SEARCH

SEARCH BY CITATION

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgement
  8. References

A secreted competence-stimulating peptide (CSP), encoded by comC, constitutes, together with the two-component system ComD-ComE, the master switch for competence induction in Streptococcus pneumoniae. Interaction between CSP and its membrane-bound histidine-kinase receptor, ComD, is believed to lead to autophosphorylation of ComD, which then transphosphorylates the ComE response regulator to activate transcription of a limited set of genes, including the comCDE operon. This generates a positive feedback loop, amplifying the signal and co-ordinating competence throughout the population. On the other hand, the promoter(s) and proteins important for basal comCDE expression have not been defined. We now report that CSP-induced and basal comCDE transcription both initiate from the same promoter, PE; that basal expression necessitates the presence of both ComD and a phosphate-accepting form of ComE, but not CSP; and that overexpression of ComER120S triggers ComD-dependent transformation in the absence of CSP. These observations suggest that self-activation of ComD is required for basal comCDE expression. We also establish that transcriptional readthrough occurs across the tRNAArg5 terminator and contributes significantly to comCDE expression. Finally, we demonstrate by various means, including single-cell competence analysis with GFP, that readthrough is crucial to avoid the stochastic production of CSP non-responsive cells lacking ComD or ComE.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgement
  8. References

Induction of competence for natural genetic transformation in Streptococcus pneumoniae depends on a signalling pathway consisting of the competence-stimulating peptide (CSP) (Håvarstein et al., 1995) and a two-component regulatory system (TCS), ComD–ComE (Pestova et al., 1996). The interaction between the secreted CSP and its membrane-embedded histidine kinase (HK) receptor ComD is believed to bring on a conformational change in the ComD transmembrane domain that ultimately results in activation of ComD kinase activity. A comparison of highly homologous ComD receptors, which are specific for different but closely related pheromone types, show that they are most divergent in the first 60–100 N-terminal aa residues. This part of the ComD receptor, which contains two or three membrane-spanning segments, is likely to determine the specificity of the receptor–ligand interaction (Håvarstein et al., 1996). According to a current model, once activated, ComD phosphorylates its cognate response regulator (RR) ComE. ComE∼P then activates transcription of the early competence (com) genes (Claverys and Håvarstein, 2002; Claverys et al., 2006). These genes include the comCDE (Fig. 1, Top) and comAB operons. The latter encodes the machinery required for maturation and export of the comC-encoded pre-CSP (Hui et al., 1995). Thus, by increasing CSP production and export capacity, this transcriptional activation promotes the autocatalytic accumulation of CSP that presumably accounts for the rapid development and synchronization of competence in pneumococcal cultures. The early com genes also include comX, which encodes an alternative sigma factor (Lee and Morrison, 1999) that directs the transcription of a large number of so-called late com genes. The latter includes genes required for the uptake and processing of transforming DNA into recombinants (Claverys and Håvarstein, 2002; Claverys et al., 2006).

image

Figure 1. The master competence control operon of S. pneumoniae. Top. Chromosomal organization of the comCDE region. htrA encodes a stress response extracellular protease and orfL encodes the orthologue of E. coli YbeA (redesignated RlmH), which methylates 23S rRNA. The region within the rectangle is carried by plasmid pR414 (Bottom). Middle. Enlarged view of the tRNAArg5-comC region. Pt represents the tRNAArg5 promoter (Pestova et al., 1996), terL/R the tRNAArg5 transcription terminator (Guiral et al., 2006a), CEbs the ComE binding site (Ween et al., 1999), −10 the promoter box (this work) and +1 the transcriptional start (Halfmann et al., 2007). Bottom. Structure of the comCDE region following chromosomal integration of plasmid pR414. Integration creates a comC::luc fusion. The region within the rectangle (Top) is entirely duplicated (leaving an intact comCDE region downstream of pR414) in wild-type recipient cells (not shown) but only partially duplicated in ΔcomC recipient cells. As shown here, the comDE operon is thus preceded by normal regulatory sequences.

Download figure to PowerPoint

The presence of a direct repeat in the comCDE promoter region, which is bound by ComE in vitro (CEbs) (Ween et al., 1999), and the location of the start of CSP-induced comCDE transcripts (Halfmann et al., 2007) with respect to CEbs (Fig. 1, Middle) are consistent with the model of ComE-dependent transcriptional activation of comCDE in response to CSP. On the other hand, while it is common to assume a ‘basal level of expression’ of the competence pheromone and of the TCS that responds to it, no one has previously defined basal expression of either genes, nor established how it might be regulated.

Here, we provide evidence that non-autocatalytic comCDE transcription (i.e. expression outside the transcriptional burst co-ordinated by CSP; we will also refer to this as basal expression) relies on the same promoter element (−10 box) as CSP-induced expression. We identify two proteins important for the basal expression, ComD and ComE, and show that non-autocatalytic comCDE expression necessitates the presence of a phosphate-accepting form of ComE, but not CSP. These observations imply that self-activation of ComD is responsible for the non-autocatalytic expression of comCDE. We also document the occurrence of transcriptional readthrough across the transcription terminator of tRNAArg5 upstream of comCDE. This finding establishes that two (possibly three) promoters drive basal expression of the comCDE operon. Finally, we provide evidence that this readthrough is crucial to counteract the accidental production of cells devoid of ComE or ComD, which would otherwise be unable to reactivate the competence cascade or respond to CSP.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgement
  8. References

Competence-stimulating peptide-induced and basal comCDE transcription initiate from the same −10 box

Throughout this study, expression of the comCDE operon (Fig. 1, Top) was investigated using transcriptional fusions with the luc gene. Placement of luc downstream of the start of comC was achieved by homology-dependent integration of pR414, a non-replicative recombinant plasmid (Table 1) which carries a comC fragment (Fig. 1, Middle and Bottom). Light emission, which results from luciferase activity, was directly measured in cultures of pneumococci actively growing in luciferin-containing medium (Prudhomme and Claverys, 2007). We first wished to characterize the comCDE promoter(s). The previously identified start of the CSP-induced comCDE transcript (Halfmann et al., 2007) is preceded by a potential −10 box [TtTtgTATAAT; upper case nucleotides indicate matches with an extended −10 promoter (Sabelnikov et al., 1995)] (Fig. 1, Middle). The first two bases in the −10, which have been shown to be critical for promoter activity in S. pneumoniae (Sabelnikov et al., 1995), were mutated (TATAAT changed to gcTAAT; Experimental procedures). When placed upstream of the comC::luc fusion, this mutation abolished the response to CSP (Fig. 2A). As strain R1844, which carries a recombinant plasmid with the mutant −10 box in front of luc, harbours a comDE operon preceded by a wild-type −10 box immediately downstream of the plasmid, CSP-induced transformation was monitored in parallel with luc expression. Transformation frequencies similar to those routinely obtained with wild-type cells were observed (data not shown) indicating that R1844 was fully CSP responsive. This finding demonstrated that the mutation of the −10 box prevented expression of the comC::luc fusion despite full activation of ComD-ComE by CSP. These results provide direct evidence that CSP-induced comCDE transcription initiates from this promoter (PE).

Table 1.  Strains, plasmids, and primers used in this study.
S. pneumoniae strainsGenotypea/descriptionSource/reference
  • a.

    R, resistance; Ap, ampicillin; Cm, chloramphenicol; Ery, erythromycin; Kan, kanamycin; Nov, novobiocin; Rif, rifampicin; Spc, spectinomycin; Str, streptomycin.

  • b.

    Lowercase letters indicate nucleotide different from the S. pneumoniae genome sequence, to introduce mutations or convenient restriction sites (underlined). In ssbB8, the underlined sequence indicate matches to the 3′ sequence of the ami operon (positions 1,672,415–1672 379 in the R6 genome) and bold italics a XhoI site. Note that the single nucleotide change introduced into primers VH10 and VH11 to create the comED58A mutation abolishes an EcoRV site (underlined).

  • c.

    3′ oligonucleotide position given with respect to the ATG of the corresponding gene; – and + indicate upstream and downstream respectively.

  • d.

    Primer sequence complementary to VH10.

  • e.

    Primer sequence complementary to VH13.

  • C

    and A indicate, respectively, the co-transcribed and the reverse orientation of an inserted mini-transposon antibiotic resistance cassette with respect to the targeted gene.

