SEARCH

SEARCH BY CITATION

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Nontypeable Haemophilus influenzae (NTHI) is a respiratory commensal and opportunistic pathogen, which persists within biofilms on airway mucosal surfaces. For many species, biofilm formation is impacted by quorum signalling. Our prior work shows that production of autoinducer-2 (AI-2) promotes biofilm development and persistence for NTHI 86-028NP. NTHI 86-028NP encodes an ABC transporter annotated as a ribose transport system that includes a protein (RbsB) with similarity to the Escherichia coli LsrB and Aggregatibacter actinomycetemcomitans RbsB proteins that bind AI-2. In this study, inactivation of rbsB significantly reduced uptake of AI-2 and the AI-2 precursor dihydroxypentanedione (DPD) by NTHI 86-028NP. Moreover, DPD uptake was not competitively inhibited by ribose or other pentose sugars. Transcript levels of rbsB increased in response to DPD and as bacteria approached stationary-phase growth. The NTHI 86-028NP rbsB mutant also formed biofilms with significantly reduced thickness and total biomass and reduced surface phosphorylcholine, similar to a luxS mutant. Infection studies revealed that loss of rbsB impaired bacterial persistence in the chinchilla middle ear, similar to our previous results with luxS mutants. Based on these data, we conclude that in NTHI 86-028NP, RbsB is a LuxS/AI-2 regulated protein that is required for uptake of and response to AI-2.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Nontypeable Haemophilus influenzae (NTHI) inhabits the nasopharynx and upper airways of children and healthy adults (Faden et al., 1991; Erwin and Smith, 2007), and can cause opportunistic infections of the airway mucosa that include bronchitis, sinusitis and otitis media (OM) (Pichichero, 2000; Erwin and Smith, 2007). Among these infections, OM is of particular public health importance. For example, OM is an extremely paediatric infection, affecting the majority of all children (Klein, 2000; Mandel et al., 2008), and is a leading cause for paediatric office visits and new antibiotic prescription to children (Finkelstein et al., 2001).

Otitis media infections are often chronic and/or recurrent in nature, and can be highly resistant to immune clearance and antibiotic treatment. Thus, it is generally thought that OM involves persistence of bacteria within biofilm communities (Costerton et al., 1999; Bakaletz, 2007; Post et al., 2007). Bacterial biofilms have been observed directly in patient samples (Post, 2001; Hall-Stoodley et al., 2006; Hoa et al., 2009; Nistico et al., 2011) and in the chinchilla experimental model for OM (Post, 2001; Ehrlich et al., 2002). As biofilms provide protection from the immune response and antibiotic treatment, understanding the mechanisms involved in their formation during chronic infection may provide new targets for disruption and treatment of biofilm-related infections (Armbruster and Swords, 2010).

Biofilm formation for many bacterial species is controlled in part through cell density-dependent quorum signalling networks, wherein changes in bacterial population phenotypes are mediated by accumulation of a soluble signalling mediator (Miller and Bassler, 2001; Waters and Bassler, 2005; Hardie and Heurlier, 2008; Jayaraman and Wood, 2008). Such signalling networks include autoinducer-2 (AI-2), a ribose derivative produced by both Gram-negative and Gram-positive bacteria that is conserved among numerous bacterial species and thus referred to as an inter-species signal (Waters and Bassler, 2005; Jayaraman and Wood, 2008). Mutation of the genetic determinant of AI-2 production (luxS) was previously shown to impact biofilm thickness/maturation and persistence of NTHI strain 86-028NP in an experimental animal model of OM (Armbruster et al., 2009). The focus of this study is to understand how strain NTHI 86-028NP internalizes and responds to AI-2.

In Vibrio harveyi, sensing of AI-2 occurs through a two-component system involving LuxP and LuxQ (Bassler et al., 1994). LuxP is similar to periplasmic ribose binding proteins and binds AI-2, while LuxQ contains sensor kinase and response regulator domains to propagate the signal (Henke and Bassler, 2004). Salmonella typhimurium, Escherichia coli, Sinorhizobium meliloti and Aggregatibacter actinomycetemcomitans utilize the Lsr (LuxS regulated) ABC transporter, an AI-2 transport system similar to the ribose ABC transporter (Miller et al., 2004). Rather than the two-component signal cascade described in V. harveyi, the Lsr system mediates AI-2 uptake via binding by LsrB and transport through a heterodimeric membrane channel (Taga et al., 2001; Xavier and Bassler, 2005; Shao et al., 2007a; Pereira et al., 2008). In addition to LsrB, it was determined in A. actinomycetemcomitans that the ribose binding protein RbsB also interacts with AI-2 (James et al., 2006; Shao et al., 2007b).

NTHI 86-028NP does not possess a homologue of LuxPQ transport system. However, the NTHI 86-028NP genome contains an ABC transporter annotated as a ribose transport system that includes a binding protein encoded by NTHI_0632, designated rbsB (Harrison et al., 2005). The NTHI 86-028NP rbsB gene product has 40.3% identity to E. coli LsrB, and 87% identity to A. actinomycetemcomitans RbsB that was found to bind AI-2. The predicted RbsB proteins from H. influenzae 86–028 NP and A. actinomycetemcomitans are virtually identical in length (292 vs. 293 amino acids). LsrB from A. actinomycetemcomitans is predicted to be somewhat larger (365 amino acids). Based on these observation and the similarity between the Lsr AI-2 transport system and ribose transporters, it was hypothesized that NTHI 86-028NP may utilize RbsB for internalization of and response to AI-2. An rbsB mutant was therefore generated in NTHI 86-028NP to determine the impact of this mutation on production and internalization of AI-2, biofilm formation, and the ability of NTHI to establish a chronic infection in the chinchilla model of OM.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Construction and confirmation of NTHI 86-028NP rbsB::Cm

A null allele of rbsB (NTHI_0632) was constructed by insertion of a chloramphenicol resistance cassette into the coding sequence (Experimental procedures). This allele was introduced into NTHI 86-028NP by natural transformation and verified by PCR (data not shown). No differences in growth rate was observed for NTHI 86-028NP rbsB::Cm compared with the parental strain in rich broth culture. NTHI 86-028NP and NTHI 86-028NP rbsB::Cm also grew similarly in minimal media with glucose as a carbon source, and neither strain was able to utilize ribose as a sole carbon source (data not shown). Notably, supernatant samples taken during growth in rich media and assessed for AI-2 using the V. harveyi bioluminescence assay revealed a significant accumulation of AI-2 in NTHI 86-028NP rbsB::Cm supernatants during late-exponential and early-stationary phase (Fig. 1). In contrast, the level of AI-2 in supernatant harvested from cultures of the parental strain decreased at these time points, suggesting that strain NTHI 86-028NP begins to internalize AI-2 in an rbsB-dependent manner as it approaches stationary phase. Importantly, genetic complementation of NTHI 86-028NP rbsB::Cm via insertion of the wild type rbsB allele into an intergenic region of the chromosome (IRB, Experimental procedures) restored the ability of this strain to decrease AI-2 levels in stationary phase.

image

Figure 1. AI-2 accumulates in late-exponential phase cultures of NTHI 86-028NP rbsB::Cm. NTHI 86-028NP, NTHI 86-028NP rbsB::Cm, and the complemented strain NTHI 86-028NP rbsB::Cm IRB::Sp were cultured in sBHI to stationary phase and supernatant samples were removed and stored at −20°C. Determination of AI-2 production in thawed supernatants was performed using the Vibrio harveyi bioluminescence assay. Significance was determined by a two-way anova with a post hoc test. *P < 0.05. Error bars indicate mean and standard deviation for three independent experiments and duplicate samples for bioluminescence.

