SEARCH

SEARCH BY CITATION

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

Pathogenic mycobacteria require type VII secretion (T7S) systems to transport virulence factors across their complex cell envelope. These bacteria have up to five of these systems, termed ESX-1 to ESX-5. Here, we show that ESX-5 of Mycobacterium tuberculosis mediates the secretion of EsxN, PPE and PE_PGRS proteins, indicating that ESX-5 is a major secretion pathway in this important pathogen. Using the ESX-5 system of Mycobacterium marinum and Mycobacterium bovis BCG as a model, we have purified and analysed the T7S membrane complex under native conditions. blue native-PAGE and immunoprecipitation experiments showed that the ESX-5 membrane complex of both species has a size of ∼ 1500 kDa and is composed of four conserved membrane proteins, i.e. EccB5, EccC5, EccD5 and EccE5. Subsequent limited proteolysis suggests that EccC5 and EccE5 mostly reside on the periphery of the complex. We also observed that EccC5 and EccD5 expression is essential for the formation of a stable membrane complex. These are the first data on a T7S membrane complex and, given the high conservation of its components, our data can likely be generalized to most mycobacterial T7S systems.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

Protein secretion is crucial for most bacterial pathogens as they need to secrete virulence factors to exploit nutrient resources within the host and to escape destruction by the immune system. Also pathogenic mycobacteria, such as Mycobacterium tuberculosis, secrete important virulence factors, for which they require specialized secretion systems due to the highly complex and unusual mycobacterial cell envelope. This cell envelope contains, in addition to the regular inner membrane, a unique outer membrane, also called the mycomembrane, which is mainly composed of covalently attached mycolic acids intercalated with free (glycol)lipids (Hoffmann et al., 2008; Zuber et al., 2008). For the secretion of proteins across this cell envelope, mycobacteria employ the recently discovered transport pathway known as type VII secretion (T7S) (Abdallah et al., 2007). Pathogenic mycobacteria can have up to five different T7S systems, designated ESX-1 to ESX-5, which probably evolved by gene duplication. The best-studied T7S system is ESX-1, which is responsible for the secretion of a small number of proteins, including the important virulence factors early-secretory antigenic-target protein 6 (ESAT-6, also named EsxA) and culture filtrate protein 10 (CFP-10, also called EsxB) (Stanley et al., 2003; Fortune et al., 2005; MacGurn et al., 2005; McLaughlin et al., 2007; Carlsson et al., 2009). The components involved in secretion are encoded by the esx-1 locus. This region is partially missing in the vaccine strain Mycobacterium bovis BCG (Gordon et al., 1999) and a considerable body of work has now demonstrated the pivotal role of ESX-1 in mycobacterial survival inside the host (Simeone et al., 2009).

Another T7S system that has recently been investigated is ESX-5. Interestingly, ESX-5 is the most-recently evolved T7S system and is restricted to the slow-growing mycobacterial species, which include all major pathogens, such as M. tuberculosis, Mycobacterium leprae, Mycobacterium ulcerans and Mycobacterium marinum (Gey van Pittius et al., 2006). In M. marinum, ESX-5 mediates the secretion of a large number of mycobacterium-specific proteins, called PE and PPE proteins (Abdallah et al., 2006; 2009; Daleke et al., 2011), and plays a role in immune modulation (Abdallah et al., 2008; 2011; Weerdenburg et al., 2012). The PE and PPE proteins are named after the Pro-Glu (PE) and Pro-Pro-Glu (PPE) motifs near their N-terminus respectively (Cole et al., 1998). While non-pathogenic mycobacteria only have a few of these proteins, they are vastly expanded in pathogenic species. For M. tuberculosis, the 167 genes encoding for PE and PPE proteins cover about 10% of the coding capacity and were one of the major surprises upon sequencing of the M. tuberculosis genome (Cole et al., 1998). Interestingly, the appearance of ESX-5 predates the huge expansion of the pe/ppe gene families in pathogenic mycobacteria (Gey van Pittius et al., 2006). The function of PE and PPE proteins is still very enigmatic, but the limited data available suggest that PE and PPE proteins are cell wall proteins exposed on the cell surface that are important for mycobacterial virulence (reviewed in Sampson, 2011).

Although the role of T7S substrates during mycobacterial infections is studied intensively, the mechanism of secretion is still unclear. Previous research has shown that the ESX-1 substrates ESAT-6 and CFP-10 are secreted as a heterodimer and depend on a small C-terminal secretion signal on CFP-10 for interaction with the ESX-1 system (Champion et al., 2006). However, the nature of the secretion channel and the mechanism of transfer of substrates through this channel are unknown. The five T7S systems of mycobacteria share a number of highly conserved components (Gey Van Pittius et al., 2001; Bitter et al., 2009) for which we have recently proposed a unified nomenclature, i.e. EccA (ESX-conserved component) through EccE and MycP (Bitter et al., 2009). Five of these components are predicted to be membrane proteins and could therefore participate in the formation of the translocation channel. Although their function is largely unknown, two of these proteins show homology to proteins with known functions: i.e. the mycosin MycP, which contains a predicted protease motif and belongs to the well-studied subtilisin protein family, and EccC, which has predicted nucleotide-binding domains (NBDs) and is a member of the so-called FtsK/SpoIIIE family of ATPases. Interestingly, another member of this latter family is VirD4 that plays a central role in type IV secretion (T4S), suggesting that EccC could play a similar important role in T7S.

In this study, we focus on the T7S membrane complex, using the ESX-5 secretion system as a model. We first show that ESX-5 is responsible for the secretion of several extracellular proteins in M. tuberculosis, including PE and PPE proteins, and that the membrane components EccC5 and most likely also EccD5 are essential for the secretion process. Subsequently, we used pulldown assays to reveal that the ESX-5 membrane complex is composed of EccB5, EccC5, EccD5 and EccE5. The architecture of this membrane complex was subsequently investigated by limited proteolysis experiments. We finally propose a new model for T7S across the unique mycobacterial cell envelope.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

ESX-5 mediates secretion of PE and PPE proteins in M. tuberculosis

To investigate the functionality of the ESX-5 secretion system in mycobacteria, we have previously performed multiple screening methods using M. marinum. In those studies, we only obtained mutants in two genes, i.e. eccA5 and espG5, both of which were defective in the secretion of various PE and PPE proteins (Abdallah et al., 2006; 2009; Daleke et al., 2011). In this study, we sought to determine the function of ESX-5 in the human pathogen M. tuberculosis and to identify additional functional components of ESX-5. Therefore, we screened a collection of transposon mutants in strain CDC1551, a recent clinical isolate. These mutants have transposon insertions in four genes within the esx-5 locus (Fig. 1A), i.e. eccC5, eccD5, eccA5 and ppe27. While eccC5 and eccD5 encode putative membrane proteins postulated to be part of the machinery that mediates transport across the mycobacterial cell envelope, eccA5 and ppe27 encode predicted soluble cytosolic and secreted proteins respectively. The transposon mutant in the esx-1 gene eccA1 was analysed as control.

figure

Figure 1. Role of ESX-5 components in secretion of EsxN, PPE41 and PE_PGRS proteins.