R304R800 derivative, nov1, rif23, str41; NovR, RifR, SmRMortier-barrière et al. (1998)
R310R800 but hexA::spc; SpcRMortier-barrière et al. (1998)
R315ΔcomCDE; CmRAlloing et al. (1998)
R682R801 but comC::pXF520, comER120S (also called cup10), comA::ermAMA, ebg::kan; CmR, EryR, KanRMartin et al. (2000)
R800R6 derivativeLefèvre et al. (1979)
R801R6x derivative, hexBLefèvre et al. (1979)
R825R800 but comC::luc (pR414), comC+; EryRBergéet al. (2002)
R895R800 but ssbB::luc (pR424), ssbB+; CmRChastanet et al. (2001)
R1477R800 but CEPM-comE (see Experimental procedures); KanRThis study
R1478R800 but CEPM-comER120S (see Experimental procedures); KanRThis study
R1501R800 but ΔcomCDagkessamanskaia et al. (2004)
R1502R1501 but ssbB::luc (pR424), ssbB+; CmRDagkessamanskaia et al. (2004)
R1521R1501 but comC::luc (pR414), ΔcomC; EryRThis study
R1619R1521 but CEPM-comE (from strain R1477); EryR, KanRThis study
R1627R1521 but comE::spc20C (see Experimental procedures); EryR, SpcRThis study
R1628R1619 but comE::spc20C; EryR, KanR, SpcRThis study
R1648R1619 but ΔcomCDE; CmR, EryR, KanRThis study
R1649R1521 but CEPM-comER120S(from strain R1478); EryR, KanRThis study
R1655R1649 but comE::spc20C; EryR, KanR, SpcThis study
R1662R1502 but CEPM-comER120S(from strain R1478); CmR, KanRThis study
R1669R1662 but comE::spc20C; CmR, KanR, SpcRThis study
R1694R1501 but tRNAArg5::luc (pR434); CmRThis study
R1742R1694 but comE::spc20C; CmR, SpcRThis study
R1785R1521 but hexA::spc (from strain R310); EryR, SpcRThis study
R1798R1785 but comED58A (from plasmid pR435; see Experimental procedures); EryR, SpcRThis study
R1816R1649 but ΔcomCDE (from strain R315); EryR, CmR, KanRThis study
R1843R1501 but hexA::spc (from strain R310); SpcRThis study
R1844R1843 but comC::luc (integrated reporter plasmid carrying a comCDE−10 mutated to GCTAAT; see Experimental procedures); CmR, SpcRThis study
R2780R800 but comC′::luc[vector]T1T2-comC+(see Fig. 7A); CmRThis study
R2782R800 but T1T2-comC’::luc[vector]T1T2-comC+(see Fig. 7A); CmRThis study
R2784R800 but T1T2-comC’::luc[vector]comC+(see Fig. 7A); CmRThis study
R2786R800 but comC′::luc[vector]comC+(see Fig. 7A); CmRThis study
R2801R2780 but CEPX-gfp(Sp) (from plasmid pCN35A); CmR, KanRThis study
R2807R2786 but CEPX-gfp(Sp) (from plasmid pCN35A); CmR, KanRThis study
Plasmids
pCEPpSC101 derivative (i.e. low copy number plasmid) carrying CEP; KanR, SpcRGuiral et al. (2006b)
pCEPcinpCEP derivative containing the ComX-dependent promoter, PX (instead of PM), and the RBS of ssbB; KanR, SpcRThis study
pCEPXColE1 (pBR322) derivative containing the ComX-dependent promoter, PX (instead of PM), and the RBS of ssbB; KanR, SpcRThis study
pCN35pCEPx derivative carrying a 728 bp NcoI-BamHI synthetic fragment containing the gfp(Sp)gene from pUC57-gfp(Sp); KanR, SpcRThis study
pQE-60ColE1 derivative; ApRQiagen Inc.
pR412pEMcat derivative carrying a SpcR (aad9 gene, also called spc) mariner minitransposon; ApR, SpcRMartin et al. (2000)
pR414ColE1 (pEVP3) derivative carrying a comC-targeting fragment adjacent to luc; insertion-duplication in S. pneumoniae generates a comC::luc (comC+) fusion; EryRBergéet al. (2002)
pR424ColE1 (pEVP3) derivative carrying an ssbB-targeting fragment adjacent to luc; insertion-duplication in S. pneumoniae generates an ssbB::luc (ssbB+) fusion; CmRChastanet et al. (2001)
pR434ColE1 (pR424) derivative carrying a HindIII-BamHI fragment with a tRNAArg5-comC intergenic segment (generated after amplification with MP120-VH7 on R800 chromosomal DNA) adjacent to luc; insertion-duplication in S. pneumoniae generates a tRNAArg5::luc fusion; CmRThis study
pR435ColE1 (pQE-60) derivative carrying an EcoRI-HindIII fragment with the comED58A open reading frame fused to a (C-ter) His6 tag; ApRThis study
pR438ColE1 (pQE-60) derivative carrying an NcoI-BglII fragment (generated after amplification with VH5-VH6 on R800 chromosomal DNA) with a (C-ter) His6 tag fused to comE; ApRThis study
pR498ColE1 (pR424) derivative carrying the HindIII-BamHI T1T2 comC synthetic fragment (from ) upstream of luc; insertion-duplication in S. pneumoniae generates comC’::luc (comC+) fusions with different placement of T1T2 (see Fig. 7A); CmRThis study
pUC57ColE1 derivative; 2710 bp; ApRGenScript USA
pUC57-T1T2comCpUC57 derivative carrying an 608 bp HindIII-BamHI synthetic fragment with the T1T2 E. coli terminator inserted 6 bp downstream of the tRNAArg5 terminator and 5 bp upstream of the first CEbs (see Fig. 7A); ApRGenScript USA
pUC57-gfp(Sp)pUC57 derivative carrying a 728 bp NcoI-BamHI synthetic fragment containing the gfp(Sp)gene encoding GFP with codon optimized for S. pneumonia R6; ApRGenScript USA
PrimersSequenceb; gene; positionc 
BM40AAGGCCTggatccAAAGCTACAAACTGTTCCBergéet al. (2002)
BM46GCTAATTGTCAATCACTTTTGAGAlloing et al. (1998)
BM47GATTTGCTAAGTTTGAAATGATTGAGSung et al. (2001)
BM52GTCCTCTATCCCTCTCATACSung et al. (2001)
BM93GccggaTcCTAATTGTCAATCACTTTTGAG; comE; +2240Guiral et al. (2006a)
Cat1CTAAAGTGAATTTAGGAGGCTTACT; cat; −49This study
comENcoGAATTTcCATGgAAGTTTTAATTTTAGAAGA-3′; comE; +25This study
Luc1TAGGCTTATCCAGTTGCTCT; luc; +68This study
MP120gccgcgaagcttCTAGTTCTTGTTGAACAAABergéet al. (2002)
MP127CCGGGGACTTATCAGCCAACC; mariner cassette universal primer (internal to terminal IRs); outward orientationMartin et al. (2000)
MP128TACTAGCGACGCCATCTATGTG; mariner cassette universal primer (adjacent to IRL); outward orientationMartin et al. (2000)
pQEforATAATAGATTCAATTGTGAGCGGThis study
pQErevCATTACTGGATCTATCAACAGGThis study
ssbB6cgccCATggTTTCTTCCTCCTACTTATCTATTC; ssbB; + 7This study
ssbB8aagctcgagaaaggacaaatttcgtcctttcttttttCTCAGGATATTGCAGACACAGT; ssbB; – 174This study
VH5cgccATGgAAGTTTTAATTTTAGAAGATG; comE; +25This study
VH6cgcagatctCTTTTGAGATTTTTTCTCTAA; comE; +729This study
VH7cgcggatccCGTTTTAGATAAAATTCTCTCAAC;This study
VH10GCTTTATTTCCTAGcTATCGATATTCATGG; comE; +188This study
VH11dCCATGAATATCGATAgCTAGGAAATAAAGC; comE; +158This study
VH12GAAATTCCATTTTGgcTAATGGTTTTTGTAAGThis study
VH13eCTTACAAAAACCATTAgcCAAAATGGAATTTCThis study
image

Figure 2. Transcription of the comCDE operon. A. CSP-induced comCDE transcription in wild-type and −10 mutant cells. Expression of a comC::luc fusion (Fig. 1) was monitored in cultures of strains R1521 (wild-type promoter, open triangles) and R1844 (−10 mutant promoter, black triangles) grown in C+Y medium. CSP (100 ng ml−1) was added after 80 min incubation at 37°C. B. Basal comCDE expression in wild-type and −10 mutant cells. RLU and OD492 were recorded during growth in C+Y medium at 37°C. Same strains and symbols as in A. Luciferase activity is expressed as RLU/OD (black symbols). OD492, grey symbols.