Download figure to PowerPoint

RbsB mediates AI-2 uptake in NTHI 86-028NP

To further investigate the role of rbsB in depletion or internalization of AI-2, NTHI 86-028NP luxS::Kn was utilized to study the kinetics of AI-2 depletion during growth, independent of AI-2 production. Broth cultures were inoculated with NTHI 86-028NP luxS::Kn and supplemented with the synthetic AI-2 precursor (S)-4,5-Dihydroxy-2,3-pentanedione (DPD) as indicated, and samples were taken to assess the amount of DPD remaining in the cultures over time (Fig. 2A). By the time the cultures reached stationary phase, NTHI 86-028NP luxS::Kn had depleted the majority of DPD present in the culture. In contrast, only a minimal loss of DPD was observed in an uninoculated control. As expected, NTHI 86-028NP luxS::Kn did not produce detectable AI-2 at any point during the course of growth. Notably, mutation of rbsB in an NTHI 86-028NP luxS::Kn background almost completely abrogated depletion of DPD by this strain (Fig. 2A). In five replicate experiments, NTHI 86-028NP luxS::Kn depleted 60% of DPD from culture supernatants on average by the time the cultures reached an OD600 of approximately 0.85, while the double mutant only depleted 15% of total DPD signal (Fig. 2B). In addition, DPD levels were unaffected by cell-free culture supernatants from NTHI 86-028NP luxS::Kn and NTHI 86-028NP rbsB::Cm luxS::Kn, indicating that DPD is not being degraded by factors present in the culture supernatants (data not shown).

image

Figure 2. Mutation of rbsB limits AI-2 depletion. NTHI 86-028NP luxS::Kn and NTHI 86-028NP rbsB::Cm luxS::Kn were cultured in sBHI media alone or sBHI supplemented with 0.2 µM of the chemically synthesized AI-2 precursor (S)-4,5-Dihydroxy-2,3-pentanedione (DPD) and samples were taken to assess depletion of DPD by V. harveyi bioluminescence. An uninoculated control sample of sBHI supplemented with DPD was included as a negative control for depletion. A. A representative graph showing kinetics of AI-2 depletion by NTHI 86-028NP luxS::Kn and NTHI 86-028NP rbsB::Cm luxS::Kn. Error bars indicate mean and standard deviation for duplicate samples. B. Combined results of five independent experiments with duplicate samples showing the percent of AI-2 depleted by NTHI 86-028NP luxS::Kn versus NTHI 86-028NP rbsB::Cm luxS::Kn for culture supernatants taken at an OD600 of ∼0.85, normalized to uninoculated control samples. Error bars indicate mean and standard deviation.

Download figure to PowerPoint

Because rbsB is designated as the binding protein for a ribose transport system, we next tested the impact of ribose on DPD uptake. NTHI 86-028NP luxS::Kn was cultured in media supplemented with 0.2 µM DPD alone or with increasing concentrations of ribose, and samples were taken when the cultures reached an OD600 of approximately 0.85 for assessment of DPD depletion (Table 1). The addition of 0.1 mM ribose had no effect on DPD depletion, while ribose in excess of 1 mM inhibited depletion of DPD. Notably, this inhibition of depletion only occurred when ribose was present in 5000-fold molar excess, suggesting a higher affinity for AI-2 than for ribose. Incubation with millimolar concentrations of another pentose sugar (xylose) also limited DPD depletion, while the addition of sucrose had no impact (Table 1). Based on these results, we conclude that in NTHI strain 86-028NP, rbsB is part of an AI-2 transport system with lower affinity for pentose sugars.

Table 1.  Inhibition of DPD depletion.
TreatmentPercent DPD depletionaStandard deviationP valueb
  • a.

    Percent DPD depleted from culture at an OD600 of approximately 0.800 compared with an uninoculated control.

  • b.

    P values determined by unpaired t-test of percent DPD depletion with the indicated treatment compared with an untreated control (bold P value denotes statistical significance).

No treatment58.6610.91
Ribose   
 0.1 mM42.687.920.07
 1.0 mM34.123.570.01
 10 mM2.2810.02< 0.01
Xylose   
 0.1 mM60.4610.720.98
 1.0 mM66.652.330.07
 10 mM0.9316.83< 0.01
Sucrose   
 0.1 mM60.501.130.19
 1.0 mM61.2010.890.17
 10 mM58.102.260.10

RbsB transcript levels correlate with AI-2 production

For some bacterial species, expression of the AI-2 transport system is induced by the presence of AI-2 (Taga et al., 2001). It was therefore hypothesized that if the protein encoded by rbsB functions as an AI-2 binding protein, transcript levels may increase during late-exponential phase when bacteria reach peak AI-2 production. NTHI 86-028NP and NTHI 86-028NP luxS::Kn were therefore cultured in rich media to stationary phase, and samples were taken at various time points during growth to assess transcript levels for luxS and rbsB by real-time RT-PCR (Fig. 3). For NTHI 86-028NP, luxS transcript levels increased by approximately twofold during late-exponential phase (Fig. 3A), and rbsB transcript levels increased by approximately fivefold during late-exponential to early-stationary phase (Fig. 3B). Notably, both luxS and rbsB transcript levels remained low in the luxS mutant (Fig. 3A and B). As NTHI 86-028NP luxS::Kn was shown to deplete AI-2 from culture in Fig. 2, low-level expression of rbsB must still be sufficient to mediate AI-2 uptake, whereas increased expression of rbsB may be optimal for internalization of the high concentration of AI-2 encountered during early-stationary phase. Additionally, incubation of the luxS mutant with DPD resulted in a transient eightfold increase in rbsB transcript levels compared with a control culture (Fig. 3C), indicating that rbsB transcription increases in response to AI-2 signalling. From these data, we conclude that transcription of rbsB, and luxS to a lesser extent, are regulated by AI-2 signalling.

image

Figure 3. AI-2 increases transcription of luxS and rbsB. NTHI 86-028NP and NTHI 86-028NP luxS::Kn were cultured in sBHI media to stationary phase. Samples were taken during lag phase (OD600 0.200), exponential phase (OD600 0.500), late-exponential phase (OD600 0.750), and early stationary phase (OD600 0.950) for isolation of RNA and real-time RT-PCR analysis of luxS (A) and rbsB (B) transcript levels. Values represent the ratio of luxS or rbsB to gyrA transcript. Error bars indicate mean and standard deviation for duplicate samples. C. NTHI 86-028NP luxS::Kn was cultured in sBHI to an OD600 of ∼0.650 and supplemented with either 0.2 µM DPD or sterile water. Samples were taken before the addition of DPD or water and at 10, 30, 40, 50 and 90 min afterwards for RNA isolation and real-time RT-PCR analysis of rbsB transcript levels. Values represent the fold increase in rbsB transcript (normalized to gyrA) for the DPD treated samples compared with untreated samples. Error bars indicate mean and standard deviation for duplicate sampling from two independent experiments.

Download figure to PowerPoint

Both rbsB and luxS promote biofilm maturation

Previous studies with the NTHI 86-028NP luxS mutant showed that loss of AI-2 quorum signalling altered overall biofilm development and maturation, resulting in biofilms with reduced biomass and average thickness (Armbruster et al., 2009). As rbsB is necessary for depletion of DPD, we hypothesized that mutation of rbsB, and the concomitant loss of AI-2 internalization would diminish biofilm maturation, as we have previously observed for luxS mutants. To test this hypothesis, NTHI 86-028NP, NTHI 86-028NP luxS::Kn and NTHI 86-028NP rbsB::Cm were cultured in a continuous flow system to establish biofilms. Both mutants formed visible biofilms in the continuous flow system. Biofilms visualized by Live/Dead staining revealed differences in biofilm thickness by confocal laser scanning microscopy (CLSM) for NTHI 86-028NP luxS::Kn and NTHI 86-028NP rbsB::Cm compared with the parental strain (Fig. 4). Representative three-dimensional images of biofilms formed by each strain demonstrate the reduced biofilm biomass for the quorum signalling mutants (Fig. 4A–C). Similar to our previous work with NTHI 86-028NP luxS::Kn, both the luxS mutant and 86-028NP rbsB::Cm formed biofilms with significantly decreased biomass (Fig. 4D), surface to biovolume ratio (Fig. 4E), average thickness (Fig. 4F) and maximum thickness (Fig. 4G) compared with the parental strain.

image

Figure 4. Mutation of rbsB results in a similar biofilm defect as mutation of luxS. Biofilms formed by NTHI 86-028NP, NTHI 86-028NP luxS::Kn, and NTHI 86-028NP rbsB::Cm under continuous flow conditions were visualized with a live/dead stain by CLSM. Z-series images were used to create representative volume views of biofilms formed by NTHI 86-028NP (A), NTHI 86-028NP luxS::Kn (B) and NTHI 86-028NP rbsB::Cm (C). Z-series images were also exported to COMSTAT to obtain biofilm measurements, including total biomass (D), surface to biovolume ratio (E), average biofilm thickness (F) and maximum biofilm thickness (G). Statistical significance determined by unpaired t-test, error bars indicate standard error of the mean (n = 8).