A. Schematic representation of the esx-5 gene locus in M. tuberculosis CDC1551 (http://cmr.jcvi.org/tigr-scripts/CMR/GenomePage.cgi?org=gmt). Genes conserved in other esx gene clusters are depicted in different shades of grey, while region-specific genes are in black.

B. Immunoblot analysis of supernatants and cell pellets of wild-type (WT) M. tuberculosis CDC1551 and mutants bearing transposons in various esx-5 (eccC5, eccD5, eccA5, ppe27) and esx-1 (eccA1) genes. GroEL2 staining was used as a control for lysis and equal loading.

C. Complementation of M. tuberculosis CDC1551 ESX-5 transposon mutants. Immunoblot analysis of supernatants and cell pellets of wild-type (WT), eccC5 and eccD5 mutants and mutants bearing the ESX-5 complementation plasmid. GroEL2 staining was used as a control for lysis and equal loading.

Download figure to PowerPoint

The different M. tuberculosis transposon mutants and the wild-type strain were first examined for expression and secretion of EsxN, the esx-5 locus-encoded homologue of ESAT-6, by immunoblot analysis. The strains with transposon insertions in eccC5 and eccD5 showed a strong defect in EsxN secretion (Fig. 1B), which was accompanied by a concomitant accumulation of EsxN in the cell pellet fraction. In contrast, mutations in eccA5, ppe27 and the esx-1 gene eccA1 showed wild-type levels of EsxN secretion (Fig. 1B). The result was surprising for eccA5, as we previously described its role in ESX-5-dependent secretion in M. marinum (Abdallah et al., 2006). The secretion of the archetype ESX-1 substrate ESAT-6 was not affected in any of the mutants, even in the eccA1 mutant. This latter result was surprising, because similar mutations are described to affect ESX-1 functioning in Mycobacterium microti (Brodin et al., 2006) and M. marinum (Gao et al., 2004; McLaughlin et al., 2007; Xu et al., 2007). EsxN secretion was restored when the eccC5 and eccD5 mutants were complemented with a plasmid containing the esx-5 gene cluster (Fig. 1C), showing that the lack of secretion was due to the transposon insertion in the esx-5 region. Complementation of the eccD5 transposon mutant with a plasmid containing only the eccD5 gene was unsuccessful. Although the reason for this is unclear, it is known that genes that are located in genomic regions containing several operon structures, such as the esx-associated genes, can often only be complemented with larger gene clusters (Mahairas et al., 1996; Bottai et al., 2012). To examine polar effects of transposon insertions on the transcription of upstream and downstream genes in the eccC5 and eccD5 mutants we analysed the mRNA levels of eccB5, espG5, mycP5 and eccE5 (Fig. S1). The only polar effects we could observe were some upregulation of mycP5 in the eccD5 mutant, whereas mRNA levels of the other genes were unaltered. Thus, for the examined ESX-5 genes, only eccC5 and the eccD5 operon are essential for the secretion of the esx-5-encoded EsxN.

Next, we studied the secretion of PE and PPE proteins by M. tuberculosis using a polyclonal antibody against PPE41 and a monoclonal antibody directed against the PGRS domain of PE_PGRS33 (Rv1818c) in immunoblot analysis. The latter antibody specifically interacts with multiple PE_PGRS proteins (Abdallah et al., 2009), the largest subfamily of PE proteins, and could therefore potentially recognize all 58 putative PE_PGRS proteins of M. tuberculosis CDC1551 (Fleischmann et al., 2002) (Fig. 1B). Analysis of the different transposon mutants revealed that again the eccC5 and the eccD5 mutants of M. tuberculosis are defective in the secretion of both PPE41 and PE_PGRS proteins, with a concomitant accumulation of PPE41 in the bacterial cells (Fig. 1B). Expression of PE_PGRS proteins was stable in these two mutants, unlike previously observed for M. marinum ESX-5 mutants. Again, introduction of the esx-5 complementation vector reversed the secretion defects of the eccC5 and eccD5 mutations (Fig. 1C). The other mutants, including the eccA5 mutant, showed no or mild secretion defects. In fact, for the ppe27 mutant we observed an increased secretion of PPE41 and PE_PGRS proteins. In summary, the two putative membrane components EccC5 and probably EccD5 are crucial for ESX-5-dependent secretion in M. tuberculosis and the ESX-5 system dictates the secretion of EsxN, PPE41 and a number of PE proteins.

Five conserved ESX-5 components localize to the mycobacterial cell envelope

Since the predicted membrane components EccC5 and most likely EccD5 are essential for ESX-5-dependent secretion, these components could possibly form the translocation channel in the mycobacterial cell envelope. To verify the cell envelope location of EccC5, EccD5 and other conserved components encoded within the esx-5 locus, a set of specific antibodies was generated (for specificity of the antibodies, see Fig. S2). These antibodies were used to analyse the cytosolic and the cell envelope fraction of M. marinum (Fig. 2A). M. marinum lysates were span at 100 000 g to pellet the cell envelope fraction, which consists of both the inner membrane and the mycolic-acid containing outer membrane (Rezwan et al., 2007). Proper fractionation was verified by immunoblot analysis of known cytosolic (GroEL2), inner membrane [FtsH; (Ito and Akiyama, 2005)] and mycomembrane [MctB; (Siroy et al., 2008)] proteins (Fig. 2B). While the esx-5-encoded proteins EccA5, EsxN and EspG5 were detected in the cytosolic fraction, EccB5, EccC5, EccD5, EccE5 and MycP5 localized to the cell envelope fraction, which is consistent with the presence of predicted transmembrane domains in their protein sequence. These five T7S core components are therefore putative components of the T7S membrane complex.

figure

Figure 2. Subcellular localization of ESX-5 components. Immunoblot analysis of total (T), cytosol (Cyt) and cell envelope (CE) fractions of M. marinum using antibodies against ESX-5 components (A) and the marker proteins GroEL2 (cytosolic protein), FtsH (inner membrane protein) and MctB (mycomembrane protein) (B).