Download figure to PowerPoint

We then examined whether alteration of PE also affected the non-autocatalytic expression of comCDE by comparing expression of the comC::luc reporter preceded by wild-type or mutant −10 box in otherwise comC-null cells (i.e. cells unable to produce CSP). A ∼6-fold reduction in comCDE expression was observed in the latter (Fig. 2B), which strongly suggested that PE is also required for basal transcription of comCDE.

Competence-stimulating peptide is not required for basal expression of comCDE

Interestingly, basal comCDE expression appeared to fluctuate. A three- to four-fold variation in expression was observed during the exponential phase of growth (Fig. 2B). Maximal non-autocatalytic expression was thus attained around OD492 0.04, clearly indicating that external (e.g. exhaustion of some component) or internal (e.g. growth rate-dependent or replication rate-dependent) signals modulate comCDE expression in actively growing cells. Because CSP-induced and basal comCDE transcription rely on the same promoter (see above), we wished to establish whether the ability of cells to produce CSP could play a role in basal comCDE expression. Comparison of comC::luc expression in ΔcomC (strain R1521) and comC+ (strain R825) cells revealed no difference until comC+ cells entered the autocatalytic phase of expression, i.e. when the concentration of CSP had reached a critical threshold for induction (Fig. 3A). We concluded that CSP plays no role in basal expression of comCDE. Subsequent analyses were therefore conducted with ΔcomC cells to facilitate the study of basal expression by preventing autocatalytic comCDE expression.

image

Figure 3. Basal expression of comCDE requires ComE but not CSP. A. CSP is not required for basal comCDE expression. comCDE expression was monitored using a comC::luc fusion in comC+ (strain R825, open squares) and ΔcomC (strain R1521, black triangles) cells. Note that luminometry is expressed as RLU not RLU/OD. Insert shows luminometry (RLU/OD) and OD values throughout the entire experiment. B. ComE is required for basal comCDE expression. Expression in a wild-type strain (R1521, open squares), in a comE mutant (strain R1627, open triangles), and in a comE mutant complemented by an ectopic copy of comE (CEPM-comE; strain R1628, black triangles) was monitored in C+Y medium containing sucrose (0.3%).

Download figure to PowerPoint

ComE is required for basal comCDE expression

Competence-stimulating peptide-induced expression of comCDE presumably requires the binding of phosphorylated ComE to CEbs (Fig. 1, Middle) to activate transcription initiation at PE. As PE is required for basal comCDE expression as well, we wondered whether this expression also relies on ComE. Inactivation of comE drastically reduced comCDE expression (Fig. 3B, compare strains R1521 and R1627). Ectopic expression of ComE (see Experimental procedures) restored comCDE expression in comE mutant cells (Fig. 3B, compare strains R1628 and R1627). These data clearly establish that ComE is required, together with PE, to drive basal expression of comCDE, even in the absence of CSP.

A phosphate-accepting ComE is required for basal comCDE expression

We next addressed the question of whether phosphorylation of ComE is required for non-autocatalytic expression of comCDE. The putative phosphate-acceptor site of ComE was identified in the receiver domain as residue D58; this residue belongs to a conserved acidic pocket involved in the co-ordination of Mg++, which is needed for phosphorylation. Based on previous studies of RRs, a D-to-A mutation would abolish the function of ComE. The codon GAT for aspartic acid (A at position 173 with respect to the start of comE) was therefore replaced with GCT, a codon for alanine (see Experimental procedures). The comED58A change not only prevented comCDE induction in response to CSP (data not shown) but also drastically reduced basal comCDE expression (Fig. 4A, compare strains R1521 and R1798). Residual expression in comED58A cells appeared indistinguishable from that in comE- cells (Fig. 4A). The finding that ComED58A mutation conferred the same phenotype as the absence of ComE strongly suggested that basal expression of comCDE requires the phosphorylation of ComE, which must occur even in the absence of CSP.

image

Figure 4. Basal expression of comCDE requires a phosphate-accepting ComE protein and ComD. A. The ComED58A mutation abolishes basal comCDE expression. comCDE expression was monitored in comE+ (strain R1521, open squares), comE (strain R1627, open triangles), and comED58A (strain R1798, black squares) cells harbouring a comC::luc fusion. B. ComD is required for basal expression of comCDE. Expression of comC::luc was compared in comD+ (strain R1628, black triangles) and comD (R1648, open circles) cells.

Download figure to PowerPoint

ComD is also required for basal comCDE expression

The finding that a phosphate-accepting ComE protein was required suggested that its cognate HK, ComD, might be also required for basal expression of comCDE (unless activation of ComE involved interaction with another kinase or with acetyl phosphate). This prompted us to examine the effect of comD inactivation on comCDE expression. To avoid a possible effect of comD mutation on expression of the downstream comE gene, we compared different strains expressing an ectopic copy of comE. While ectopic comE allowed normal expression of the comC::luc fusion in comD+comE- cells (Fig. 4B, strain R1628), only very low level expression was detected in ΔcomDE cells (Fig. 4B, strain R1648). Expression levels in the latter case were similar to those in cells lacking a functional ComE protein (compare with Fig. 4A, strains R1627 and R1798). These data demonstrate that ComD is required for basal expression of the comCDE operon. Together with the finding that a phosphate-accepting ComE protein was required, they suggested that ComD phosphorylates ComE, even in the absence of CSP.

ComER120S enhances competence and allows transformation in the absence of CSP

The conclusion that basal comCDE expression necessitates the presence of both ComD and a phosphate-accepting form of ComE, but not CSP, was confirmed through the study of cells harbouring the ComER120S mutant protein. This point mutation of comE was previously shown to result in competence upregulation and alter the kinetics of competence shutoff following CSP addition (Martin et al., 2000). Based on structures and mutations of other RRs, such as Escherichia coli OmpR or PhoP (Nakashima et al., 1991; Chen et al., 2003), a possible mechanism to account for the phenotypes of the ComER120S mutation would be that it affects dimerization, thereby stabilizing a transcriptionally active form of ComE. Because the absence of CSP prevented spontaneous competence induction in comER120S cells, it was concluded that interaction of ComER120S with activated ComD was required for induction (Martin et al., 2000). In light of the present data suggesting that ComD phosphorylates ComE even in the absence of CSP, the effect of an overproduction of ComER120S in ΔcomC cells was examined. Overproduction was achieved through ectopic expression of comER120S under the control of a maltose-inducible promoter (Experimental procedures). It was found to strongly stimulate comCDE transcription (∼7 fold; Fig. 5A). This stimulation required the presence of ComD, as deduced from the effect of the inactivation of comD on comCDE expression in this background (Fig. 5B). We concluded that the ComER120S protein requires activation (phosphorylation) by ComD to trigger comCDE transcription.

image

Figure 5. ComER120S cells display enhanced competence and transform in the absence of CSP. A. Increased comER120S expression stimulates comC::luc transcription. comCDE expression was monitored in cells harbouring CEPM-comE (strain R1628; triangles) or CEPM-comER120S (strain R1655; squares) grown in C+Y medium containing 0.3% sucrose (open symbols) or 0.3% maltose (filled symbols). B. ComD is required for ComER120S-dependent comC::luc expression. Expression was monitored in cells harbouring CEPM-comER120S which were comD (R1816; triangles) or comD+ (R1655; squares) cells during growth in C+Y containing 0.3% sucrose (open symbols) or 0.3% maltose (filled symbols). C. Increased comER120S expression triggers late com gene (ssbB) expression. Expression of ssbB::luc (R1669, triangles) or comC::luc (R1655, squares) fusions was monitored in cells harbouring CEPM-comER120S during growth in C+Y containing 0.3% maltose. D. Increased comER120S expression induces genetic transformation. R1655 (CEPM-comER120S) cells were grown in C+Y containing 0.3% maltose. Every 15 min, aliquots were mixed with R304 chromosomal DNA for 30 min and plated to measure the frequency of transformation to SmR.