Download figure to PowerPoint

Stationary biofilms were also established by NTHI 86-028NP, NTHI 86-028NP luxS::Kn, NTHI 86-028NP rbsB::Cm, and the complemented strain NTHI 86-028NP rbsB::Cm IRB::Sp to verify the results obtained under continuous media flow conditions and to determine the impact of genetic complementation on biofilm formation by the rbsB mutant (Fig. 5). Live/Dead staining and CLSM of biofilms formed by each strain demonstrated that NTHI 86-028NP luxS::Kn (Fig. 5D) and NTHI 86-028NP rbsB::Cm (Fig. 5C) also formed thinner biofilms with reduced total biomass (Fig. 5E) and average thickness (Fig. 5F) as compared with the parental strain NTHI 86-028NP (Fig. 5A) when cultured under stationary conditions. Notably, genetic complementation of rbsB fully restored biofilm formation by this strain as the biofilms formed by NTHI 86-028NP rbsB::Cm IRB::Sp were similar to those formed by the parental strain (Fig. 5B, E and F). From these studies, we conclude that mutation of rbsB and the resulting loss of AI-2 internalization impacts biofilm formation in a similar manner as loss of AI-2 production.

image

Figure 5. Genetic complementation fully restores biofilm formation by NTHI 86-028NP rbsB::Cm. NTHI 86-028NP, NTHI 86-028NP luxS::Kn, NTHI 86-028NP rbsB::Cm, and the complemented strain NTHI 86-028NP rbsB::Cm IRB::rbsB were cultured in sBHI media and allowed to establish stationary biofilms for 12 h. Biofilms were visualized by live/dead staining and CLSM. Vertical Z-series images were used to create representative volume views of biofilms formed by NTHI 86-028NP (A), NTHI 86-028NP rbsB::Cm IRB::rbsB (B), NTHI 86-028NP rbsB::Cm (C) and NTHI 86-028NP luxS::Kn (D). Z-series images were also exported to COMSTAT to obtain measurements of total biofilm biomass (E) and average thickness (F). Statistical significance determined by unpaired t-test. Error bars indicate mean and standard deviation (n = 6).

Download figure to PowerPoint

To further investigate the impact of AI-2 quorum signalling on biofilm formation, NTHI 86-028NP, NTHI 86-028NP luxS::Kn and NTHI 86-028NP rbsB::Cm stationary biofilms were formed in the presence or absence of DPD, and biofilms were analysed for changes in total biomass (Fig. 6). In media lacking DPD, NTHI 86-028NP formed thick biofilms while NTHI 86-028NP luxS::Kn and NTHI 86-028NP rbsB::Cm biofilms had significantly decreased total biomass (Fig. 6A) and average thickness (Fig. 6B), as previously observed. The addition of 0.2 µM DPD to NTHI 86-028NP did not significantly alter biofilm formation. For NTHI 86-028NP luxS::Kn, the addition of DPD fully restored biofilm biomass and thickness to the level observed for the parental strain. Notably, NTHI 86-028NP rbsB::Cm did not respond to DPD, as indicated by low biofilm biomass and average thickness under both treatment conditions. Taken together, these results provide concrete evidence that the biofilm defects observed for NTHI 86-028NP luxS::Kn are the direct result of loss of AI-2 signalling rather than a metabolic defect due to mutation of luxS, and that rbsB is required by NTHI strain 86-028NP to respond to AI-2.

image

Figure 6. NTHI 86-028NP requires rbsB to respond to exogenous AI-2. NTHI 86-028NP, NTHI 86-028NP luxS::Kn, and NTHI 86-028NP rbsB::Cm were cultured in sBHI media alone (white bars) or sBHI supplemented with 0.2 µM DPD (gray bars) and allowed to establish stationary biofilms for 12 h. Biofilms were visualized by live/dead staining and CLSM. Vertical Z-series images were exported to COMSTAT for analysis of total biofilm biomass (A) and average thickness (B). Statistical significance determined by unpaired t-test. **P < 0.01 compared with NTHI 86-028NP. *P < 0.01 compared with NTHI 86-028NP luxS::Kn. Error bars indicate mean and standard deviation (n = 6).

Download figure to PowerPoint

The decreased biofilm thickness and total biomass observed for NTHI 86-028NP luxS::Kn were previously attributed in part to alterations in lipooligosaccharide (LOS) moieties (Armbruster et al., 2009). Specifically, NTHI 86-028NP luxS::Kn had decreased phosphorylcholine (PCho), an LOS modification that correlates with biofilm maturation and persistence in vivo (Hong et al., 2007a,b). The level of surface-accessible PCho on NTHI 86-028NP rbsB::Cm was assessed by whole-bacterium elisa for comparison with NTHI 86-028NP, NTHI 86-028NP luxS::Kn, and NTHI 86-028NP licD::Kn, a mutant lacking the PCho transferase that is thus unable to decorate LOS with PCho (Fig. 7). As previously reported, NTHI 86-028NP luxS::Kn had significantly reduced surface-accessible PCho compared with the parental strain. NTHI 86-028NP rbsB::Cm also had reduced PCho as compared with the parental strain. Notably, the amount of surface-accessible PCho detected on NTHI 86-028NP rbsB::Cm was almost identical to the level detected on NTHI 86-028NP luxS::Kn. NTHI 86-028NP licD::Kn had negligible surface-accessible PCho, as expected.

image

Figure 7. Mutation of rbsB reduces surface-accessible PCho. A modified whole-bacterium elisa was used to detect surface phosphorylcholine using an anti-PCho monoclonal antibody. Significance determined by unpaired t-test, error bars indicate standard error of the mean (n = 12).

Download figure to PowerPoint

The biosynthetic genes involved in PCho decoration of LOS, as well as other LOS moieties, are subject to phase variation via slip-strand mispairing within repeat regions (Weiser, 2000). Therefore, the phase status of seven LOS biosynthetic genes was assessed for NTHI 86-028NP rbsB::Cm for comparison with the parental strain (Experimental procedures). No differences were observed for the phase status of genes involved in PCho decoration of LOS (Table 2). Additionally, NTHI 86-028NP rbsB::Cm phase status only differed from that of NTHI 86-028NP for oafA, which was generally in the ‘ON’ phase for NTHI 86-028NP rbsB::Cm colonies and in the ‘OFF’ phase within most NTHI 86-028NP colonies. Interestingly, altered phase status of oafA was also observed for NTHI 86-028NP luxS::Kn (Armbruster et al., 2009). The results of the phase status assessment clearly show that the reduction in surface-accessible PCho observed for NTHI 86-028NP rbsB::Cm was not due to phase variation of the LOS biosynthetic genes necessary for the addition of PCho to LOS.

Table 2.  Analysis of tetrameric repeat regions.
 NTHI 86-028NPNTHI 86-028NP rbsB::Cm
Number of coloniesNumber of colonies
  • a.