Download figure to PowerPoint

ESX-5 membrane proteins form large complexes up to ∼ 1500 kDa

To investigate whether the conserved membrane components of ESX-5 form a multimeric protein machinery, M. marinum cell envelope fractions were purified and solubilized in the mild non-ionic detergent n-dodecyl beta-D-maltoside (DDM), and complex formation of the solubilized ESX-5 components was analysed by blue native-polyacrylamide gel electrophoresis (BN-PAGE) and immunoblot analysis (Fig. 3A). All four antibodies directed against EccB5, EccC5, EccD5 and EccE5 reacted with a major complex of ∼ 1500 kDa. While this complex is the most abundant one, four smaller complexes were additionally detected by all four antisera. To determine if our results can be generalized to ESX-5 systems of other mycobacteria, we also analysed cell envelopes of M. bovis BCG, the tuberculosis vaccine strain and a close homologue of M. tuberculosis (with 99% identity). BN-PAGE analysis of solubilized M. bovis BCG cell envelopes revealed comparable complexes, suggesting that ESX-5 complex formation is conserved (Fig. 3B). As a control, we also analysed BN-PAGE gels using antibodies directed against the control membrane protein MctB. Using this antibody, different complexes were stained, indicating that the ∼ 1500 kDa complex is indeed specific for the ESX-5 components. Next, we analysed the effect of chemical cross-linkers on ESX-5 complexes. Addition of dithiobis(succinimidyl propionate) (DSP), which covalently links juxtaposed lysine residues, induced a shift from the lower to the higher molecular weight complex (Fig. 3A), suggesting that the ∼ 1500 kDa complex is the relevant structure present in the mycobacterial cell envelope, while the smaller complexes probably represent partly dissociated complexes.

figure

Figure 3. Complex formation of ESX-5 membrane components. Immunoblot analysis of detergent-solubilized cell envelope fractions of M. marinum (A) treated with and without the chemical cross-linker DSP and M. bovis BCG (B) after blue native-polyacrylamide gel electrophoresis. The five observed complexes using antibodies against ESX-5 components are marked with an arrow.

Download figure to PowerPoint

Isolation of the ESX-5 membrane complex

To investigate the composition of the ESX-5 membrane complex in more detail, we performed immune precipitation experiments using the antibody directed against EccB5 and cell envelopes of M. marinum and M. bovis BCG. The EccB5 antibody or antibodies isolated from corresponding pre-immune serum were linked to protein A sepharose beads and subsequently incubated with detergent-solubilized membrane proteins (Fig. 4A). In both M. marinum and M. bovis BCG, four proteins were specifically purified using the EccB5 antibody, while they were missing in the pulldown samples using the corresponding antibodies from pre-immune serum. Immunoblot analysis (Fig. 4B) and nano-liquid chromatography tandem mass spectrometry (nanoLC-MS/MS; Table S2) identified these proteins as EccB5, EccC5, EccD5 and EccE5, demonstrating that these four ESX-5 membrane components interact. Importantly, when we repeated the immune precipitation experiments using the EccC5 antibody, the same four proteins were purified from M. marinum membranes (Fig. 4A, lane 3). The ESX-5 membrane complex did not seem to contain other components, encoded either by the esx-5 locus, or elsewhere on the genome. In particular, the absence of the fifth conserved membrane protein of the T7S system, i.e. MycP5, was apparent. In conclusion, ESX-5 forms a conserved ∼ 1500 kDa complex in the mycobacterial cell envelope consisting of EccB5, EccC5, EccD5 and EccE5.

figure

Figure 4. Isolation of the ESX-5 membrane complex. SDS-polyacrylamide gel electrophoresis analysis and Coomassie staining (A) or immunoblotting (B) of the purified ESX-5 membrane complex of M. marinum (A, lanes 1 to 3; B, lanes 1 and 2) and M. bovis BCG (A, lanes 4 and 5; B, lanes 3 and 4) using antibodies against EccB5 (A, lanes 2 and 5; B, lanes 2 and 4) or EccC5 (A, lane 3). Purifications using pre-immune serum (A, lanes 1 and 4; B, lanes 1 and 3) served as negative control. Isolated proteins were analysed by mass spectrometry.

Download figure to PowerPoint

Architecture of the ESX-5 membrane complex

To gain more insight in the architecture of the ESX-5 membrane complex, limited protease digestions were carried out. Low amounts of protease typically results in the digestion of exposed domains while leaving the core structure of a complex intact. Cell envelope fractions of M. marinum were incubated with 10 or 50 μg ml−1 trypsin, either directly or after solubilization by DDM, and then analysed by SDS-PAGE and immunoblotting (Fig. 5A). Solubilization of the ESX-5 membrane complex did not largely influence the sensitivity of the ESX-5 subunits for trypsin, suggesting that the protease-sensitive domains are equally well exposed in the context of the mycobacterial cell envelope as when the complex is in solution. Figure 5A shows that EccB5 and EccD5 are largely intact after treatment with 10 μg ml−1 trypsin, while full-length EccC5 and EccE5 could hardly be detected. In fact, novel protein bands of ∼ 50 kDa for EccC5 and ∼ 35 kDa for EccE5 appeared, demonstrating that these proteins are partially digested.

figure

Figure 5. Trypsinization of the ESX-5 membrane complex.

A. Immunoblot of trypsinized (0, 10 or 50 μg ml−1 trypsin) M. marinum cell envelope fractions with (+) or without (−) prior DDM solubilization and after SDS-polyacrylamide gel electrophoresis. The full-length (>) and processed (*) products are indicated.

B. SDS-polyacrylamide gel electrophoresis analysis of purified ESX-5 membrane complexes with (lane 2) and without (lane 1) 10 μg ml−1 trypsin treatment. The full-length and processed (*) products were verified by mass spectrometry.

C. Schematic representation of composition of the trypsinized complex. Digested parts are depicted as hatched boxes. Predicted transmembrane domains (dark grey) and nucleotide-binding domains (NBD; light grey) are indicated. The numbers indicate the protein lengths in amino acids.

Download figure to PowerPoint

To determine which domains of EccC5 and EccE5 are digested by trypsin and whether the trypsin-resistant domains are still part of the ESX-5 membrane complex, the solubilized ESX-5 membrane complex of M. marinum was incubated with 10 μg ml−1 trypsin and purified using antibody-coated beads (Fig. 5B). As expected, the trypsinized and purified complex contained full-length EccB5 and EccD5, while full-length EccC5 and EccE5 were absent. Additionally, novel protein bands of ∼ 50 kDa and ∼ 35 kDa appeared, which were identified by mass spectrometry as processed fragments of EccC5 and EccE5 respectively (Fig. S3). Interestingly, the identified peptides in the ∼ 50 kDa band covered a region of EccC5 that was much larger than the observed molecular weight. Therefore, we suspect that the observed protein band consists of two ∼ 50 kDa portions of EccC5, of which only the more C-terminal portion is recognized by the EccC5 antiserum (Fig. 5C). For EccE5, the N-terminal domain, including the two predicted transmembrane helices, was removed. In conclusion, the middle and C-terminal domain of EccC5 and the N-terminal domain of EccE5 appear to be mostly exposed on the surface of the ESX-5 membrane complex. In addition, as trypsin digestion was similar for solubilized ESX-5 complexes as for complexes that are not solubilized by detergent, we can conclude that these digestible domains are not shielded by the mycobacterial cell envelope.