Download figure to PowerPoint

We next investigated whether the high level of comCDE expression achieved in ΔcomC cells overproducing ComER120S resulted in induction of the late com genes. Expression of an ssbB::luc fusion was thus monitored in the same genetic context and under the same conditions (i.e. growth in maltose-containing C+Y medium). Significant ssbB expression was observed (Fig. 5C). Chromosomal transformation was then investigated by taking samples every 15 min, mixing them with SmR chromosomal DNA (for 30 min) and plating appropriate dilutions to measure the frequency of SmR transformants. Significant spontaneous transformation of ComER120S cells was detected after 30–150 min growth in the absence of CSP (Fig. 5D). Nevertheless, maximal transformation frequencies remained ∼100-fold lower than routinely observed with CSP-induced wild-type cells. This is consistent with the observation that ssbB::luc expression values following overproduction of ComER120S remained below comC::luc values, whereas the reverse is normally observed with CSP-induced wild-type cells (data not shown).

It is of note that these observations do not contradict our previous report that although ComER120S mutant cells could develop competence under conditions normally non-permissive for wild-type cells, this occurred in a CSP-dependent manner (Martin et al., 2000). In the present study, competence induction of comER120SΔcomC cells was observed only when ComER120S was overproduced through maltose-induction.

To summarize, overproduction of ComER120S enhanced comCDE expression in the absence of CSP. This expression was dependent on ComD. The level of comCDE expression attained resulted in significant induction of the late com genes and promoted bona fide chromosomal transformation. These data confirm conclusions based on the use of wild-type ComE cells that ComE and ComD, but not CSP, are required for basal expression of the comCDE operon.

Transcriptional readthrough into comCDE across the tRNAArg5 transcription terminator

Residual comCDE expression was observed in cells harbouring a mutant PE (Fig. 2B), as well as in comE (Fig. 3B) or comD (Fig. 4B) mutant cells. This prompted us to investigate whether transcriptional readthrough across terL/R, the transcription terminator of tRNAArg5 located immediately upstream of comCDE (Fig. 6A), could be responsible for residual comCDE expression. It was previously shown that a point mutation in terL/R resulted in an increase in basal expression of comCDE (Guiral et al., 2006a). To investigate whether readthrough also occurred in wild-type cells, the luc gene was inserted between CEbs and PE (Fig. 6A; see Experimental procedures). Residual luc expression was readily detected in cells harbouring this construct (tRNAArg5::luc) (Fig. 6B, top panel). As expected, inactivation of comE did not reduce tRNAArg5::luc expression but rather slightly increased it, possibly indicating that ComE interferes with readthrough transcription. In a parallel experiment, the absence of ComE was confirmed to strongly reduce comC::luc expression (Fig. 6B, bottom panel). These data therefore establish that readthrough occurs across the transcription terminator of tRNAArg5 and can contribute to basal comCDE expression. Comparison of comC::luc expression levels in comE+ and comE mutant cells indicated that readthrough accounted for about one-third total comCDE expression (Fig. 6B, bottom panel).

image

Figure 6. Transcriptional readthrough into comCDE. A. Structure of the comCDE region following chromosomal integration of plasmid pR434. An enlarged view of the tRNAArg5-comC region is shown at the top (see Legend of Fig. 1 for details). Plasmid pR434 carries the region within the rectangle. The structure of the comCDE region following chromosomal integration of plasmid pR434 is shown at the bottom. Integration creates a tRNAArg5::luc fusion; the region within the rectangle is entirely duplicated (leaving an intact comCDE region downstream of pR434). As shown here, the comDE operon is thus preceded by normal regulatory sequences. B. Comparison of tRNAArg5::luc and comC::luc expression. Top panel: Strain R1694 (comE+, filled triangles) and R1742 (comE::spc20C, open triangles) harbour the tRNAArg5::luc fusion. Bottom panel: Strain R1521 (comE+, filled triangles) and R1627 (comE::spc20C, open triangles) harbour the comC::luc fusion. RLU/OD, black lines and symbols; OD492, grey lines and symbols.

Download figure to PowerPoint

Biological significance of transcriptional readthrough into comCDE

To assess the biological relevance of transcriptional readthrough from tRNAArg5 into comCDE, we inserted the strong transcription terminators of E. coli rrnB, T1T2, immediately upstream of PE (Fig. 7A; Experimental procedures) so as to virtually eliminate readthrough transcription. We first observed a significant reduction (4–5-fold) in basal comCDE expression in cells harbouring T1T2 in front of the CEbs (Fig. 7B, compare 1 with 2 and 3 with 4). We interpret the reduction in luc expression as the result of diminished comDE expression due to T1T2 preventing readthrough, which in turn reduces ComE-dependent transcription of the reporter gene. It is also of note that lower luciferase levels were observed with constructs harbouring T1T2 in front of luc (Fig. 7B) indicating that readthrough transcription from upstream accounts for about 1/3 (compare 2 with 4) to 1/2 (compare 1 with 3) of the basal expression of comCDE. These findings provided independent proof of the occurrence of transcriptional readthrough into comCDE in wild-type cells and suggested a significant reduction in the amount of ComD and ComE in cells expressing the comCDE operon only from PE.

image

Figure 7. Abolition of transcriptional readthrough severely affects the ability to develop competence. A. Structure of the comCDE upstream region inserts before (left) and after (right) insertion of the T1T2 transcription terminator (red arrow). Inserts are represented by white and red rectangles respectively. Upon transformation of a wild-type recipient by plasmid pR498 (Table 1), clones harbouring T1T2 only in front of the intact comCDE operon (1) or of luc (4) are recovered, as well as clones devoid of T1T2 (2) and clones harbouring T1T2 on each side of the integrated vector moiety (3) (see Experimental procedures). The 208 bp T1T2 fragment is inserted 6 bp downstream of terL/R and 5 bp upstream of the first CEb. B. Basal expression is reduced in cells harbouring T1T2 in front of comCDE. RLU/OD: strain R2780 (1) and R2782 (3) (T1T2; the latter also harbouring T1T2 in front of luc), red triangles and diamonds respectively; strain R2786 (2) and R2784 (4) (no terminator; the latter harbouring T1T2 only in front of luc), black squares and triangles respectively. OD492: grey lines and symbols. C. Spontaneous competence induction is reduced in cells harbouring T1T2 in front of comCDE. RLU/OD: strain R2780 (T1T2), red triangles; strain R2786 (no terminator), black squares. OD492: grey lines and symbols. D. Response to CSP is reduced in cells harbouring T1T2 in front of comCDE. Cells prepared as described in the Experimental procedures (see Fluorescence microscopy) were CSP-induced. To measure transformation, R304 chromosomal DNA was added 10 min after CSP addition and cells were further incubated for 20 min at 30°C before plating for selection of SmR transformants (Experimental procedures). RLU/OD: strain R2801 (T1T2), red triangles; strain R2807 (no terminator), black squares. E. Heterogeneity in individual response to CSP of cells harbouring T1T2 in front of comCDE. Placement of the gfp gene under the control of a ComX-dependent promoter (see Experimental procedures) allowed the study of GFP expression in individual cells by fluorescence microscopy, 20 min after CSP addition. Top panel: strain R2807. Middle panel: strain R2801. Bottom panel: strain R2807 without CSP. F. Distribution of fluorescence intensities in wild type and in cells harbouring T1T2 in front of comCDE. Average fluorescence intensity per µm2 for individual cells was calculated as described in the Experimental procedures and cells were grouped according to this value into seven classes of increasing intensity. Class 1 and 2 correspond to cells for which fluorescence intensity emanates from autofluorescence; class 3 and above correspond to cells exhibiting CSP-induced GFP fluorescence (see Experimental procedures). 410, 354 and > 500 cells were counted for strains R2807, R2801 and R2807 without CSP respectively. Experiments shown in B, C and D were conducted in parallel with two independent clones for each strain. Values reported correspond to the average of the two cultures. For clarity, standard deviation bars have been omitted for OD values. Note that data shown in D–F correspond to the same experiment, except the measurement of chromosomal transformation.