    1769 refers to NTHI_1769, a hypothetical glycosyltransferase.

oafA  
 On87
 Off241
lex2A  
 On20
 Off326
lic1A  
 On318
 Off00
lic2A  
 On248
 Off00
lic3A  
 On247
 Off00
lic3A2  
 On88
 Off00
lgtC  
 On388
 Off00
1769a  
 On88
 Off00
lav  
 On00
 Off87

Both rbsB and luxS promote the establishment of chronic NTHI infection

Our previous study of NTHI 86-028NP luxS::Kn showed that production of AI-2 was a critical factor in the ability of nontypeable H. influenzae to establish a persistent infection in the chinchilla model of OM (Armbruster et al., 2009). Based on the similarities between NTHI 86-028NP luxS::Kn and NTHI 86-028NP rbsB::Cm biofilm formation and PCho expression, it was hypothesized that mutation of rbsB and the resulting defect in AI-2 internalization would result in a similar persistence defect in the chinchilla model of OM. To test this hypothesis, chinchillas were inoculated via transbullar injection of approximately 103 cfu/ear of NTHI 86-028NP, NTHI 86-028NP luxS::Kn, or NTHI 86-028NP rbsB::Cm, and bacterial load was determined at 7, 14, 21 and 28 days post infection. Comparable numbers of each strain were recovered at 7 and 14 days post infection (Fig. 8). By 21 days post infection, a significant persistence defect was observed for the quorum signalling mutants with 13% of ears (2 of 16) infected with NTHI 86-028NP luxS::Kn and 31% of ears (5 of 16) infected with NTHI 86-028NP rbsB::Cm clear of visible signs of infection and with bacterial loads below the limit of detection. A similar trend was observed at 28 days post infection, with bacterial loads below the limit of detection observed in 33% ears (2 of 6) infected with NTHI 86-028NP luxS::Kn and 50% of ears (4 of 8) infected with NTHI 86-028NP rbsB::Cm. Notably, for animals infected with the parental strain NTHI 86-028NP a bacterial load greater than the initial inocula of 103 cfu/ear was detected at all times post infection. We thus conclude that rbsB encodes a protein critical for AI-2 quorum signalling in NTHI strain 86-028NP, that the AI-2 signalling system promotes the establishment of biofilms in vitro, and that AI-2 signalling also promotes the establishment of chronic infection by NTHI.

image

Figure 8. Mutation of rbsB limits bacterial persistence in vivo. Chinchillas were infected via transbullar inoculation with ∼103 cfu of NTHI 86-028NP (filled circles), NTHI 86-028NP luxS::Kn (open triangles), or NTHI 86-028NP rbsB::Cm (open diamonds). Total bacterial load per ear was determined by serial dilution and plating of effusion fluid, middle ear lavage, and bullar homogenate at 7, 14, 21 and 28 days post infection. Data points represent total bacterial load for individual ears, and data shown are the combined results for three independent studies (two 21 day studies and one 28 day study). Day 7: NTHI 86-028NP n = 15 ears, NTHI 86-028NP luxS::Kn n = 17 ears, NTHI 86-028NP rbsB::Cm n = 15 ears. Day 14: NTHI 86-028NP n = 15 ears, NTHI 86-028NP luxS::Kn n = 15 ears, NTHI 86-028NP rbsB::Cm n = 15 ears. Day 21: NTHI 86-028NP n = 14 ears, NTHI 86-028NP luxS::Kn n = 16 ears, NTHI 86-028NP rbsB::Cm n = 16 ears. Day 28: NTHI 86-028NP n = 8 ears, NTHI 86-028NP luxS::Kn n = 6 ears, NTHI 86-028NP rbsB::Cm n = 8 ears. The dashed line indicates limit of detection. Error bars represent the geometric mean and 95% confidence intervals. Significance determined by log transformation of the data and unpaired t-test.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

It has long been recognized that bacteria can persist within biofilm communities during chronic disease, and establishment of these bacterial communities affords protection from both immune clearance and antibiotic treatment (Stewart, 2002; Costerton et al., 2003; Ghannoum and O'Toole, 2004; Anderson and O'Toole, 2008). Due to the high rate of antibiotic resistance for chronic biofilm diseases such as OM, research focused on identifying factors that contribute to the establishment of bacterial biofilms and persistence will further our understanding of biofilm-associated disease and may aid in the development of new therapeutics. One factor that contributes to biofilm formation, maturation and dispersal for many species is bacterial cell-to-cell communication via quorum signals (Davies et al., 1998; Hardie and Heurlier, 2008). Our previous work established that NTHI 86-028NP produces AI-2 and requires luxS to form mature biofilms and establish a chronic infection (Armbruster et al., 2009), but it was unclear as to how strain 86-028NP was responding to this signalling mediator. In this study, we used a genetic approach to identify rbsB as being required for uptake of and response to AI-2 by NTHI 86-028NP, and further addressed the role of AI-2 quorum signalling in biofilm development and persistence. The results of this study clearly show that sensing of AI-2 promotes the establishment of mature NTHI biofilm communities in vitro and during experimental OM.

While previous work from our laboratory reported a prominent role for luxS in biofilm maturation and persistence, the product of luxS is a component of the activated methyl cycle and therefore plays a role in bacterial metabolism. Thus, for some species, the effects of a luxS mutation on biofilm development and virulence can be attributed to a metabolic defect rather than interference with production and sensing of AI-2 (Winzer et al., 2002; 2003; Rezzonico and Duffy, 2008; Sztajer et al., 2008). However, through the use of the AI-2 precursor DPD in the present study, we have clearly shown that the biofilm defects of a luxS mutant can be fully complemented by the addition of quorum signal. The results of this study also prove that mutation of a gene involved in the response to AI-2 in a strain with luxS intact still results in defects in biofilm maturation, indicating that this phenotype in NTHI 86-028NP is due to loss of AI-2 quorum signalling rather than any potential metabolic impact of the luxS mutation. Both the luxS mutant and the rbsB mutant exhibited decreased phosphorylcholine levels, indicating that AI-2 signalling regulates the formation of mature NTHI biofilms at least in part through modulation of LOS composition (Armbruster et al., 2009). Additionally, the results of the phase status analyses in concert with our previous study of the luxS mutant clearly exclude the possibility of an unlinked phase variation event resulting in the observed changes in biofilm maturation.

In E. coli, the LuxS-regulated (Lsr) operon for internalization of AI-2 includes lsrA, lsrC, lsrD, lsrB, the genes lsrF, lsrG and lsrE that appear to be involved in degradation of AI-2, and a divergently transcribed gene cluster containing lsrK and the repressor lsrR (Taga et al., 2003; Wang et al., 2005; Xavier and Bassler, 2005; Li et al., 2007). In contrast, the ribose transport operon of NTHI 86-028NP that includes rbsB is composed of rbsD, rbsA, rbsC, rbsB, rbsK and rbsR (Harrison et al., 2005). This configuration is more similar to the ribose transport operon of A. actinomycetemcomitans HK1651 than to the Lsr transport operon. Additionally, rbsK and rbsR do not appear to be divergently transcribed in NTHI, and the genes involved in degradation of AI-2 are lacking. However, as NTHI 86-028NP lacks a true Lsr transporter, this strain appears to be utilizing the putative ribose transporter as an AI-2/LuxS-regulated transporter for uptake of and response to AI-2. In support of this hypothesis, transcription of the lsr operon in S. typhimurium and E. coli is regulated by AI-2 and thus decreased in a luxS mutant (Taga et al., 2001; Xavier and Bassler, 2005). Therefore, the data reported herein showing low rbsB transcript levels in NTHI 86-028NP luxS::Kn and upregulation of transcript levels following the addition of DPD prove that rbsB is regulated by LuxS and AI-2 in NTHI 86-028NP.