Stability of ESX-5 membrane components

To examine whether the components of the membrane channel depend on each other for stability, we tested our M. tuberculosis transposon mutants for stable expression of EccB5 and EspG5, the only two orthologues of M. tuberculosis that are efficiently recognized by our antibodies directed against M. marinum proteins. Immunoblot analysis showed that the expression of the cytosolic protein EspG5 was not affected in any of the mutant strains. In contrast, EccB5 expression was abolished when eccC5 or eccD5 were mutated (Fig. 6A), and this phenotype could be reversed when the eccC5 and eccD5 mutants were complemented with a plasmid containing the complete esx-5 gene cluster (Fig. 6B). The loss of EccB5 was not due to lower eccB5 transcription in these mutants, since mRNA levels of eccB5 were comparable in all strains (Fig. S1). Thus, the membrane components EccC5 and probably EccD5 are not only essential for secretion, but are also required for stable expression of EccB5.

figure

Figure 6. EccC5 and EccD5 expression is required for ESX-5 complex stability.

A. Immunoblot analysis of total cell lysates from wild-type (WT) M. tuberculosis CDC1551 and mutants bearing transposons in various esx-5 and esx-1 genes. GroEL2 staining served as a control for equal loading.

B. Complementation of M. tuberculosis CDC1551 ESX-5 transposon mutants. Immunoblot analysis of total cell lysates of wild-type (WT), eccC5 and eccD5 mutants and mutants bearing the ESX-5 complementation plasmid. GroEL2 staining was used as a control for lysis and equal loading.

C. Immunoblot analysis of cytosol (for EccA5 and EspG5) and cell envelope (for EccB5, EccC5, EccD5, EccE5, MycP5 and FtsH) fractions of wild-type (WT) M. marinum, eccC5 deletion mutant (ΔeccC5) and complemented strain (ΔeccC5::eccBC5) using antibodies against ESX-5 components and the inner membrane marker FtsH.

D. Immunoblot analysis of detergent-solubilized cell envelope fractions of wild-type (WT) M. marinum, eccC5 deletion mutant (ΔeccC5) and complemented strain (ΔeccC5::eccBC5) after blue native-polyacrylamide gel electrophoresis.

Download figure to PowerPoint

To corroborate these results, a M. marinum strain with a nearly complete markerless deletion of the eccC5 gene was constructed and used to analyse ESX-5 complex stability. Similarly to M. tuberculosis, secretion of EsxN and PE_PGRS proteins was abolished in this eccC5 mutant (Fig. S4) and this phenotype could be complemented by introducing eccC5 located on a plasmid. We then analysed the expression of the ESX-5 components in this mutant. As expected, EccC5 was not detected in this strain (Fig. 6C). Interestingly, while MycP5, EccA5, EspG5 and the unrelated membrane protein FtsH were normally present in the eccC5 mutant, EccD5 levels were strongly reduced and also EccB5 and EccE5 levels were diminished. Complementation of the eccC5 mutant restored the expression of these three proteins. Thus, stable expression of EccD5 and to some extent EccB5 and EccE5 is affected by the absence of EccC5 in M. marinum, similarly as we had observed for the EccC5 mutant in M. tuberculosis.

We subsequently examined the effect of the eccC5 deletion in M. marinum on complex formation. To investigate whether the residual EccB5, EccD5 and EccE5 molecules still produce membrane complexes, cell envelope proteins were solubilized in DDM and analysed by BN-PAGE and immunoblotting (Fig. 6D). None of the three membrane proteins showed complexes on BN-PAGE, demonstrating that they do not form stable complexes in the absence of EccC5. Thus, EccC5 is required to maintain a stable complex conformation.

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

In this study, we have investigated the functionality and composition of T7S systems, using ESX-5 as a model. We have shown that ESX-5 mediates the secretion of EsxN, PPE41 and PE_PGRS proteins in M. tuberculosis and that the two membrane components EccC5 and probably EccD5 are essential for this process. The observation that PE and PPE protein families are vastly expanded in M. tuberculosis and that ESX-5 seems to be the preferred pathway for the secretion of these proteins together indicate that ESX-5 is a major secretion pathway in this pathogen. Furthermore, we identified that the ESX-5 secretion membrane complex of M. marinum and M. bovis BCG is composed of the conserved membrane proteins EccB5, EccC5, EccD5 and EccE5 and has an apparent size of ∼ 1500 kDa. As these components are highly conserved, our data can most likely be generalized to the mycobacterial T7S systems ESX-1, ESX-2 and ESX-3. The exception is probably the ESX-4 system, because the ESX-4 locus does not contain an apparent eccE homologue.

Very recently, the crucial role of ESX-5 in virulence and the ESX-5-dependent secretion of EsxN and PPE41 were described for M. tuberculosis H37Rv (Bottai et al., 2012). The effect of ESX-5 mutations on PE_PGRS secretion was not clear, but seemed to be independent of ESX-5. In case these results are true, we have no explanation for this discrepancy between the two M. tuberculosis strains. Bottai et al. (2012) also observed an EccA5 dependency for EsxN and PPE41 secretion in H37Rv, in contrast to what we describe here for M. tuberculosis CDC1551. These differences might be caused by different growth conditions used in the various studies, but alternatively, EccA5 could play different roles in ESX-5 secretion in different mycobacterial species and strains or might be redundant in M. tuberculosis CDC1551.

Interestingly, also ESX-1-mediated secretion shows a varied dependency on the presence of EccA1. In this study, we observed that ESAT-6 secretion is not affected by mutating eccA1 in M. tuberculosis CDC1551, while previous data showed that ESX-1 secretion was not restored in M. microti when the M. tuberculosis H37Rv esx-1 region was introduced with a transposon insertion in eccA1 (Brodin et al., 2006). In addition, other studies showed that EccA1 is required for ESX-1 secretion in M. marinum (Gao et al., 2004; McLaughlin et al., 2007; Xu et al., 2007), but not in Mycobacterium smegmatis (Converse and Cox, 2005).

In this study, we elucidated the size, composition and architecture of the ESX-5 membrane complex by isolating it under native conditions. Both in M. marinum and M. bovis BCG, this complex is composed of the membrane proteins EccB5, EccC5, EccD5 and EccE5. As this complex likely functions as the channel through which substrates are transported across the mycobacterial cell envelope, it is not surprising that EccC5 and EccD5 are essential for the secretion of ESX-5 substrates. In addition, expression of all the components of the secretion complex seems to be required for maintaining a stable membrane complex as the lack of EccC5 and/or EccD5 affects the stability the other ESX-5 complex components and membrane complex formation.