Download figure to PowerPoint

We then investigated the effect of T1T2 on spontaneous competence development. Spontaneous competence was significantly delayed and reduced about fourfold as a consequence of the presence of T1T2 in front of comCDE (Fig. 7C). Although these data established that the contribution of readthrough to basal comCDE expression was biologically significant, it did not indicate whether the reduction in competence reflected a diminution in the fraction of cells developing competence or a lower expression of the com genes in every cell in the culture. To distinguish between these two possibilities, we investigated the heterogeneity in individual response to CSP of cells harbouring T1T2 in front of comCDE through the use of GFP and fluorescence microscopy. The gfp gene was placed under the control of a ComX-dependent promoter (i.e. allowing GFP expression as a late com gene product; see Experimental procedures) to permit examination of CSP-induced GFP expression at the individual cell level. The cells used carried the comC::luc reporter in addition to the CEPX-gfp construct which allowed the monitoring of luciferase (i.e. competence) induction in response to CSP. This monitoring revealed a ∼4-fold reduction in luc expression in cells harbouring T1T2 (Fig. 7D). Direct assays for chromosomal transformation in the same cultures revealed a ∼3-fold reduction in T1T2 cells (Fig. 7D and data not shown), establishing that the T1T2-dependent transcriptional block affected not only basal comCDE expression and spontaneous competence, but also CSP-induced competence and transformation. Fluorescence microscopy then revealed a striking heterogeneity in the population of CSP-induced cells harbouring T1T2 in front of comCDE because as many as 75% of T1T2 cells did not produce GFP (Fig. 7E–F). In contrast, GFP was expressed in > 98% of the cells in the wild-type culture (Fig. 7F; see the representative field in Fig. 7E showing that all of ∼40 cells express GFP).

We conclude that readthrough transcription into comCDE across the terminator of tRNAArg5 plays a key role in pneumococcal competence. We propose that this readthrough maintains the presence of the ComD–ComE TCS in every cell, thereby ensuring that they can develop spontaneous competence and remain fully responsive to CSP.

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgement
  8. References

The ComD-ComE TCS mediates pneumococcal competence induction in response to the CSP signal. It has been assumed that upon binding of CSP, the membrane-associated HK receptor ComD autophosphorylates, then transphosphorylates the ComE RR (Fig. 8). However, despite almost 15 years of study since the discovery of this TCS (Pestova et al., 1996), phosphorylation of ComE has never been experimentally verified. The present finding that a D-to-A mutation in ComE (ComED58A), which is expected to inactivate ComE's phosphateacceptor site, completely abolished the response to CSP constitutes the first genetic evidence that ComE∼P is involved in the process and that the assumed phosphorylation mechanism is probably correct.

image

Figure 8. Proposed transcriptional regulation of the comCDE master competence control operon of S. pneumoniae. Expression of comCDE relies on maintenance transcripts (i.e. transcripts initiated at the PL and/or Pt promoters; green colour) and autoregulation transcripts (i.e. transcripts initiated at PE and requiring ComD-dependent phosphorylation of ComE; orange colour). In the latter case, the thick arrows indicates that CSP can accelerate ComD phosphorylation. Maintenance transcripts rely on readthrough across the terminator downstream of tRNAArg5. Environmental signals (ES) could affect any of these promoters (large blue arrows) generating the synthesis of ES specific transcripts. Promoters are marked on the gene map by arrows and putative terminators determined by TransTermHP (http://transterm.cbcb.umd.edu/cgi-bin/transterm/predictions.pl.) are indicated by loops.

Download figure to PowerPoint

On the other hand, the mechanism(s) ensuring comCDE expression in the non-autocatalytic phase of expression remain unknown. Our data demonstrate that the same promoter, PE, drives both basal and CSP-induced/autocatalytic comCDE transcription (Fig. 2). This finding suggests a direct involvement of ComE in the control of basal comCDE expression, a hypothesis fully supported by the strong reduction of comCDE expression in comE-null cells (Fig. 3B). Surprisingly, basal comCDE expression appears to require the phosphorylation of ComE. This conclusion is based first on the observation that the comED58A mutation, which presumably prevents phosphorylation of ComE, abolishes basal comCDE expression and, second, on the requirement for ComD (Fig. 4). Even more surprising is the finding of a requirement for ComD even in ΔcomC cells. This implies that ComD is capable of self-activation in the absence of CSP and that this self-activation is critical for basal comCDE expression (Fig. 8). Alternatively, interaction between ComD and another unidentified ligand could be responsible for the postulated conformational change in ComD dimers, followed by autophosphorylation of active site histidines in trans between the monomers (Gao and Stock, 2009). Interestingly, similar levels of expression were observed in comC+ and ΔcomC cells during the non-autocatalytic phase of comCDE expression (Fig. 3A) indicating that CSP plays no role in basal comCDE expression.

The conclusion that basal expression of comCDE requires ComE and ComD, but not CSP, is further supported by the finding that overproduction of the ComER120S protein enhances comCDE expression in ΔcomC cells, leading to induction of the late com genes and to a significant level of chromosomal transformation in the absence of CSP (Fig. 5).

Potential impact of low-level extracellular CSP on basal comCDE expression

We previously showed that increased expression of comAB, which encodes the CSP-dedicated maturation/export machinery, resulted in comCDE upregulation (Martin et al., 2000). This suggested that CSP can impact on comCDE expression. To reconcile this observation with the present conclusion that CSP is not required for basal expression, we propose that increased comAB expression by accelerating CSP export optimized the autocatalytic phase of comCDE expression. This phase may initiate at the level of individual cells (if CSP is sequestered at the surface of producing cells and functions as an autocrine device) and subsequently concern the whole population in liquid cultures and possibly only neighbouring cells in biofilms, depending on whether CSP diffuses freely or not.

A contribution of CSP to basal comCDE expression was implicit in the hypothesis attributing the negative effect of the extracellular stress-response protease, HtrA, on spontaneous competence to the degradation of secreted CSP at the surface of pneumococcal cells (Sebert et al., 2002). Although conflicting results have been reported regarding HtrA's role in competence (Dagkessamanskaia et al., 2004; Ibrahim et al., 2004; Sebert et al., 2005), the present observation that CSP is not required for basal comCDE expression indicates that if HtrA targets CSP, it would be more likely to interfere with the autocatalytic phase of expression.

Readthrough into comCDE across the tRNAArg5 transcription terminator

It was previously suggested that ‘…quorum-sensing in the regulation of competence depends on the production of CSP at a basal rate (perhaps depending on transcriptional readthrough past the tRNAArg terminator) and a consequent accumulation of CSP…’ (Pestova et al., 1996). Although we provide evidence that readthrough readily occurs in wild-type cells and, under the conditions used in our experiments, accounts for about 1/3–1/2 total comCDE expression (Figs 6B and 7B), the speculation of Pestova and coworkers as concerns the role of readthrough appears incorrect because our data indicate that CSP plays no role in the basal expression of comCDE (Fig. 3A). We propose instead that readthrough is important not for CSP production but for ComD–ComE maintenance (see below).

Two (possibly three) promoters as targets for competence regulatory inputs

Because transcriptional readthrough across the transcription terminator of tRNAArg5 occurs not only in a strain harbouring a point mutation destabilizing this terminator (Guiral et al., 2006a) but also in wild-type cells (Fig. 6B), basal expression of comCDE does not rely only on PE. Pt, the promoter of tRNAArg5, can also contribute to comCDE expression in addition to PE. Moreover, no putative transcription terminator was predicted between orfL (spr2044 in R6 genome; Hoskins et al., 2001) and tRNAArg5. Therefore PL, the putative promoter of orfL, could equally contribute to comCDE expression (Fig. 8, Maintenance transcripts). These results are especially important going forward, as they clearly define several likely targets for the multiple regulatory inputs that affect competence induction.