Based on these results, rbsB in NTHI 86-028NP clearly represents an AI-2-regulated and luxS-regulated (Lsr) gene even though the operon containing rbsB is more similar to the ribose transport operon of A. actinomycetemcomitans than the Lsr operon of E. coli. In addition, the minimal impact of pentose sugars on depletion of DPD (unless in excess of 5000 times the DPD concentration) supports the conclusion that, for NTHI strain 86-028NP, rbsB is utilized as an AI-2 transporter at high cell density. It is therefore intriguing to speculate that the rest of the ribose transport operon of NTHI 86-028NP may be similarly regulated by AI-2 and function as part of a high-affinity AI-2 transporter, in addition to its possible function as a pentose sugar transporter. However, further research will be necessary to determine how the operon is regulated without apparent divergent transcription of the operon repressor. The downstream phosphorylation and detection of AI-2 and the signalling induced in response to detection of AI-2 also remain to be investigated in NTHI.

In the context of experimental OM, both the luxS mutant and the rbsB mutant were below the limit of detection in 13–50% of samples taken at 21 days post infection or later while NTHI 86-028NP continued to persist at high levels in all animals infected with this strain.

Based on these data quorum signalling does not appear to be required for acute infection, but the ability to both produce and respond to the AI-2 signal clearly contribute to the establishment of a chronic infection. This defect in persistence during chronic infection may be related to the biofilm defects observed for the quorum signalling mutants, in that minimal biofilm formation by the mutant strains may be sufficient to promote persistence during acute infection, but the formation of mature phosphorylcholine-positive biofilm communities may be necessary for the establishment and maintenance of a chronic infection and evasion of the host immune response.

In addition, while a clear trend towards clearance was observed for the quorum signalling mutants it is notable that the animals that still had detectable levels of the mutant strains at later time points carried a similar bacterial load as that observed for animals infected with the parental strain. As these infection studies are conducted using an outbred population, this difference between apparent clearance and persistence may reflect heterogeneity in the immune responses of individual chinchillas and their ability to combat the infection. However, as all 52 ears infected with the parental strain exhibited a bacterial load higher than the initial inocula regardless of the number of days post infection, these results suggest that the quorum signalling mutants are most likely more susceptible to factors of the host immune response than the parental strain. The results of the infection studies thus suggest that either only some of the animals were able to mount a sufficient immune response to promote clearance of the mutant strains, or that the quorum signalling mutants managed to overcome the defect in AI-2 signalling and/or biofilm maturation to establish a persistent population in some of the infected ears. Further research will be necessary to distinguish between these possibilities.

Similar to the results of the in vitro biofilm studies, the results of experimental infection with the luxS mutant and the rbsB mutant prove that the persistence defect previously observed for NTHI 86-028NP luxS::Kn was due to loss of AI-2 quorum signalling rather than any potential metabolic defects or to alterations in other quorum signalling networks, such as AI-3, which may be impacted by a luxS mutation (Kendall et al., 2007). However, it still remains a possibility that host factors produced during the course of infection could impact NTHI signalling networks and contribute to biofilm formation and persistence. The data presented herein thus support a prominent role for AI-2 quorum signalling in concert with other as yet undetermined factors that promote the establishment of a chronic, biofilm-associated infection. It is also possible that a mutant deficient in both the ability to produce and respond to AI-2 may have a more severe persistence defect beyond what was observed for either quorum signalling mutant strain.

NTHI remains a leading cause of OM and other upper respiratory tract infections, despite promising vaccine candidates. Our data indicate that AI-2 quorum signalling is utilized by strain 86-028NP to promote biofilm formation and establishment of chronic, persistent infections. Furthermore, our previous work indicates that AI-2 produced by NTHI impacts Moraxella catarrhalis biofilm formation, antibiotic resistance and persistence in the chinchilla model of OM (Armbruster et al., 2010; Verhaegh et al., 2011). Therefore, therapeutics aimed at interfering with AI-2 binding and signalling may prevent biofilm development or disrupt already established biofilms to augment current OM treatments. For NTHI 86-028NP, rbsB appears to be a promising target for interference with AI-2 signalling as mutation of this gene clearly has a significant biological impact on AI-2 uptake, biofilm development and persistence during experimental OM. However, it should be noted that there is considerable genomic heterogeneity among NTHI strains and that some NTHI strains possess both the ribose transport operon and an Lsr transport operon, similar to A. actinomycetemcomitans. Thus, it is possible that other NTHI strains may utilize different means for uptake of quorum signal, or that other strains may respond to AI-2 signalling in a different manner. Further investigation into transport and sensing of AI-2 in NTHI will allow for identification of virulence factors controlled by AI-2 signalling, and may reveal new target candidates for disruption of quorum signalling as a therapy for treatment of NTHI infections.

Experimental procedures

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

Bacterial strains and culture conditions

All strains of nontypeable H. influenzae were cultivated in brain heart infusion (BHI) medium (Difco) supplemented with 10 µg ml−1 haemin (ICN Biochemicals) and 10 µg ml−1 NAD (Sigma); this medium is referred to below as supplemented BHI (sBHI). Nontypeable H. influenzae (NTHI) strain 86-028NP is a nasopharyngeal isolate from a child with chronic OM (Bakaletz et al., 1988) for which the genomic sequence has been determined (Harrison et al., 2005). NTHI 86-028NP luxS::Kn contains a kanamycin resistance cassette disrupting the autoinducer-2 synthase (NTHI_0621) (Armbruster et al., 2009). NTHI 86-028NP licD::Kn contains a kanamycin resistance cassette disrupting the phosphorylcholine transferase (NTHI_1594) (West-Barnette et al., 2006).

Generation of NTHI 86-028NP rbsB::Cm

A 2313 bp DNA fragment containing rbsB (NTHI_0632) was amplified from NTHI 86-028NP genomic DNA using primers GCA ATC GCC GCT TCA ATG g and CTA CCG CTA CCC CCG TCA GG. The amplicon was ligated into pCR2.1 following InVitrogen protocol to generate pCR-rbsB. pCR-rbsB was digested with SspI, a unique site within rbsB, for ligation with a chloramphenicol resistance cassette from pCMR (Whitby et al., 1998). The resulting construct was transformed into chemically competent E. coli to generate pCR-rbsB::Cm. The expected sequence was confirmed by PCR with primers GGT TTG GCT GTT TCT GGC TCT GC and CGA TAG TTG CTG CCA TTT TGC CAC, and by sequence analysis. The plasmid DNA was linearized with BamHI and introduced into NTHI 86-028NP via natural transformation as described previously (Hong et al., 2007a,b). Transformants were plated onto sBHI agar containing 1.5 µg ml−1 chloramphenicol (Sigma) and incubated for 48 h at 37°C. Transformants carrying the expected construct were verified by PCR.

Generation of NTHI 86-028NP rbsB::Cm IRB::rbsB

A 1363 bp intergenic region (herein designated as intergenic region B, or IRB) is contained within the NTHI 86-028NP genome between NTHI_1846 and NTHI_1849. A 2248 bp segment containing IRB was amplified from NTHI 86-028NP genomic DNA using primers AGC TTC CGC CGC CAG TAA AAT and CCA AAG CGT CAG CGG ATG C. The amplicon was ligated in pCR2.1 using the TA Cloning Kit (InVitrogen) to create pCR-IRB. White colonies were verified to contain IRB using primers CCG CGT CCG AAA TAT GTG CTA C and ACT CCG CGT TAT CCC CGT CTT A. pCR-IRB was digested with SspI and dephosphorylated. A spectinomycin resistance cassette was excised from pSpec (Whitby et al., 1998) with EcoRV and ligated into the prepared pCR-IRB vector. The resulting construct was transformed into chemically competent E. coli to generate pCR-IRB::Sp. pCR-IRB::Sp was digested with StuI and dephosphorylated. pCR-rbsB (described above) was digested with BtgI and BsmFI, and the 1134 bp band containing rbsB was gel extracted and ligated into pCR-IRB::Sp. The resulting construct was transformed into chemically competent E. coli to generate pCR-IRB::rbsB. Transformants were selected by growth on Luria–Bertani (LB) plates with 100 µg ml−1 spectinomycin (Sigma), screened using primers M13F (a universal primer in pCR2.1) and CAC GGT ACC ATT TCT TGC TG (within the spectinomycin resistance cassette), and verified by restriction digest with NdeI and EcoRV to generate three bands (4118, 3435 and 938 bp). pCR-IRB::rbsB was linearized using BamHI and introduced into NTHI 86-028NP rbsB::Cm via natural transformation. Transformants were plated onto sBHI agar containing 30 µg ml−1 spectinomycin, and verified by PCR to contain both rbsB and rbsB::Cm using primers GGT TTG GCT GTT TCT GGC TCT GC and CGA TAG TTG CTG CCA TTT TGC CAC.