We demonstrated that the ESX-5 membrane complex has a size of ∼ 1500 kDa. The relative abundance of each component in the purified complex was extrapolated from the nanoLC-MS/MS data by determining two factors: the protein abundance index and the normalized spectral abundance factor (Rappsilber et al., 2002; Paoletti et al., 2006; Table S3). Both values suggest that EccB5, EccC5 and EccD5 are present in roughly equal copies, while EccE5 is present in a lower number (approximately half). This stoichiometry is consistent with SDS-PAGE analysis and Coomassie staining of the same purified complex. Thus, assuming a 2:2:2:1 ratio, the ∼ 1500 kDa complex observed by BN-PAGE followed by immunoblot analysis might consist of six copies of EccB5, EccC5 and EccD5 and three copies of EccE5, resulting in a complex of 1668 kDa. Besides this dominant complex, BN-PAGE revealed four smaller complexes. As these additional complexes were also detected with antisera against all four membrane constituents, they must all be present in the protein subcomplexes, and therefore the smallest complex of ∼ 750 kDa already contains all four ESX-5 proteins. The EccC5 component is a putative ATPase that belongs to the well-conserved family of FtsK/SpoIIIE family, of which different members have been shown to form hexamers (Massey et al., 2006). This is in accordance with the proposed six copies of EccC5 present in the intact complex. However, based on molecular weight calculations, the smallest ESX-5 subcomplex cannot contain hexameric EccC5. Another striking feature of the complex is that it lacks the fifth conserved membrane component encoded by the mycobacterial esx loci, i.e. the subtilin-like protease mycosin. Apparently, this protease, although required for secretion via ESX-1, is not tightly associated with the core complex.

Limited protease digestion of the membrane complex revealed cleavage of the N-terminal part of EccE5, containing two predicted transmembrane domains, and a middle and C-terminal segment of EccC5, both having a NBD. Probably, these domains are therefore mostly exposed on the surface of the complex. As these domains are similarly sensitive to trypsin when the complex is still embedded within the mycobacterial cell envelope, it is tempting to speculate that these domains are also extending from this intricate lipid structure. Based on these findings, we propose two models for the composition of the T7S membrane complex (Fig. 7). In the first model (Fig. 7A), the four components are embedded in the cytosolic membrane via their predicted transmembrane domains, where they assemble into a large membrane channel. The three NBDs of EccC are likely involved in energizing translocation of substrates through the translocation channel. In this model, the T7S membrane complex is located entirely within the inner membrane, which also could imply that T7S is a two-step process. In the alternative model (Fig. 7B), we propose that the T7S membrane channel mediates protein translocation in one step over both the inner membrane and the mycomembrane. This means that one of the T7S components should form a pore in the mycomembrane. The rationale for choosing EccE as the mycomembrane component in the model is twofold: (i) the predicted transmembrane domains of EccE are sensitive to protease digestion, not only when the complex is solubilized in detergent but also when the complex is still embedded in the mycobacterial cell envelope and (ii) EccE is the only component of the membrane complex that is restricted to T7S systems of species with a mycolic acid-rich outer membrane, such as Mycobacterium, Rhodococcus and Nocardia species (Gey Van Pittius et al., 2001). In addition, EccE is absent in ESX-4, which is the most ancient T7S system in mycobacteria (Gey Van Pittius et al., 2001), suggesting that this component is not part of the core structure. One argument against this hypothesis is that EccE does not have the characteristics of a Gram-negative outer membrane protein. However, very few mycomembrane proteins have been identified so far and their characteristics are therefore still unclear.

figure

Figure 7. Models of the T7S membrane channel. Presented here are our current working hypotheses, in which EccBCDE are embedded in the cytosolic membrane, where they assemble into a large membrane complex. The three nucleotide-binding domains of EccC are likely involved in energizing translocation of substrates through the translocation channel. In this model, T7S is a two-step (A) or a one-step (B) process. IM, inner membrane; PG, peptidoglycan; AG, arabinogalactan; OM, mycobacterial outer membrane.

Download figure to PowerPoint

EccC is the only component of the T7S membrane complex that shows homology to a component of other established specialized protein secretion systems, i.e. the VirD4 protein of T4S systems. The structure of the T4S core complex has recently been solved by cryo-electron microscopy (Fronzes et al., 2009) and crystallization (Chandran et al., 2009). The complex has a size (∼ 1100 kDa) in the range of the T7S membrane complex and spans both the inner and the outer membrane of the Gram-negative cell envelope. However, VirD4 was not part of the core complex and it therefore is unclear how this ATPase interacts with the membrane channel. Since the T7S membrane complex is unstable in the absence of EccC, the properties of T4S and T7S membrane complex are different.

These are the first biochemical data on the nature and composition of the T7S membrane complex. The elucidation of its size, composition and architecture is an important step forward in unravelling the molecular machinery that transports virulence factors across the unique mycobacterial cell envelope. Future research will focus on obtaining detailed structural information of this crucial membrane complex.

Experimental procedures

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

Bacterial strains and culture conditions

Wilde-type M. tuberculosis CDC1551 strain and transposon mutants in eccC5 (JHU1783-2086), eccD5 (JHU1795-1400), eccA5 (JHU1798-305), ppe27 (JHU1790-82), eccA1 (JHU3868-236) were kindly provided by BEI Resources (Lamichhane et al., 2003). M. marinum strain E11, M. bovis BCG strain Tice (Leung et al., 2008) and the M. tuberculosis CDC1551 strains were grown at 30°C or 37°C in Middlebrook 7H9 broth (Difco) supplemented with 0.2% glycerol, 10% oleic acid–albumin–dextrose–catalase (OADC) (BBC) and 0.05% Tween 80.