PL and/or Pt driven comCDE transcription could thus be responsible for the coupling of competence with growth rate. Notably, maximal expression of tRNAArg5::luc and maximal basal expression of comCDE occurred at a very similar cell-density, i.e. around OD492 0.04 (Fig. 6B). Maximal expression thus coincided with the fastest growth phase. Many E. coli tRNA promoters are known to exhibit growth rate-dependent regulation (Duester et al., 1982). If this also applies to S. pneumoniae, it is possible that when cells enter a fast-growing phase, Pt provides an initial transcriptional impulse, which is then propagated via ComD-ComE-dependent activation of PE. Similarly, PL drives expression of orfL which encodes the orthologue of E. coli YbeA (redesignated RlmH, for rRNA large subunit methyltransferase H; Purta et al., 2008). As YbeA is specifically involved in methylation of 23S rRNA, it is likely that its expression is coupled with ribosomal activity and therefore parallels growth rate. PL may thus also promote growth rate-dependent transcription of comCDE.

The existence of two (possibly three) promoters driving transcription of comCDE somehow complicates the study of the control of basal expression of the master competence operon of S. pneumoniae. There is accumulating evidence that basal comCDE expression is not constant, but that it is adjusted in response to changes in environmental conditions (Claverys et al., 2006). Thus, variations of external pH (Chen and Morrison, 1987) or the presence of sublethal concentrations of some antibiotics (Prudhomme et al., 2006) have been shown to modulate competence. This suggests that external signals can be conveyed to comCDE by mechanism(s) that remain to be characterized. These signals could thus impact PE, the ComE-dependent promoter, either directly affecting the ComD–ComE signal transduction cascade or some unknown repressor(s) that antagonizes the binding of ComE∼P to its target site upstream PE. The documented contribution of transcriptional readthrough across the transcription terminator of tRNAArg5 to comCDE expression opens the alternative possibility that ES primarily affect the maintenance promoters PL and/or Pt, and as a secondary consequence comCDE expression (Fig. 8).

Importance of transcriptional readthrough for maintenance of ComD–ComE

That the basal expression of comDE is self-maintaining, by use of the same two proteins driving the strongly elevated expression of the pheromone response reveals a surprising but pleasing economy of design. However, this design carries its own potential drawback. Thus, the stochastic production of cells lacking ComE or ComD could lead to the appearance of subpopulations of pneumococci that are not expressing comCDE and can no longer respond to CSP. This view is supported by our finding that insertion of strong transcription terminators immediately upstream of CEbs-PE so as to virtually eliminate readthrough results in significant reduction of basal comCDE expression, as well as of spontaneous and CSP-induced competence and transformation (Fig. 7). In addition, analysis of competence at the single cell level using GFP expressed under the control of a ComX-dependent promoter demonstrated that while 99% of wild-type cells express GFP following CSP addition, as many as 75% of the cells bearing the transcription terminators become uninducible (Fig. 7E and F).

We therefore conclude that the transcriptional readthrough into comCDE across the terminator of tRNAArg5 documented in this study is crucial to counteract the accidental production of cells devoid of ComE or ComD. Taking into account the importance of ComD activation for basal comCDE expression, readthrough may also attenuate the consequences of stochasticity in the process of ComD activation itself. In the absence of readthrough, a possible alternative to prevent accumulation of genetically wild-type but CSP non-reactive cells would be their eradication via pneumococcal fratricide (Claverys and Håvarstein, 2007; Claverys et al., 2007). In any case, maintenance of CSP responsiveness appears of primary importance for a species which lacks an SOS-like induction mechanism, presumably using the competence regulatory cascade to co-ordinate the response to stress conditions and CSP as an alarmone (Claverys et al., 2006).

Experimental procedures

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgement
  8. References

Bacterial strains, culture and transformation conditions

Streptococcus pneumoniae strains and plasmids used in this study are described in Table 1. Stock cultures were routinely grown at 37°C in Casamino Acid Tryptone (CAT) medium to OD550 = 0.4; after addition of 15% glycerol, stocks were kept frozen at −70°C. For the monitoring of growth and luc expression, precultures were gently thawed and aliquots were inoculated (1 in 100) in luciferin-containing (Prudhomme and Claverys, 2007) C+Y medium and distributed (300 µl per well) into a 96-well white microplate with clear bottom. Relative luminescence unit (RLU) and OD values were recorded throughout incubation at 37°C in a LucyI luminometer (Anthos) or a Varioskan Flash luminometer (Thermo 399 Electron Corporation). For each figure in this manuscript, OD and luminescence curves correspond to the average of two parallel cultures (from independent clones in the case of Fig. 7).

Competence-stimulating peptide-induced transformation was performed as described previously (Martin et al., 2000), using pre-competent cells treated at 37°C for 10 min with synthetic CSP1 (100 ng ml−1). After addition of transforming DNA, cells were incubated for 20 min at 30°C. Transformants were selected by plating on CAT-agar supplemented with 4% horse blood, followed by selection using a 10 ml overlay containing chloramphenicol (4.5 µg ml−1), erythromycin (0.05 µg ml−1), kanamycin (250 µg ml−1), spectinomycin (100 µg ml−1) or streptomycin (200 µg ml−1), after phenotypic expression for 120 min at 37°C.

In vitro mariner mutagenesis

Insertion of a spc (SpcR) minitransposon in comE was obtained through in vitro mariner mutagenesis as described (Prudhomme et al., 2007). The plasmid used as a source for the minitransposon was pR412 (Table 1). Briefly, pR412 DNA (∼1 µg) was incubated with a PCR fragment amplified from R800 chromosomal DNA with the BM46-BM47 primer pair (Table 1) in the presence of purified Himar1 transposase, leading to random insertion of the minitransposon within the fragment. Gaps in transposition products were repaired as described (Prudhomme et al., 2007) and the resulting in vitro-generated transposon insertion library was used to transform S. pneumoniae. Location and orientation of minitransposon insertions were determined as previously described (Prudhomme et al., 2007) through PCR reactions using primers MP127 or MP128 in combination with either one of the primers used to generate the comE PCR fragment (Table 1). Cassette–chromosome junctions were sequenced and comE::spc20C was retained for this study.

Construction of a mutant −10 box and of ComED58A

Site-directed mutagenesis of the comCDE−10 box and of comE involved the use of the PCR-based gene splicing by overlap extension (gene SOEing) method (Horton et al., 1990). Briefly, a couple of PCR reactions (with primer pairs A1-A2 and B2-B1) is used to generate two fragments A and B that incorporate a mutant primer (A2) at one extremity of A and its complement (B2) at the other extremity of B. A third PCR reaction with primer pair A1-B1 then produces a unique fragment with the mutant sequence in the middle. Primer pairs A1-A2, B2-B1 and A1-B1 to generate the mutant −10 box and comED58A were MP120-VH13 (template for PCR, strain R800), VH12-BM40 (template for PCR, strain R800) and MP120-BM40, and pQEfor-VH11 (template for PCR, pR438), VH10-pQrev (template for PCR, pR438) and pQEfor-pQErev respectively.

Plasmid pR438, which was used as template to generate VH10-pQrev and pQEfor-VH11 fragments (see above), was constructed by cloning into NcoI-BglII-digested pQE60 plasmid DNA a PCR fragment amplified with the VH5-VH6 primer pair on R800 chromosomal DNA and digested with NcoI and BglII.

For construction of the mutant −10 box, the MP120-BM40 fragment amplified was digested with HindIII-BamHI and ligated to HindIII-BamHI-digested plasmid pR424 DNA to replace the fragment containing the 5′ssbB region. The ligation mixture was then used to transform strain R1843 (a hex- recipient to avoid rejection of the mutation during chromosomal integration) to generate strain R1844, which harbours the pR424 derivative with the mutant −10 box in front of luc (Table 1).

To construct a comED58A strain, the pQEfor-pQErev PCR fragment was digested with EcoRI and HindIII and ligated to EcoRI-HindIII-digested pQE60 plasmid DNA thus generating plasmid pR435. The comE region in plasmid pR435 was sequenced to rule out the presence of unwanted mutation(s). Transformation of the hex- recipient strain R1785 (comC::lucΔcomC) with pR435 plasmid DNA was followed by phenotypic expression and segregation of transformed cells in liquid culture, and plating on CAT-agar without selection. As the GAT to GCT mutation corresponding to the D58A change inactivated an EcoRV site (GATATC) present in wild-type comE, individual colonies were picked up, the corresponding comE region was amplified and digested with EcoRV to identify a comED58A transformant (strain R1798; Table 1).