Generation of NTHI 86-028NP rbsB::Cm luxS::Kn

A double mutant strain was generated by disruption of luxS (NTHI _0621) in NTHI 86-028NP rbsB::Cm. The previously published plasmid pUCluxS::Kn (Armbruster et al., 2009) was linearized with SfoI and introduced into NTHI 86-028NP rbsB::Cm via natural transformation. Transformants were plated onto sBHI agar containing 30 µg ml−1 ribostamycin (Sigma), and verified by PCR to contain both luxS::Kn and rbsB::Cm.

Autoinducer-2 production and depletion

NTHI 86-028NP and NTHI 86-028NP rbsB::Cm from overnight plate cultures were diluted in 20 ml of sBHI to an OD600 of approximately 0.05 and grown to stationary phase in sidearm flasks at 37°C with shaking at 150 r.p.m. Samples were taken at hourly intervals, centrifuged for 3 min at 13000 r.p.m., and supernatants were stored at −20°C until bioluminescence assays were performed. Luminescence produced by V. harveyi BB170 (Bassler et al., 1994) following 3 h incubation with supernatant samples was determined in a Turner Designs TD-20/20 luminometer for 10 s. Data are reported as relative light units (counts per 10 s).

For AI-2 uptake studies, sBHI was supplemented with 0.2 µM (S)-4,5-Dihydroxy-2,3-pentanedione (DPD, Omm Scientific) when indicated, inoculated with ∼108 cfu of NTHI (OD600 ∼ 0.15), and incubated at 37°C and 150 r.p.m. Samples were taken at hourly intervals, centrifuged, and stored at −20°C as above. This concentration of DPD was chosen as it elicits approximately equivalent luminescence from V. harveyi as NTHI 86-028NP late exponential phase culture supernatant (OD600 of approximately 0.750). For inhibition studies, NTHI 86-028NP luxS::Kn cultures were supplemented with ribose (Sigma), xylose (Sigma) or sucrose (Sigma) to a final concentration of 0.1, 1.0 or 10 mM as indicated and samples were taken at mid-logarithmic phase of growth (OD600 of ∼0.85).

Real-time RT-PCR

NTHI 86-028NP and NTHI 86-028NP luxS::Kn were grown in sBHI to stationary phase, and 0.5 ml samples were taken at the indicated optical densities for isolation of RNA as per RNeasy Mini kit instructions (Qiagen). On-column DNase treatment of samples was performed using the RNase-Free DNase set (Qiagen). RNA concentration and purity were determined using a NanoDrop ND-1000 spectrophotometer (version 3.1.2). RT-PCR master mixes were prepared using the TaqMan One-Step RT-PCR Master Mix Reagents kit (Applied Biosystems). A complete list of primers and probes is provided in Table 3 (all primers were purchased from Eurofins, and Fam/Tamra probes were purchased from Sigma). Each RT-PCR reaction was conducted in duplicate using 100 ng total RNA in a final volume of 25 µl per well. Thermocycling conditions in an ABI Prism 7000 Sequence Detection System (Applied Biosystems) were as follows: 1 cycle of 48°C for 30 min, 1 cycle of 95°C for 10 min, and 40 cycles of 95°C for 15 s and 60°C for 1 min. Transcript levels were determined for luxS, rbsB and gyrA using the 7000 System SDS Software (version 1.2.3f2). For each analysis, control experiments lacking reverse transcriptase treatment were performed and showed no detectable products.

Table 3.  Real time PCR primers.
PrimerSequence
gyrA forward5′-GCATTACCTGACGTTCGAGATG-3′
gyrA reverse5′-CCTTCGCGATCCATTGAGAA-3′
gyrA probe5′-6TTTAAAACCAGTTCACCGCCGCGTAC0-3′
luxS forward5′-TGCGGAAGCTATACGGAACA-3′
luxS reverse5′-CCTATACCGCGTGCGATAACA-3′
luxS probe5′-6TCCTTAGAAGATGCACACGAAATTGCCAA0-3′
rbsB forward5′-TGATGCTCATAAATTCAATGTGCTT-3′
rbsB reverse5′-TTTCCGTTACATTCAAACCTTTTG-3′
rbsB probe5′-6CCAGTCAGCCAGCAGATTTTGATCGA0-3′

Continuous flow system

NTHI biofilms were established in a continuous flow system as previously described (Hong et al., 2007b). NTHI 86-028NP, NTHI 86-028NP luxS::Kn, and NTHI 86-028NP rbsB::Cm were diluted to ∼108 cfu ml−1 in sBHI broth, injected into the port of a commercial microscopy flow-cell (Stovall), and incubated for 3 h at 37°C without medium flow to permit bacterial surface attachment. Continuous flow of sBHI media was initiated at a rate of ∼60 ml per hour and maintained for 24 h.

Stationary biofilm system

NTHI stationary biofilms were established in Lab-TekII two-chamber No. 1.5 German coverglass slides (Nunc). NTHI 86-028NP, NTHI 86-028NP luxS::Kn, NTHI 86-028NP rbsB::Cm, and NTHI 86-028NP rbsB::Cm IRB::rbsB were diluted to ∼108 cfu ml−1 in sBHI broth (or sBHI supplemented with 0.2 µM DPD as indicated). Chambers of the coverglass slides were inoculated with 2 ml of the bacterial suspension, and biofilms were established at 37°C and 5% CO2 for 12 h.

CLSM

Biofilm samples were washed once with PBS and stained with a LIVE/DEAD BacLight viability kit (InVitrogen). Z-series images of biofilms were collected using either a Zeiss LSM510 CLSM microscope or a Nikon Eclipse C1 CLSM microscope. Between five and eight image stacks, each representing a different field of view, were compiled for each strain. The Z-series images were visualized using the Nikon Elements software and exported into MATLAB (version 5.1) for COMSTAT analysis as previously described (Heydorn et al., 2002).

Whole-bacteria elisa

elisas were performed on intact bacterial cells as described previously (Jones et al., 2002; Armbruster et al., 2009). Bacteria were diluted in distilled H2O to an OD600 of 0.150 (∼108 cfu ml−1), and 0.1 ml was dispensed into each well of a MaxiSorp-coated 96-well microtitre plate (Nunc) and dried overnight uncovered at 37°C for 24 h. Plates were washed once and blocked for 30 min in TSBB buffer (10 mM Tris, 0.5 M NaCl, 0.5% Tween, pH = 8.0). Wells were incubated with 0.1 ml anti-phosphorylcholine monoclonal antibody HAS (Statens Serum Institut) overnight at room temperature, washed once, and incubated for 1 h in the dark with goat-anti-mouse IgM-horseradish peroxidase (HRP) conjugate. Wells were then washed once and incubated in the dark for approximately 20 min with 0.1 ml of TMB substrate reagent (OptEIA, Becton-Dickinson). The reaction was stopped with 0.05 ml of 2 N H2SO4, and OD450 measured using a plate reader (Labsystems Multiskan Plus).