EccC5 knockout in M. marinum and ESX-5 complementation

To produce an eccC5 knockout in M. marinum first a merodiploid strain was created. Anchored primers (EcoRI for the 5′ primer and HindIII for the 3′ primer) were used to amplify both eccB5 and eccC5 from M. marinum M strain genomic DNA by PCR. Amplicons were cloned as EcoRI–HindIII fragments in the integrative plasmid pMV361 (Stover et al., 1991) and sequenced (ABI), resulting in pMV–eccBC5. This plasmid was introduced in M. marinum MVU by electroporation, after which endogenous eccC5 gene was deleted by allelic exchange using a specialized transducing mycobacteriophage (Bardarov et al., 1997). Fragments bearing the 1164/1186 bp of flanking regions of endogenous eccC5 of M. marinum, which will result in a deletion of 96% of the gene, were synthesized by PCR (primer set EccC ko Lf TTTTTTTTCCATAAATTGGGCCGTCGGACTTCAATCCAG and EccC ko Lr TTTTTTTTCCATTTCTTGGCGGTGTTGGCAGAACGATGT for the 5′ region and primer set EccC ko Rf TTTTTTTTCCATAGATTGGTCATTCGCGGCAAGATGAAG and EccC ko Rr TTTTTTTTCCATCTTTTGGGAATGGCCACTACTACCTGA for the 3′ flanking region). Amplicons corresponding to 5′ or 3′ flanking regions were digested with Van91I and cloned into the Van91I-digested p0004s plasmid that contains a hygromycin resistance cassette and the sacB gene to be able to select for sucrose sensitivity. This allelic exchange substrate was introduced into the PacI site of phasmid phAE159 and electroporated into M. smegmatis mc2155 to obtain high titres of phage pHAE159 according to Bardarov et al. (1997). Subsequently, the M. marinum strain containing pMV–eccBC5 was incubated with high titres of phage. Colonies in which endogenous eccC5 was deleted were selected on hygromycin plates and verified for sucrose sensitivity. The deletion was confirmed by PCR analysis and sequencing. Using a temperature-sensitive phage encoding the γδ-resolvase (TnpR) (a kind gift from Apoorva Bhatt, University of Birmingham, UK), the resistance genes was removed, generating an unmarked deletion mutation. Efforts to obtain an eccC5 negative mutant by exchanging pMV–eccBC5 with pSM128 (Timm et al., 1994; Pashley and Parish, 2003) that integrates at the same site as pMV361 and contains a streptomycin resistance cassette were unsuccessful, indicating that eccC5 is essential for growth of M. marinum (R. Ummels, A. Hol Horeman, W. Bitter, and E.N.G. Houben, in preparation). Subsequently, a transposon library of this delinquent strain was used to select for an eccC5 negative mutant following the same switching procedure. The removal of pMV–eccBC5 in the obtained mutant, which contained a transposon insertion at a position unrelated to the esx clusters (R. Ummels, A. Hol Horeman, W. Bitter, and E.N.G. Houben, in preparation), was confirmed by PCR analysis. Finally, a complemented version of this strain was produced by a second switching procedure to re-introduce the pMV–eccBC5 plasmid.

The complete esx-5 genomic locus of M. tuberculosis CDC1551 was amplified by PCR as two separate ∼ 10 kb amplicons using anchored primers (amplicon 1: PacI for the 5′ primer and SdaI for the 3′ primer; amplicon 2: SdaI for the 5′ primer and PacI for the 3′ primer). The obtained PCR products were digested, ligated and cloned at the PacI site of a modified pMV361 vector (Stover et al., 1991), in which the kanamycin resistance cassette is replaced by a hygromycin cassette and a PacI site was introduced at the HindIII restriction site.

Antisera

To generate antiserum against EccC5, the C-terminal 2220 nucleotides corresponding to amino acids 650–1389 of M. marinum eccC5 were amplified by PCR using anchored primers (BamHI for the 5′ primer and HindIII for the 3′ primer) and cloned behind a His-tag in pQE30 (Qiagen). For EccD5 antibodies the N-terminal 399 nucleotides (amino acids 1–133) of M. marinum eccD5 were amplified by PCR using anchored primers (PstI for the 5′ primer and HindIII for the 3′ primer) and also cloned behind a His-tag into pQE31 (Qiagen). Both constructs were introduced in Escherichia coli M15-pREP4 (Qiagen) and heterologously expressed proteins were extracted from inclusion bodies by 8 M urea, before they were purified by HisTrap HP columns (GE Healthcare). For EccA5 antibodies the N-terminal 930 nucleotides corresponding to amino acids 1–310 of M. marinum eccA5 were amplified by PCR using anchored primers (EcoRI for the 5′ primer and SpeI for the 3′ primer) and cloned behind a glutathione-S-transferase (GST)-tag into pRP265, a pGEX derivative (Smith and Johnson, 1988). GST–EccA5 fusion protein was purified from E. coli TOP10F1 cells in the presence of 1 M urea by a GSTrap affinity column (Amersham Biosciences) and the GST-tag was removed with the Thrombin CleanCleave kit (Sigma-Aldrich). Antisera against EccB5, EccE5, MycP5, EspG5 and MctB were raised against synthetic peptides (EccB5, CLPMDMSPAELVVPK; EccE5, CGLNRLTGRQLAAVR; MycP5, CGLSPRDDGLINAID; EspG5, CAVYARQYRDDAKGP; MctB, CFVEANSAEKLRSV). Polyclonal rabbit antisera against the peptides and purified proteins were raised in rabbits by Innovagen (Lund, Sweden) using Stimune (Prionix) as adjuvants.

Rabbit polyclonal antibodies against E. coli FtsH were raised as explained previously (van Bloois et al., 2008). Mouse anti-GroEL2, mouse anti-ESAT-6 (Hyb76-8) and rabbit anti-EsxN (Mtb9.9a) were kind gifts from J. Belisle (Colorado State University, and the NIH, Bethesda, MD, USA), Ida Rosenkrand (Statens Seruminstitut, Copenhagen, Denmark) and B. McLaughlin (UCSF, San Francisco, USA) respectively. Rabbit anti-PPE41 and mouse anti-PE_PGRS (7C4.1F7) were described previously (Abdallah et al., 2006).

Some of the antibodies were purified from crude serum using HiTrap Protein A HP columns according to the manufacturer's protocol (GE Healthcare).

Analysis of expression and secretion of mycobacterial proteins

Mycobacteria were grown to mid-logarithmic phase in Middlebrook 7H9 broth supplemented with 0.2% dextrose and 0.05% Tween 80. Supernatants were separated from bacterial cells by centrifugation, after which the samples were heat inactivated (30 min 80°C). Proteins in the cell-free supernatants were precipitated with 10% TCA. Cell pellets were lysed by bead beating using 425–600 μm glass beads (Sigma) in PBS and protein concentrations were measured using the BCA protein assay (Pierce). Proteins were separated by SDS-PAGE and visualized by immunoblotting.

Subcellular fractionation

Bacteria were grown to mid-logarithmic phase in 7H9 medium, washed three times in cold PBS and resuspended in lysis buffer [PBS, 250 mM sucrose, 1 mM EDTA, Complete Protease Inhibitor Cocktail (Roche)]. The bacteria were lysed by two passages at 0.83 kbar through a OneShot cell disrupter (Constant Systems). Unbroken cells were removed by centrifugation three times for 5 min at 3000 g. Subsequently, cell envelopes were separated from the cytosolic fraction by ultracentrifugation for 45 min at 100 000 g. The cell envelope pellet was resuspended in PBS–250 mM sucrose, protein concentration was measured and aliquots were stored at −80°C.