Ectopic expression of wild-type and mutant ComE proteins

Placement of a copy of wild-type comE and the comER120S mutant under the control of the maltose-inducible PM promoter at CEP (Guiral et al., 2006b) was achieved by cloning PCR fragments generated using the BM93-comENco primer pair (Table 1) into the pCEP plasmid. Chromosomal DNA of strains R800 and R682 (Table 1) was used as a template for amplification of wild-type comE and the comER120S mutant respectively. After digestion with BamHI and NdeI, amplified fragments were ligated with NcoI-BamHI-digested pCEP plasmid DNA. Transformation of strain R800 with the ligation mixtures and selection for KanR transformants was used to generate strains R1477 (CEPM-comE) and R1478 (CEPM-comER120S).

Construction of a tRNAArg5::luc transcriptional fusion

Plasmid pR434 which harbours the tRNAArg5::luc transcriptional fusion was constructed through removal from plasmid pR424 of a HindIII-BamHI fragment containing the 5′ssbB region and replacement with a HindIII-BamHI digested PCR fragment amplified on R800 chromosomal DNA with MP120-VH7 primer pair (Table 1).

Placement of transcription terminators in front of comCDE

To insert strong transcription terminators upstream of the CEbs in the comCDE region (Fig. 7A), a 608 bp HindIII-BamHI DNA fragment containing the E. coli rrnB terminator T1T2 (positions 4,169,779–4,169,986 of the K-12 MG1655 strain; http://www.ncbi.nlm.nih.gov/sites/entrez?db=genome&cmd=Retrieve&dopt=Overview&list_uids=115), flanked by two regions of homology with the S. pneumoniae R6 chromosome (226 bp including tRNAArg5 and 162 bp with the CEbs), was synthesized and cloned into pUC57 by Genscript USA (http://www.genscript.com/) to generate plasmid pUC57-T1T2comC. The HindIII-BamHI T1T2 fragment digested from pUC57-T1T2comC was then placed in front of the luc gene by substituting it for the HindIII-BamHI ssbB fragment of plasmid pR424 (Table 1), thus generating plasmid pR498.

Upon transformation of a wild-type recipient by plasmid pR498, clones harbouring T1T2 at different positions can be recovered. PCR was therefore used to probe the structure of CmR transformants resulting from chromosomal integration of pR498, as follows. Amplification with the BM47 (match in orfL)-Luc1 (match in luc) primer pair generated a 832 or 1040 bp fragment, depending on whether T1T2 was, respectively, absent or present, in the region upstream the integrated vector (Fig. 7A, Top). Amplification with the Cat1 (match in the vector)-BM52 (match in comD) primer pair generated a 931 or 1139 bp fragment depending on whether T1T2 was, respectively, absent or present in the region downstream the integrated vector (Fig. 7A, Top). Among 19 CmR clones analysed, two harboured T1T2 only in front of the intact comCDE operon (Fig. 7A, 1); one was devoid of T1T2 (Fig. 7A, 2); six harboured T1T2 on each side of the integrated vector moiety (Fig. 7A, 3); and 10 harboured T1T2 only in front of luc (Fig. 7A, 4).

Construction of CEPX-gfp

The gene encoding the GFP variant GFPmut2 (mutations S65A, V68L and S72A) (Cormack et al., 1996) was resynthesized with codons optimized for S. pneumoniae strain R6 (http://gib.genes.nig.ac.jp/) using the OptimumGene™ algorithm and cloned into pUC57 by Genscript USA to generate plasmid pUC57-gfp(Sp). Notably, in addition to codon optimization, two modifications were included in the synthesis; a nucleotide transition at position 171 (A->T) that results in the inactivation of an internal NcoI restriction site; and an amino acid substitution (A206K) that prevents GFP dimerization (Zacharias et al., 2002). The sequence of gfp(Sp) is available upon request. The synthetic gene was inserted into pCEPX (see below) between NcoI and BamHI to generate pCN35. In this plasmid, the start codon of gfp(Sp) is part of the NcoI restriction site and the BamHI site is inserted after the TAA stop codon.

pCEPX is an integrative plasmid derived from pCEP (Guiral et al., 2006b). It allows chromosomal integration of a gene at CEP and its expression under the control of the CSP-inducible, ComX-dependent promoter of the ssbB gene, PX. This promoter is present on a 194 bp fragment also containing the ssbB RBS (positions 1,704,879–1,705,072 in the R6 genome; Hoskins et al., 2001), which was amplified using the ssbB6-ssbB8 primer pair (Table 1) and R6 genomic DNA as template. The resulting PCR fragment was digested with NcoI and XhoI, and inserted into NcoI-XhoI-digested pCEP yielding plasmid pCEPcin. Note that as digestion of pCEP with XhoI destroyed a transcription terminator at the 3′ end of the amiF gene, the forward 59 nt primer ssbB8 included in addition to the 5′ region of ssbB PX a sequence allowing reconstitution of the amiF terminator. Finally, a 2823 bp EcoRI-PvuII fragment from pCEPcin containing PX was cloned into the pBR322 vector between EcoRI and NruI thus generating plasmid pCEPX.

Fluorescence microscopy

Stock cultures were prepared as described above except that they were grown in acidified C+Y (pH 6.56) instead of CAT medium. After gentle thawing, aliquots were inoculated at OD550 = 0.01 in acidified C+Y medium (pH 6.56) and grown at 37°C to an OD550 of 0.2. Then, cultures were centrifuged (5 min, 5000 g) and the cell pellet was resuspended in the same medium to a final OD550 = 0.4. Finally, this cell suspension was inoculated (1/10) in acidified C+Y medium (pH 6.56) and competence was induced with synthetic CSP1 (100 ng ml−1) for 20 min at 37°C. 0.5 ml of samples was collected, pelleted (2 min, 3000 g, 4°C) and resuspended in 10 µl phosphate-buffered saline. Three microlitres of this cell suspension were deposited on glass slides with poly-l-lysine-treated coverslips before imaging.

Phase contrast and fluorescence microscopy were performed with an inverted Olympus X81 microscope equipped with a phase contrast objective UplanF1100x, Chroma filter sets for GFP (Ex: 470BP40; Em: 525BP50), and a monochrome CoolSnapHQ digital camera (Roper Scientific). Fluorescence images were captured with exposure times of 5000 ms, and processed using Metamorph software (Molecular Devices). To create overlay images, GFP signals and phase contrast signals, artificially coloured in green and black on red background, respectively, were merged using the ‘Color Combine’ tool. To quantify GFP intensity from individual cells, images were corrected for background fluorescence. Using the Integrated Morphometry Application of Metamorph v 7.5, the integrated intensities (i.e. sum of the greyscale values for all pixels contained in a cell) and area from several hundred cells were logged to an Excel (Microsoft) spreadsheet for further analysis. Average fluorescence intensity per µm2 from each cell was calculated and cells were classified into seven classes according to this value. Class 1 (relative GFP intensity comprised between 29 670 and 30 020 arbitrary units, a.u.) and 2 (30 021–30 370 a.u.) correspond to cells for which fluorescence intensity emanates from autofluorescence. Class 3 and above correspond to CSP-induced GFP fluorescence, i.e. relative fluorescence intensity greater than 30 370 a.u. (class 3, 30 371–31 000; 4, 31 001–32 000; 5, 32 001–33 000; 6, 33 001–34 000; 7, 34 001–35 000). The % of total cells in each class was then plotted to generate the histograms shown in Fig. 7F.

Acknowledgement

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgement
  8. References

We thank Calum Johnston for critical reading of the manuscript. N. C. was the recipient of a postdoctoral fellowship from the Fondation pour la Recherche Médicale (UFP20061108553).

