of the glnA upstream region from S. coelicolor M145, forward primers with the different glnA attachments were created (Table 7). Additionally, for achieving the same glnA DNA amplification length, both primers – reverse and forward with glnA attachment – were created to bind to the pGEM T-Easy vector.

The PCR conditions for the amplification of the upstream regions were 94°C for 3 min; then 30 cycles of 94°C for 45 s, 60°C for 45 s and 72°C for 60 s; and a final extension at 72°C for 10 min.

The DNA fragments were purified using S-400 Microspins (GE Healthcare).

Fragment labelling was performed via PCR using the primer 5′-AGCCAGTGGCGATAAG-3′, which was labelled with Cy5 at the 5′ end. The PCR conditions for Cy5 labelling were 94°C for 3 min; then 35 cycles of 94°C for 45 s, 50°C for 45 s and 72°C for 60 s; and an extension at 72°C for 10 min.

2% TAE agarose gels were used for agarose EMSA. The amount of DNA in each reaction was 2 ng and the amount of protein was 55 and 1450 nM.

In the case of the different glnA upstream regions, polyacrylamide gels (5%) were used with 1× TBE. The DNA was mixed with different amounts (55 and 1450 nM) of GlnR in reaction buffer (50 mM Tris, 100 mM NaCl, 10 mM β-mercaptoethanol, pH 8) and incubated for 15 min at 24°C. After incubation, loading buffer without bromphenol blue (0.25× TBE buffer, 60%, glycerol; Roche) was added and the fragments were separated by PAGE. DNA bands were visualized by fluorescence imaging using a Typhoon Trio+ Variable Mode Imager (GE Healthcare).

Calculation of Kd-values was carried out as described earlier (Licht and Brantl, 2006).

DNase I footprinting

Limited hydrolysis of free DNA and DNA–protein complexes was performed with DNA fragments isolated after restriction digests from corresponding plasmid vectors. A PstI/XbaI fragment with the glnA upstream regulatory region was used for the analysis of the coding strand after end-labelling with Klenow polymerase (Promega) and [α-32P]-dATP. The corresponding non-coding strand was obtained after a Klenow fill-in reaction with the corresponding BamHI/SacI fragment. For the analysis of the gdhA coding strand a PstI/BglII digested DNA fragment was labelled with [α-32P]-dATP as described above. Samples were incubated in the presence of 0.5 mU DNase I μl−1 for 30 s at 25°C. Hydrolysis was stopped by addition of 330 mM NaOAc, pH 4.8, 10 mM EDTA, 10 ng μl−1 glycogen followed by phenol extraction. A G- and A-specific sequence ladder was generated by chemical cleavage of the respective DNA fragments according to Maxam and Gilbert (1980). Samples were separated on 8% or 10% denaturing polyacrylamide gels and visualized by autoradiography.

Reverse transcription-PCR

Comparison of S. coelicolor M145 versus S. coelicolor FS55:

Streptomyces coelicolor M145 and FS55 were grown for 4 days in S-medium. Cells were washed twice in 5 mM nitrate N-Evans medium and inoculated into fresh N-Evans for 5 h before RNA extraction.

Comparison of S. coelicolor M145 in complex and N-limiting media:

Streptomyces coelicolor M145 was grown for 4 days in S-medium and in N-Evans. Cell disruption was performed with glass beads (150–212 μm, Sigma) and a Precellys Homogenizer (6500 r.p.m., 1× 20–30 s; Peqlab). RNA was isolated with the RNeasy kit from Qiagen. The DNase digestion was performed twice, the first time on column for 30 min at 24°C and the second time for 1.5 h at 37°C with DNase I from Fermentas. Three micrograms of RNA was used for a reverse transcription reaction which was performed with enzymes and cofactors from Fermentas. As primers, random nonamers from Sigma were used. PCR reactions were performed with primers listed in Table 8.

The PCR conditions were 95°C for 5 min; then 35 cycles of 95°C for 15 s, 55°C for 30 s and 72°C for 20 s; and an extension at 72°C for 5 min.

RT-PCR was repeated two times with RNA isolated from four independently grown cultures. The PCR products were quantified with agarose gels and ethidium bromid staining.

Griess-Ilosvay-reaction to verify nitrite

Streptomyces coelicolor M145 and S. coelicolor FS55 were grown for 4 days in S-medium. Cells were washed twice in 5 mM nitrate N-Evans and inoculated into fresh N-Evans for 12 h before a Griess-Ilosvay-reaction was performed. Three millilitres of supernatant was incubated for 1 min at 24°C with 0.1 ml Griess-Ilosvay-reagent (Merck).