Immunoprecipitation

Purified antibodies were incubated overnight with protein A sepharose beads (GE Healthcare) and cross-linked to the beads using 2 mM disuccinimidyl suberate (DSS) for 1 h at room temperature. Antibody-coated beads were washed five times with 100 mM citric acid (pH 3.0) to remove non-cross-linked antibodies, after which the pH was neutralized by repeated washing with PBS. Isolated cell envelopes were diluted in PBS and solubilized in 0.25% n-dodecyl β-D-maltoside (DDM; Sigma) for 30 min on ice. Non-solubilized material was spun down for 30 min at 100 000 g. Subsequently, 50% antibody-coated beads were added and the mixture was incubated for 2 h head over head at 4°C. The beads were washed two times with PBS–0.04% DDM and incubated with 50 μl of solubilization buffer (50 mM Tris-HCl pH 6.8, 2% SDS, 10% glycerol, bromophenol blue) for 10 min at 37°C. 30 mM DTT was subsequently added to the eluted material and samples were re-incubated for 10 min at 37°C.

Cross-linking, trypsin treatment and BN-PAGE

Cell envelope fractions were diluted in PBS and incubated with 1 mM DSP or DMSO (control) for 30 min on ice. Subsequently, the cross-linker was quenched for 30 min with 100 mM glycine, 10 mm NaHPO4 (pH 8.5). Ten or 50 μg ml−1 trypsin (Sigma) was added either to untreated cell envelopes or to DDM-solubilized membrane proteins and left for 1 h on ice. Trypsin was then blocked with 0.2 mg ml−1 trypsin inhibitor (Sigma) for another 15 min on ice. DDM-solubilized membrane complexes were analysed by blue native-PAGE (BN-PAGE) and immunoblotting using the NativePAGE Novex 3–12% BisTris gels according to the manufacturer's protocol (Invitrogen).

Mass spectrometry analysis

Processing of protein lanes from Coomassie-stained SDS-PAGE gels, NanoLC-MS/MS, MS/MS spectra searching against the M. marinum and M. bovis BCG FASTA databases and peptide validation were performed as previously described (Shevchenko et al., 1996; Piersma et al., 2009). Label-free relative quantification was performed by spectral counting and for each identified protein the number of associated MS/MS spectra was counted and used as quantitative value. Spectral counts have been shown to be proportional with relative protein abundance in a complex mixture (Liu et al., 2004).

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information

We are grateful to Maria Daleke and Aniek van der Woude for the purification of the EccA5 antigen and peptide design for antibody production, respectively, and subsequent testing of antisera. We thank Ana Sauri for helpful suggestions on immunoprecipitation experiments and Musa Sani, Nicole van der Wel and Peter Peters for fruitful discussions. This work was supported by a VENI grant from the Netherlands Organization for Scientific Research (to E. N. G. H.) and the European Community's Seventh Framework Programme (FP7/2007–2013) under Grant Agreement No. 201762 (to J. B. and W. B.).