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgement
  8. References
  • Alloing, G., Martin, B., Granadel, C., and Claverys, J.P. (1998) Development of competence in Streptococcus pneumoniae: pheromone auto-induction and control of quorum-sensing by the oligopeptide permease. Mol Microbiol 29: 7584.
  • Bergé, M., Moscoso, M., Prudhomme, M., Martin, B., and Claverys, J.P. (2002) Uptake of transforming DNA in Gram-positive bacteria: a view from Streptococcus pneumoniae. Mol Microbiol 45: 411421.
  • Chastanet, A., Prudhomme, M., Claverys, J.P., and Msadek, T. (2001) Regulation of Streptococcus pneumoniae clp genes and their role in competence development and stress survival. J Bacteriol 183: 72957307.
  • Chen, J.D., and Morrison, D.A. (1987) Modulation of competence for genetic transformation in Streptococcus pneumoniae. J Gen Microbiol 133: 19591967.
  • Chen, Y., Birck, C., Samama, J.P., and Hulett, F.M. (2003) Residue R113 is essential for PhoP dimerization and function: a residue buried in the asymmetric PhoP dimer interface determined in the PhoPN three-dimensional crystal structure. J Bacteriol 185: 262273.
  • Claverys, J.P., and Håvarstein, L.S. (2002) Extra-cellular peptide control of competence for genetic transformation in Streptococcus pneumoniae. Front Biosci 7: 17981814.
  • Claverys, J.P., and Håvarstein, L.S. (2007) Cannibalism and fratricide: mechanisms and raisons d’être. Nat Rev Microbiol 5: 219229.
  • Claverys, J.P., Prudhomme, M., and Martin, B. (2006) Induction of competence regulons as general stress responses in Gram-positive bacteria. Annu Rev Microbiol 60: 451475.
  • Claverys, J.P., Martin, B., and Håvarstein, L.S. (2007) Competence-induced fratricide in streptococci. Mol Microbiol 64: 14231433.
  • Cormack, B.P., Valdivia, R.H., and Falkow, S. (1996) FACS-optimized mutants of the green fluorescent protein (GFP). Gene 173: 3338.
  • Dagkessamanskaia, A., Moscoso, M., Hénard, V., Guiral, S., Overweg, K., Reuter, M., et al. (2004) Interconnection of competence, stress and CiaR regulons in Streptococcus pneumoniae: competence triggers stationary phase autolysis of ciaR mutant cells. Mol Microbiol 51: 10711086.
  • Duester, G., Elford, R.M., and Holmes, W.M. (1982) Fusion of the Escherichia coli tRNALeu1 promoter to the galK gene: analysis of sequences necessary for growth-rate-dependent regulation. Cell 30: 855864.
  • Gao, R., and Stock, A.M. (2009) Biological insights from structures of two-component proteins. Ann Rev Microbiol 63: 133154.
  • Guiral, S., Hénard, V., Granadel, C., Martin, B., and Claverys, J.P. (2006a) Inhibition of competence development in Streptococcus pneumoniae by increased basal-level expression of the ComDE two-component regulatory system. Microbiology (Special Issue Pneumococcus) 152: 323331.
  • Guiral, S., Hénard, V., Laaberki, M.-H., Granadel, C., Prudhomme, M., Martin, B., and Claverys, J.P. (2006b) Construction and evaluation of a chromosomal expression platform (CEP) for ectopic, maltose-driven gene expression in Streptococcus pneumoniae. Microbiology (Special Issue Pneumococcus) 152: 343349.
  • Halfmann, A., Hakenbeck, R., and Bruckner, R. (2007) A new integrative reporter plasmid for Streptococcus pneumoniae. FEMS Microbiol Lett 268: 217224.
  • Håvarstein, L.S., Coomaraswamy, G., and Morrison, D.A. (1995) An unmodified heptadecapeptide pheromone induces competence for genetic transformation in Streptococcus pneumoniae. Proc Natl Acad Sci USA 92: 1114011144.
  • Håvarstein, L.S., Gaustad, P., Nes, I.F., and Morrison, D.A. (1996) Identification of the streptococcal competence-pheromone receptor. Mol Microbiol 21: 865871.
  • Horton, R.M., Cai, Z., Ho, S.N., and Pease, L.R. (1990) Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction. BioTechniques 8: 528535.
  • Hoskins, J., Alborn, W.E., Jr, Arnold, J., Blaszczak, L.C., Burgett, S., DeHoff, B.S., et al. (2001) Genome of the bacterium Streptococcus pneumoniae strain R6. J Bacteriol 183: 57095717.
  • Hui, F.M., Zhou, L., and Morrison, D.A. (1995) Competence for genetic transformation in Streptococcus pneumoniae: organization of a regulatory locus with homology to two lactococcin A secretion genes. Gene 153: 2531.
  • Ibrahim, Y.M., Kerr, A.R., McCluskey, J., and Mitchell, T.J. (2004) Role of HtrA in the virulence and competence of Streptococcus pneumoniae. Infect Immun 72: 35843591.
  • Lee, M.S., and Morrison, D.A. (1999) Identification of a new regulator in Streptococcus pneumoniae linking quorum sensing to competence for genetic transformation. J Bacteriol 181: 50045016.
  • Lefèvre, J.C., Claverys, J.P., and Sicard, A.M. (1979) Donor deoxyribonucleic acid length and marker effect in pneumococcal transformation. J Bacteriol 138: 8086.
  • Martin, B., Prudhomme, M., Alloing, G., Granadel, C., and Claverys, J.P. (2000) Cross-regulation of competence pheromone production and export in the early control of transformation in Streptococcus pneumoniae. Mol Microbiol 38: 867878.
  • Mortier-Barrière, I., De Saizieu, A., Claverys, J.P., and Martin, B. (1998) Competence-specific induction of recA is required for full recombination proficiency during transformation in Streptococcus pneumoniae. Mol Microbiol 27: 159170.
  • Nakashima, K., Kanamaru, K., Aiba, H., and Mizuno, T. (1991) Signal transduction and osmoregulation in Escherichia coli. A novel type of mutation in the phosphorylation domain of the activator protein, OmpR, results in a defect in its phosphorylation-dependent DNA binding. J Biol Chem 266: 1077510780.
  • Pestova, E.V., Håvarstein, L.S., and Morrison, D.A. (1996) Regulation of competence for genetic transformation in Streptococcus pneumoniae by an auto-induced peptide pheromone and a two-component regulatory system. Mol Microbiol 21: 853864.
  • Prudhomme, M., Attaiech, L., Sanchez, G., Martin, B., and Claverys, J.P. (2006) Antibiotic stress induces genetic transformability in the human pathogen Streptococcus pneumoniae. Science 313: 8992.
  • Prudhomme, M., Camilli, A., and Claverys, J.P. (2007) In vitro mariner mutagenesis of Streptococcus pneumoniae: tools and traps. In The Molecular Biology of Streptococci. Hakenbeck, R., and Chhatwal, G.S. (eds). Norfolk, UK: Horizon Scientific Press, pp. 511518.
  • Prudhomme, M., and Claverys, J.P. (2007) There will be a light: the use of luc transcriptional fusions in living pneumococcal cells. In The Molecular Biology of Streptococci. Hakenbeck, R., and Chhatwal, G.S. (eds). Norfolk, UK: Horizon Scientific Press, pp. 519524.
  • Purta, E., Kaminska, K.H., Kasprzak, J.M., Bujnicki, J.M., and Douthwaite, S. (2008) YbeA is the m3Psi methyltransferase RlmH that targets nucleotide 1915 in 23S rRNA. RNA 14: 22342244.
  • Sabelnikov, A.G., Greenberg, B., and Lacks, S.A. (1995) An extended -10 promoter alone directs transcription of the DpnII operon of Streptococcus pneumoniae. J Mol Biol 250: 144155.
  • Sebert, M.E., Palmer, L.M., Rosenberg, M., and Weiser, J.N. (2002) Microarray-based identification of htrA, a Streptococcus pneumoniae gene that is regulated by the CiaRH two-component system and contributes to nasopharyngeal colonization. Infect Immun 70: 40594067.
  • Sebert, M.E., Patel, K.P., Plotnick, M., and Weiser, J.N. (2005) Pneumococcal HtrA protease mediates inhibition of competence by the CiaRH two-component signaling system. J Bacteriol 187: 39693979.
  • Sung, C.K., Li, H., Claverys, J.P., and Morrison, D.A. (2001) An rpsL Cassette, Janus, for Gene Replacement through Negative Selection in Streptococcus pneumoniae. Appl Environ Microbiol 67: 51905196.
  • Ween, O., Gaustad, P., and Håvarstein, L.S. (1999) Identification of DNA binding sites for ComE, a key regulator of natural competence in Streptococcus pneumoniae. Mol Microbiol 33: 817827.
  • Zacharias, D.A., Violin, J.D., Newton, A.C., and Tsien, R.Y. (2002) Partitioning of lipid-modified monomeric GFPs into membrane microdomains of live cells. Science 296: 913916.