Computional analysis

The MEME/MAST tools (http://meme.sdsc.edu) were used to identify GlnR binding sites in the genomic sequence of S. coelicolor M145. For binding site motif discovery, the sequences of the known GlnR binding sites were submitted to the search tool MEME (Bailey and Elkan, 1994). The position specific scoring matrix generated by MEME was submitted to the tool MAST (Bailey and Gribskov, 1998) to screen a library of upstream sequences (−1 to −250) of all annotated genes of S. coelicolor M145.

For GlnR alignment, ClustalX (Thompson et al., 1997) and GeneDoc (Nicholas et al., 1997) were used.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

We wish to thank S. Fisher for providing the S. coelicolor strain FS55. The authors are grateful to G. Muth for discussions and critical reading of the manuscript. Y. T. acknowledges a scholarship from the Studienstiftung des deutschen Volkes. This work was supported by the EU (LSH 4032, ActinoGen) and by the BMBF as part of the SYSMO project (5019).

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  • Bailey, T.L., and Elkan, C. (1994) Fitting a mixture model by expection maximization to discover motifs in biopolymers. Proc Int Conf Intell Syst Mol Biol 2: 2836.
  • Bailey, T.L., and Gribskov, M. (1998) Combining evidence using P-values: application to sequence homology searches. Bioinformatics 14: 4854.
  • Beckers, G., Strösser, J., Hildebrandt, U., Kalinowski, J., Farwick, M., Krämer, R., et al. (2005) Regulation of AmtR-controlled gene expression in Corynebacterium glutamicum: mechanism and characterization of the AmtR regulon. Mol Microbiol 58: 580595.
  • Belitsky, B.R., Wray, L.V., Jr, Fisher, S.H., Bohannon, D.E., and Sonenshein, A.L. (2000) Role of TnrA in nitrogen source-dependent repression of Bacillus subtilis glutamate synthase gene expression. J Bacteriol 182: 59395947.
  • Bentley, S.D., Chater, K.F., Cerdeno-Tarraga, A.M., Challis, G.L., Thomson, N.R., James, K.D., et al. (2002) Complete genome sequence of the model actinomycete Streptomyces coelicolor A3(2). Nature 417: 141147.
  • Bérdy, J. (2005) Bioactive microbial metabolites. J Antibiot (Tokyo) 58: 126.
  • Brandenburg, J.L., Wray, L.V., Jr, Beier, L., Jarmer, H., Saxild, H.H., and Fisher, S.H. (2002) Roles of PucR, GlnR, and TnrA in regulating expression of the Bacillus subtilis ure P3 promoter. J Bacteriol 184: 60606064.
  • Brown, S.W., and Sonenshein, A.L. (1996) Autogenous regulation of the Bacillus subtilis glnRA operon. J Bacteriol 178: 24502454.
  • Bullock, W.O., Fernandez, J.M., and Short, J.M. (1987) XL1-Blue, a high efficiency plasmid transforming recA Escherichia coli strain with beta galactosidase selection. Biotechniques 5: 376378.
  • Burkovski, A. (2003) Ammonium assimilation and nitrogen control in Corynebacterium glutamicum and its relatives: an example for new regulatory mechanisms in actinomycetes. FEMS Microbiol Rev 27: 617628.
  • Carlson, T.A., Martin, G.B., and Chelm, B.K. (1987) Differential transcription of the two glutamine synthetase genes of Bradyrhizobium japonicum. J Bacteriol 169: 58615866.
  • Chater, K.F. (2001) Regulation of sporulation in Streptomyces coelicolor A3(2): a checkpoint multiplex? Curr Opin Microbiol 4: 667673.
  • Delgado, J., Forst, S., Harlocker, S., and Inouye, M. (1993) Identification of a phosphorylation site and functional analysis of conserved aspartic acid residues of OmpR, a transcriptional activator for ompF and ompC in Escherichia coli. Mol Microbiol 10: 10371047.
  • Detsch, C., and Stülke, J. (2003) Ammonium utilization in Bacillus subtilis: transport and regulatory functions of NrgA and NrgB. Microbiology 149: 32893297.
  • Fink, D., Weissschuh, N., Reuther, J., Wohlleben, W., and Engels, A. (2002) Two transcriptional regulators GlnR and GlnRII are involved in regulation of nitrogen metabolism in Streptomyces coelicolor A3(2). Mol Microbiol 46: 331347.