Assessment of phase-variable genes

Determination of ON/OFF state of phase-variable genes was performed as previously described (Erwin et al., 2006; Armbruster et al., 2009). Individual colonies of each NTHI strain were harvested from plate cultures suspended in 0.1 ml of 10% suspension of Chelex (Bio-Rad). Genomic DNA was prepared by vortexing suspensions for 15 s, boiling for 10 min, chilling on ice for 2 min, and centrifugation at 8000 g for 2 min. Supernatants (0.05 ml) were transferred to fresh tubes for PCR amplification and sizing by means of GeneMapper (Applied Biosystems, Foster City, CA, USA) analysis at the DNA Sequencing Facility of the WFUHS Biomolecular Resource Laboratory as previously described (Armbruster et al., 2009). Numbers of repeats for each region were estimated based on fragment size, and used in accordance with the previously defined genomic sequence of each region to define ‘on’ or ‘off’ status of each phase-variable region.

Chinchilla infection studies

Bacterial persistence and biofilm formation in the middle ear cavity were assessed as described previously (Hong et al., 2007a,b; Armbruster et al., 2009). Chinchillas were purchased from Rauscher's chinchilla ranch (Larue, OH, USA) and allowed to acclimate to the vivarium for > 7 days before infection. No animals showed visible signs of illness before infection. The animals were anaesthetized with isofluorane and infected via transbullar injection with ∼103 cfu of NTHI 86-028NP, NTHI 86-028NP luxS::Kn, or NTHI 86-028NP rbsB::Cm. All inocula were confirmed by plate-counts. The degree of inflammation was assessed at 48 h intervals by digital otoscopic examination using a qualitative scoring system of 1 to 4, with 4 being the most severe (Hong et al., 2007a). Animals were euthanized at 7, 14, 21 and 28 days post infection and bullae were aseptically opened. Fluids within the middle ear were recovered and middle ear lavage was performed using 1.0 ml sterile PBS. Both bullae were then excised and homogenized in 10 ml sterile PBS (Hong et al., 2007a). Total cfu/ear were determined by combining bacterial counts obtained for homogenized bullae and middle-ear effusion fluid with lavage.

Statistics

Significance was determined by nonparametric t-test, unpaired t-test or two-way anova with post hoc tests of significance as indicated. All P values are two-tailed at a 95% confidence interval. Analyses were performed using GraphPad Prism, version 5 (GraphPad Software, San Diego, CA, USA).

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References

The authors acknowledge excellent assistance by Gayle Foster, Jim Turner, the WFU sequencing facility, and helpful comments and critiques from Dr Steven Mizel and Dr Marlena Westcott. This work was supported by grants from NIH/NIDCD (DC007444 and DC10051) awarded to W. E. Swords. Chelsie E. Armbruster and Kristin E.D. Weimer were supported by an NIH training grant (T32 AI07401).