  • Fisher, S.H. (1999) Regulation of nitrogen metabolism in Bacillus subtilis: vive la difference! Mol Microbiol 32: 223232.
  • Hesketh, A., Fink, D., Gust, B., Rexer, H.-U., Scheel, B., Chater, K.F., et al. (2002) The GlnD and GlnK homologues of Streptomyces coelicolor A3(2) are functionally dissimilar to their nitrogen regulatory system counterparts from enteric bacteria. Mol Microbiol 46: 319330.
  • Jakoby, M., Nolden, L., Meier-Wagner, J., Kramer, R., and Burkovski, A. (2000) AmtR, a global repressor in the nitrogen regulation system of Corynebacterium glutamicum. Mol Microbiol 37: 964977.
  • Kieser, T., Bibb, M.J., Buttner, M., Chater, K.F., and Hopwood, D.A. (2000) Practical Streptomyces Genetics. Norwich: The John Innes Foundation.
  • Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680685.
  • Licht, A., and Brantl, S. (2006) Transcriptional repressor CcpN from Bacillus subtilis compensates asymmetric contact distribution by cooperative binding. J Mol Biol 364: 434448.
  • Magasanik, B. (1982) Genetic control of nitrogen assimilation in bacteria. Ann Rev Genet 16: 135168.
  • Martinez-Hackert, E., and Stock, A.M. (1997) Structural relationships in the OmpR family of winged-helix transcription factors. J Mol Biol 269: 301312.
  • Maxam, A.M., and Gilbert, W. (1980) Sequencing endlabeled DNA with base-specific chemical cleavages. Methods Enzymol 65: 499560.
  • Merrick, M.J., and Edwards, R.A. (1995) Nitrogen control in bacteria. Microbiol Rev 59: 604622.
  • Miller, J.H. (1972) Experiments in Molecular Genetics. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
  • Mizuno, T., Kato, M., Jo, Y.L., and Mizushima, S. (1988) Interaction of OmpR, a positive regulator, with the osmoregulated ompC and ompF genes of Escherichia coli. Studies with wild-type and mutant OmpR proteins. J Biol Chem 263: 10081012.
  • Moir, J.W.B., and Wood, N.J. (2001) Nitrate and nitrite transport in bacteria. Cell Mol Life Sci 58: 215224.
  • Nakano, M.M., Yang, F., Hardin, P., and Zuber, P. (1995) Nitrogen regulation of nasA and the nasB operon, which encode genes required for nitrate assimilation in Bacillus subtilis. J Bacteriol 177: 573579.
  • Nakano, M.M., Hoffman, T., Zhu, Y., and Jahn, D. (1998) Nitrogen and oxygen regulation of Bacillus subtilis nasDEF encoding NADH-dependent nitrite reductase by TnrA and ResDE. J Bacteriol 180: 53445350.
  • Nicholas, K.B., Nicholas, H.B., Jr, and Deerfield, D.W., II (1997) GeneDoc: analysis and visualization of genetic variation. EMBNEW News 4: 14.
  • Ninfa, A.J., and Jiang, P. (2005) PII signal transduction proteins: sensors of alpha-ketoglutarate that regulate nitrogen metabolism. Curr Opin Microbiol 8: 168173.
  • Okanishi, M., Suzuki, K., and Umezawa, H. (1974) Formation and reversion of streptomycetes protoplasts: cultural condition and morphological study. J Gen Microbio 80: 389400.
  • Raynaud, C., Etienne, G., Peyron, P., Laneelle, M.A., and Daffe, M. (1998) Extracellular enzyme activities potentially involved in the pathogenicity of Mycobacterium tuberculosis. Microbiology 144: 577587.
  • Reitzer, L., and Schneider, B.L. (2001) Metabolic context and possible physiological themes of sigma (54)-dependent genes in Escherichia coli. Microbiol Mol Biol Rev 65: 422444.
  • Reuther, J., and Wohlleben, W. (2007) Nitrogen metabolism in Streptomyces coelicolor: transcriptional and post-translational regulation. J Mol Microbiol Biotechnol 12: 139146.
  • Rigali, S., Nothaft, H., Noens, E.E., Schlicht, M., Colson, S., Muller, M., et al. (2006) The sugar phosphotransferase system of Streptomyces coelicolor is regulated by the GntR-family regulator DasR and links N-acetylglucosamine metabolism to the control of development. Mol Microbiol 61: 12371251.
  • Robichon, D., Arnaud, M., Gardan, R., Pragai, Z., O'Reilly, M., Rapoport, G., et al. (2000) Expression of a new operon from Bacillus subtilis, ykzB-ykoL, under the control of the TnrA and PhoP-PhoR global regulators. J Bacteriol 182: 12261231.