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  • Anderson, G.G., and O'Toole, G.A. (2008) Innate and induced resistance mechanisms of bacterial biofilms. Curr Top Microbiol Immunol 322: 85105.
  • Armbruster, C.E., and Swords, W.E. (2010) Interspecies bacterial communication as a target for therapy in otitis media. Expert Rev Anti Infect Ther 8: 10671070.
  • Armbruster, C.E., Hong, W., Pang, B., Dew, K.E., Juneau, R.A., Byrd, M.S., et al. (2009) LuxS promotes biofilm maturation and persistence of nontypeable Haemophilus influenzae in vivo via modulation of lipooligosaccharides on the bacterial surface. Infect Immun 77: 40814091.
  • Armbruster, C.E., Hong, W., Pang, B., Weimer, K.E.D., Juneau, R.A., Turner, J., and Swords, W.E. (2010) Indirect Pathogenicity of Haemophilus influenzae and Moraxella catarrhalis in Polymicrobial Otitis Media Occurs via Interspecies Quorum Signaling. mBio 1 (3): e00102–10.
  • Bakaletz, L.O. (2007) Bacterial biofilms in otitis media: evidence and relevance. Pediatr Infect Dis J 26: S17S19.
  • Bakaletz, L.O., Tallan, B.M., Hoepf, T., DeMaria, T.F., Birck, H.G., and Lim, D.J. (1988) Frequency of fimbriation of nontypable Haemophilus influenzae and its ability to adhere to chinchilla and human respiratory epithelium. Infect Immun 56: 331335.
  • Bassler, B.L., Wright, M., and Silverman, M.R. (1994) Multiple signalling systems controlling expression of luminescence in Vibrio harveyi: sequence and function of genes encoding a second sensory pathway. Mol Microbiol 13: 273286.
  • Costerton, J.W., Stewart, P.S., and Greenberg, E.P. (1999) Bacterial biofilms: a common cause of persistent infections. Science 284: 13181322.
  • Costerton, W., Veeh, R., Shirtliff, M., Pasmore, M., Post, C., and Ehrlich, G. (2003) The application of biofilm science to the study and control of chronic bacterial infections. J Clin Invest 112: 14661477.
  • Davies, D.G., Parsek, M.R., Pearson, J.P., Iglewski, B.H., Costerton, J.W., and Greenberg, E.P. (1998) The Involvement of Cell-to-Cell Signals in the Development of a Bacterial Biofilm. Science 280: 295298.
  • Ehrlich, G.D., Veeh, R., Wang, X., Costerton, J.W., Hayes, J.D., Hu, F.Z., et al. (2002) Mucosal biofilm formation on middle-ear mucosa in the chinchilla model of otitis media. JAMA 287: 17101715.
  • Erwin, A.L., and Smith, A.L. (2007) Nontypeable Haemophilus influenzae: understanding virulence and commensal behavior. Trends Microbiol 15: 355362.
  • Erwin, A.L., Allen, S., Ho, D.K., Bonthuis, P.J., Jarisch, J., Nelson, K.L., et al. (2006) Role of lgtC in resistance of nontypeable Haemophilus influenzae strain R2866 to human serum. Infect Immun 74: 62266235.
  • Faden, H., Waz, M.J., Bernstein, J.M., Brodsky, L., Stanievich, J., and Ogra, P.L. (1991) Nasopharyngeal flora in the first three years of life in normal and otitis-prone children. Ann Otol Rhinol Laryngol 100: 612615.
  • Finkelstein, J.A., Davis, R.L., Dowell, S.F., Metlay, J.P., Soumerai, S.B., Rifas-Shiman, S.L., et al. (2001) Reducing Antibiotic Use in Children: A Randomized Trial in 12 Practices. Pediatrics 108: 17.
  • Ghannoum, M.A., and O'Toole, G.A. (2004) Microbial Biofilms. p. xiii, 426 p., [410] p. of plates. Washington, D.C.: ASM Press.
  • Hall-Stoodley, L., Hu, F.Z., Gieseke, A., Nistico, L., Nguyen, D., Hayes, J.D., et al. (2006) Direct detection of bacterial biofilms on the middle ear mucosa of children with chronic otitis media. JAMA 296: 202211.
  • Hardie, K.R., and Heurlier, K. (2008) Establishing bacterial communities by ‘word of mouth’: LuxS and autoinducer 2 in biofilm development. Nat Rev Microbiol 6: 635643.
  • Harrison, A., Dyer, D.W., Gillaspy, A., Ray, W.C., Mungur, R., Carson, M.B., et al. (2005) Genomic sequence of an otitis media isolate of nontypeable Haemophilus influenzae: comparative study with H. influenzae serotype d, strain KW20. J Bacteriol 187: 46274636.
  • Henke, J.M., and Bassler, B.L. (2004) Three parallel quorum-sensing systems regulate gene expression in Vibrio harveyi. J Bacteriol 186: 69026914.
  • Heydorn, A., Ersboll, B., Kato, J., Hentzer, M., Parsek, M.R., Tolker-Nielsen, T., et al. (2002) Statistical analysis of Pseudomonas aeruginosa biofilm development: impact of mutations in genes involved in twitching motility, cell-to-cell signaling, and stationary-phase sigma factor expression. Appl Environ Microbiol 68: 20082017.
  • Hoa, M., Tomovic, S., Nistico, L., Hall-Stoodley, L., Stoodley, P., Sachdeva, L., et al. (2009) Identification of adenoid biofilms with middle ear pathogens in otitis-prone children utilizing SEM and FISH. Int J Pediatr Otorhinolaryngol 73: 12421248.
  • Hong, W., Mason, K., Jurcisek, J.A., Novotny, L.A., Bakaletz, L.O., and Swords, W.E. (2007a) Phosphorylcholine decreases early inflammation and promotes the establishment of stable biofilm communities of nontypeable Haemophilus influenzae strain 86-028NP in a chinchilla model of otitis media. Infect Immun 75: 958965.
  • Hong, W., Pang, B., West-Barnette, S., and Swords, W.E. (2007b) Phosphorylcholine expression by nontypeable Haemophilus influenzae correlates with maturation of biofilm communities in vitro and in vivo. J Bacteriol 189: 83008307.
  • James, D., Shao, H., Lamont, R.J., and Demuth, D.R. (2006) The Actinobacillus actinomycetemcomitans ribose binding protein RbsB interacts with cognate and heterologous autoinducer 2 signals. Infect Immun 74: 40214029.
  • Jayaraman, A., and Wood, T.K. (2008) Bacterial quorum sensing: signals, circuits, and implications for biofilms and disease. Annu Rev Biomed Eng 10: 145167.
  • Jones, P.A., Samuels, N.A., Phillips, N.J., Munson, R.S., Bozue, J.A., Arseneau, J.A., et al. (2002) Haemophilus influenzae type B strain A2 has multiple sialyltransferases involved in lipooligosaccharide sialylation. J Biol Chem 277: 1459814611.
  • Kendall, M.M., Rasko, D.A., and Sperandio, V. (2007) Global effects of the cell-to-cell signaling molecules autoinducer-2, autoinducer-3, and epinephrine in a luxS mutant of enterohemorrhagic Escherichia coli. Infect Immun 75: 48754884.
  • Klein, J.O. (2000) The burden of otitis media. Vaccine 19: S2S8.
  • Li, J., Attila, C., Wang, L., Wood, T.K., Valdes, J.J., and Bentley, W.E. (2007) Quorum sensing in Escherichia coli is signaled by AI-2/LsrR: effects on small RNA and biofilm architecture. J Bacteriol 189: 60116020.
  • Mandel, E.M., Doyle, W.J., Winther, B., and Alper, C.M. (2008) The incidence, prevalence and burden of OM in unselected children aged 1-8 years followed by weekly otoscopy through the ‘common cold’ season. Int J Pediatr Otorhinolaryngol 72: 491499.
  • Miller, M.B., and Bassler, B.L. (2001) Quorum sensing in bacteria. Annu Rev Microbiol 55: 165199.
  • Miller, S.T., Xavier, K.B., Campagna, S.R., Taga, M.E., Semmelhack, M.F., Bassler, B.L., and Hughson, F.M. (2004) Salmonella typhimurium recognizes a chemically distinct form of the bacterial quorum-sensing signal AI-2. Mol Cell 15: 677687.
  • Nistico, L., Kreft, R., Gieseke, A., Coticchia, J.M., Burrows, A., Khampang, P., et al. (2011) An Adenoid Reservoir for Pathogenic Biofilm Bacteria. J Clin Microbiol 49: 14111420.
  • Pereira, C.S., McAuley, J.R., Taga, M.E., Xavier, K.B., and Miller, S.T. (2008) Sinorhizobium meliloti, a bacterium lacking the autoinducer-2 (AI-2) synthase, responds to AI-2 supplied by other bacteria. Mol Microbiol 70: 12231235.
  • Pichichero, M.E. (2000) Recurrent and persistent otitis media. Pediatr Infect Dis J 19: 911916.
  • Post, J.C. (2001) Direct evidence of bacterial biofilms in otitis media. Laryngoscope 111: 20832094.
  • Post, J.C., Hiller, N.L., Nistico, L., Stoodley, P., and Ehrlich, G.D. (2007) The role of biofilms in otolaryngologic infections: update 2007. Curr Opin Otolaryngol Head Neck Surg 15: 347351.
  • Rezzonico, F., and Duffy, B. (2008) Lack of genomic evidence of AI-2 receptors suggests a non-quorum sensing role for luxS in most bacteria. BMC Microbiol 8: 154.
  • Shao, H., Lamont, R.J., and Demuth, D.R. (2007a) Autoinducer 2 Is Required for Biofilm Growth of Aggregatibacter (Actinobacillus) actinomycetemcomitans. Infect Immun 75: 42114218.
  • Shao, H., James, D., Lamont, R.J., and Demuth, D.R. (2007b) Differential interaction of Aggregatibacter (Actinobacillus) actinomycetemcomitans LsrB and RbsB proteins with autoinducer 2. J Bacteriol 189: 55595565.
  • Stewart, P.S. (2002) Mechanisms of antibiotic resistance in bacterial biofilms. Int J Med Microbiol 292: 107113.
  • Sztajer, H., Lemme, A., Vilchez, R., Schulz, S., Geffers, R., Yip, C.Y., et al. (2008) Autoinducer-2-regulated genes in Streptococcus mutans UA159 and global metabolic effect of the luxS mutation. J Bacteriol 190: 401415.
  • Taga, M.E., Semmelhack, J.L., and Bassler, B.L. (2001) The LuxS-dependent autoinducer AI-2 controls the expression of an ABC transporter that functions in AI-2 uptake in Salmonella typhimurium. Mol Microbiol 42: 777793.
  • Taga, M.E., Miller, S.T., and Bassler, B.L. (2003) Lsr-mediated transport and processing of AI-2 in Salmonella typhimurium. Mol Microbiol 50: 14111427.
  • Verhaegh, S.J., Snippe, M.L., Levy, F., Verbrugh, H.A., Jaddoe, V.W., Hofman, A., et al. (2011) Colonization of healthy children by Moraxella catarrhalis is characterized by genotype heterogeneity, virulence gene diversity and co-colonization with Haemophilus influenzae. Microbiology 157: 169178.
  • Wang, L., Li, J., March, J.C., Valdes, J.J., and Bentley, W.E. (2005) luxS-dependent gene regulation in Escherichia coli K-12 revealed by genomic expression profiling. J Bacteriol 187: 83508360.
  • Waters, C.M., and Bassler, B.L. (2005) Quorum sensing: cell-to-cell communication in bacteria. Annu Rev Cell Dev Biol 21: 319346.
  • Weiser, J.N. (2000) The generation of diversity by Haemophilus influenzae. Trends Microbiol 8: 433435.
  • West-Barnette, S., Rockel, A., and Swords, W.E. (2006) Biofilm growth increases phosphorylcholine content and decreases potency of nontypeable Haemophilus influenzae endotoxins. Infect Immun 74: 18281836.
  • Whitby, P.W., Morton, D.J., and Stull, T.L. (1998) Construction of antibiotic resistance cassettes with multiple paired restriction sites for insertional mutagenesis of Haemophilus influenzae. FEMS Microbiol Lett 158: 5760.
  • Winzer, K., Hardie, K.R., Burgess, N., Doherty, N., Kirke, D., Holden, M.T., et al. (2002) LuxS: its role in central metabolism and the in vitro synthesis of 4-hydroxy-5-methyl-3(2H)-furanone. Microbiology 148: 909922.
  • Winzer, K., Hardie, K.R., and Williams, P. (2003) LuxS and autoinducer-2: their contribution to quorum sensing and metabolism in bacteria. Adv Appl Microbiol 53: 291396.
  • Xavier, K.B., and Bassler, B.L. (2005) Regulation of uptake and processing of the quorum-sensing autoinducer AI-2 in Escherichia coli. J Bacteriol 187: 238248.