  • Rudd, B.A., and Hopwood, D.A. (1980) A pigmented mycelial antibiotic in Streptomyces coelicolor: control by a chromosomal gene cluster. J Gen Microbiol 119: 333340.
  • Sambrook, J., Fritsch, E.F., and Manzanal, T. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
  • Schreier, H.J., Brown, S.W., Hirschi, K.D., Nomellini, J.F., and Sonenshein, A.L. (1989) Regulation of Bacillus subtilis glutamine synthetase gene expression by the product of the glnR gene. J Mol Biol 210: 5163.
  • Spinosa, M., Riccio, A., Mandrich, L., Manco, G., Lamberti, A., Iaccarino, M., et al. (2000) Inhibition of glutamine synthetase II expression by the product of the gstl gene. Mol Microbiol 37: 443452.
  • Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., and Higgins, D.G. (1997) The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 24: 48764882.
  • Tullius, M.V., Harth, G., and Horwitz, M.A. (2003) Glutamine synthetase GlnA1 is essential for growth of Mycobacterium tuberculosis in human THP-1 macrophages and guinea pigs. Infect Immun 71: 39273936.
  • Volff, J.N., Eichenseer, C., Viell, P., Piendl, W., and Altenbuchner, J. (1996) Nucleotide sequence and role in DNA amplification of the direct repeats composing the amplifiable element AUDI of Streptomyces lividans 66. Mol Microbiol 21: 10371047.
  • Weisschuh, N., Fink, D., Vierling, S., Bibb, M.J., Wohlleben, W., and Engels, A. (2000) Transcriptional analysis of the gene for glutamine synthetase II and two upstream genes in Streptomyces coelicolor A3(2). Mol Gen Genet 264: 461469.
  • Van Wezel, G.P., White, J., Hoogvliet, G., and Bibb, M. (2000) Application of redD, the transcriptional activator gene of the undecylprodigiosin biosynthetic pathway, as a reporter for transcriptional activity in Streptomyces coelicolor A3(2) and Streptomyces lividans. J Mol Microbiol Biotechnol 2: 551556.
  • Wray, L.V., Jr, and Fisher, S.H. (1993) The Streptomyces coelicolor glnR gene encodes a protein similar to other bacterial response regulators. Gene 130: 145150.
  • Wray, L.V., Jr, Atkinson, M.R., and Fisher, S.H. (1991) Identification and cloning of the glnR locus, which is required for transcription of the glnA gene in Streptomyces coelicolor. J Bacteriol 173: 73517360.
  • Wray, L.V., Jr, Atkinson, M.R., and Fisher, S.H. (1994) The nitrogen-regulated Bacillus subtilis nrgAB operon encodes a membrane protein and a protein highly similar to the Escherichia coli glnB-encoded PII protein. J Bacteriol 176: 108114.
  • Wray, L.V., Jr, Ferson, A.E., Rohrer, K., and Fisher, S.H. (1996) TnrA, a transcription factor required for global nitrogen regulation in Bacillus subtilis. Proc Natl Acad Sci USA 93: 88418845.
  • Wray, L.V., Jr, Ferson, A.E., and Fisher, S.H. (1997) Expression of the Bacillus subtilis ureABC operon is controlled by multiple regulatory factors including CodY, GlnR, TnrA, and Spo0H. J Bacteriol 179: 54945501.
  • Wray, L.V., Jr, Zalieckas, J.M., and Fisher, S.H. (2000) Purification and in vitro activities of the Bacillus subtilis TnrA transcription factor. J Mol Biol 300: 2940.
  • Yoshida, K., Yamaguchi, H., Kinehara, M., Ohki, Y.H., Nakaura, Y., and Fujita, Y. (2003) Identification of additional TnrA-regulated genes of Bacillus subtilis associated with a TnrA box. Mol Microbiol 49: 157165.
  • Yoshida, T., Qin, L., Egger, L.A., and Inouye, M. (2006) Transcription regulation of ompF and ompC by a single transcription factor, OmpR. J Biol Chem 281: 1711417123.
  • Yu, H., Peng, W.-T., Liu, Y., Wu, T., Yao, Y.-F., Cui, M.-X., et al. (2006) Identification and characterization of glnA promoter and its corresponding trans-regulatory protein GlnR in the rifamycin SV producing actinomycete, Amycolatopsis mediterranei U32. Acta Biochim Biophys Sin 38: 831843.
  • Zalieckas, J.M., Wray, L.V., Jr, and Fisher, S.H. (2006) Cross-regulation of the Bacillus subtilis glnRA and tnrA genes provides evidence for DNA binding site discrimination by GlnR and TnrA. J Bacteriol 188: 25782585.