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information
  • Abdallah, A.M., Verboom, T., Hannes, F., Safi, M., Strong, M., Eisenberg, D., et al. (2006) A specific secretion system mediates PPE41 transport in pathogenic mycobacteria. Mol Microbiol 62: 667679.
  • Abdallah, A.M., Gey van Pittius, N.C., Champion, P.A., Cox, J., Luirink, J., Vandenbroucke-Grauls, C.M., et al. (2007) Type VII secretion—mycobacteria show the way. Nat Rev Microbiol 5: 883891.
  • Abdallah, A.M., Savage, N.D., van Zon, M., Wilson, L., Vandenbroucke-Grauls, C.M., van der Wel, N.N., et al. (2008) The ESX-5 secretion system of Mycobacterium marinum modulates the macrophage response. J Immunol 181: 71667175.
  • Abdallah, A.M., Verboom, T., Weerdenburg, E.M., Gey van Pittius, N.C., Mahasha, P.W., Jimenez, C., et al. (2009) PPE and PE_PGRS proteins of Mycobacterium marinum are transported via the type VII secretion system ESX-5. Mol Microbiol 73: 329340.
  • Abdallah, A.M., Bestebroer, J., Savage, N.D., de Punder, K., van Zon, M., Wilson, L., et al. (2011) Mycobacterial secretion systems ESX-1 and ESX-5 play distinct roles in host cell death and inflammasome activation. J Immunol 187: 47444753.
  • Bardarov, S., Kriakov, J., Carriere, C., Yu, S., Vaamonde, C., McAdam, R.A., et al. (1997) Conditionally replicating mycobacteriophages: a system for transposon delivery to Mycobacterium tuberculosis . Proc Natl Acad Sci USA 94: 1096110966.
  • Bitter, W., Houben, E.N.G., Bottai, D., Brodin, P., Brown, E.J., Cox, J.S., et al. (2009) Systematic genetic nomenclature for type VII secretion systems. PLoS Pathog 5: e1000507.
  • van Bloois, E., Dekker, H.L., Fröderberg, L., Houben, E.N.G., Urbanus, M.L., de Koster, C.G., et al. (2008) Detection of cross-links between FtsH, YidC, HflK/C suggests a linked role for these proteins in quality control upon insertion of bacterial inner membrane proteins. FEBS Lett 582: 14191424.
  • Bottai, D., Di Luca, M., Majlessi, L., Frigui, W., Simeone, R., Sayes, F., et al. (2012) Disruption of the ESX-5 system of Mycobacterium tuberculosis causes loss of PPE protein secretion, reduction of cell wall integrity and strong attenuation. Mol Microbiol 83: 11951209.
  • Brodin, P., Majlessi, L., Marsollier, L., de Jonge, M.I., Bottai, D., Demangel, C., et al. (2006) Dissection of ESAT-6 system 1 of Mycobacterium tuberculosis and impact on immunogenicity and virulence. Infect Immun 74: 8898.
  • Carlsson, F., Joshi, S.A., Rangell, L., and Brown, E.J. (2009) Polar localization of virulence-related Esx-1 secretion in mycobacteria. PLoS Pathog 5: e1000285.
  • Champion, P.A., Stanley, S.A., Champion, M.M., Brown, E.J., and Cox, J.S. (2006) C-terminal signal sequence promotes virulence factor secretion in Mycobacterium tuberculosis . Science 313: 16321636.
  • Chandran, V., Fronzes, R., Duquerroy, S., Cronin, N., Navaza, J., and Waksman, G. (2009) Structure of the outer membrane complex of a type IV secretion system. Nature 462: 10111015.
  • Cole, S.T., Brosch, R., Parkhill, J., Garnier, T., Churcher, C., Harris, D., et al. (1998) Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 393: 537544.
  • Converse, S.E., and Cox, J.S. (2005) A protein secretion pathway critical for Mycobacterium tuberculosis virulence is conserved and functional in Mycobacterium smegmatis . J Bacteriol 187: 12381245.
  • Daleke, M.H., Cascioferro, A., de Punder, K., Ummels, R., Abdallah, A.M., van der Wel, N., et al. (2011) Conserved Pro-Glu (PE) and Pro-Pro-Glu (PPE) protein domains target LipY lipases of pathogenic mycobacteria to the cell surface via the ESX-5 pathway. J Biol Chem 286: 1902419034.
  • Fleischmann, R.D., Alland, D., Eisen, J.A., Carpenter, L., White, O., Peterson, J., et al. (2002) Whole-genome comparison of Mycobacterium tuberculosis clinical and laboratory strains. J Bacteriol 184: 54795490.
  • Fortune, S.M., Jaeger, A., Sarracino, D.A., Chase, M.R., Sassetti, C.M., Sherman, D.R., et al. (2005) Mutually dependent secretion of proteins required for mycobacterial virulence. Proc Natl Acad Sci USA 102: 1067610681.
  • Fronzes, R., Schafer, E., Wang, L., Saibil, H.R., Orlova, E.V., and Waksman, G. (2009) Structure of a type IV secretion system core complex. Science 323: 266268.
  • Gao, L.Y., Guo, S., McLaughlin, B., Morisaki, H., Engel, J.N., and Brown, E.J. (2004) A mycobacterial virulence gene cluster extending RD1 is required for cytolysis, bacterial spreading and ESAT-6 secretion. Mol Microbiol 53: 16771693.
  • Gey Van Pittius, N.C., Gamieldien, J., Hide, W., Brown, G.D., Siezen, R.J., and Beyers, A.D. (2001) The ESAT-6 gene cluster of Mycobacterium tuberculosis and other high G+C Gram-positive bacteria. Genome Biol 2: RESEARCH0044.
  • Gey van Pittius, N.C., Sampson, S.L., Lee, H., Kim, Y., van Helden, P.D., and Warren, R.M. (2006) Evolution and expansion of the Mycobacterium tuberculosis PE and PPE multigene families and their association with the duplication of the ESAT-6 (esx) gene cluster regions. BMC Evol Biol 6: 95.
  • Gordon, S.V., Brosch, R., Billault, A., Garnier, T., Eiglmeier, K., and Cole, S.T. (1999) Identification of variable regions in the genomes of tubercle bacilli using bacterial artificial chromosome arrays. Mol Microbiol 32: 643655.
  • Hoffmann, C., Leis, A., Niederweis, M., Plitzko, J.M., and Engelhardt, H. (2008) Disclosure of the mycobacterial outer membrane: cryo-electron tomography and vitreous sections reveal the lipid bilayer structure. Proc Natl Acad Sci USA 105: 39633967.
  • Ito, K., and Akiyama, Y. (2005) Cellular functions, mechanism of action, and regulation of FtsH protease. Annu Rev Microbiol 59: 211231.
  • Lamichhane, G., Zignol, M., Blades, N.J., Geiman, D.E., Dougherty, A., Grosset, J., et al. (2003) A postgenomic method for predicting essential genes at subsaturation levels of mutagenesis: application to Mycobacterium tuberculosis . Proc Natl Acad Sci USA 100: 72137218.
  • Leung, A.S., Tran, V., Wu, Z., Yu, X., Alexander, D.C., Gao, G.F., et al. (2008) Novel genome polymorphisms in BCG vaccine strains and impact on efficacy. BMC Genomics 9: 413.
  • Liu, H., Sadygov, R.G., and Yates, J.R., 3rd (2004) A model for random sampling and estimation of relative protein abundance in shotgun proteomics. Anal Chem 76: 41934201.
  • MacGurn, J.A., Raghavan, S., Stanley, S.A., and Cox, J.S. (2005) A non-RD1 gene cluster is required for Snm secretion in Mycobacterium tuberculosis . Mol Microbiol 57: 16531663.
  • McLaughlin, B., Chon, J.S., MacGurn, J.A., Carlsson, F., Cheng, T.L., Cox, J.S., and Brown, E.J. (2007) A mycobacterium ESX-1-secreted virulence factor with unique requirements for export. PLoS Pathog 3: e105.
  • Mahairas, G.G., Sabo, P.J., Hickey, M.J., Singh, D.C., and Stover, C.K. (1996) Molecular analysis of genetic differences between Mycobacterium bovis BCG and virulent M. bovis . J Bacteriol 178: 12741282.
  • Massey, T.H., Mercogliano, C.P., Yates, J., Sherratt, D.J., and Lowe, J. (2006) Double-stranded DNA translocation: structure and mechanism of hexameric FtsK. Mol Cell 23: 457469.
  • Paoletti, A.C., Parmely, T.J., Tomomori-Sato, C., Sato, S., Zhu, D., Conaway, R.C., et al. (2006) Quantitative proteomic analysis of distinct mammalian Mediator complexes using normalized spectral abundance factors. Proc Natl Acad Sci USA 103: 1892818933.
  • Pashley, C.A., and Parish, T. (2003) Efficient switching of mycobacteriophage L5-based integrating plasmids in Mycobacterium tuberculosis . FEMS Microbiol Lett 229: 211215.
  • Piersma, S.R., Broxterman, H.J., Kapci, M., de Haas, R.R., Hoekman, K., Verheul, H.M., and Jimenez, C.R. (2009) Proteomics of the TRAP-induced platelet releasate. J Proteomics 72: 91109.
  • Rappsilber, J., Ryder, U., Lamond, A.I., and Mann, M. (2002) Large-scale proteomic analysis of the human spliceosome. Genome Res 12: 12311245.
  • Rezwan, M., Laneelle, M.A., Sander, P., and Daffe, M. (2007) Breaking down the wall: fractionation of mycobacteria. J Microbiol Methods 68: 3239.
  • Sampson, S.L. (2011) Mycobacterial PE/PPE proteins at the host-pathogen interface. Clin Dev Immunol 2011: 497203.
  • Shevchenko, A., Wilm, M., Vorm, O., and Mann, M. (1996) Mass spectrometric sequencing of proteins silver-stained polyacrylamide gels. Anal Chem 68: 850858.
  • Simeone, R., Bottai, D., and Brosch, R. (2009) ESX/type VII secretion systems and their role in host-pathogen interaction. Curr Opin Microbiol 12: 410.
  • Siroy, A., Mailaender, C., Harder, D., Koerber, S., Wolschendorf, F., Danilchanka, O., et al. (2008) Rv1698 of Mycobacterium tuberculosis represents a new class of channel-forming outer membrane proteins. J Biol Chem 283: 1782717837.
  • Smith, D.B., and Johnson, K.S. (1988) Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase. Gene 67: 3140.
  • Stanley, S.A., Raghavan, S., Hwang, W.W., and Cox, J.S. (2003) Acute infection and macrophage subversion by Mycobacterium tuberculosis require a specialized secretion system. Proc Natl Acad Sci USA 100: 1300113006.
  • Stover, C.K., Cruz, V.F., Fuerst, T.R., Burlein, J.E., Benson, L.A., Bennett, L.T., et al. (1991) New use of BCG for recombinant vaccines. Nature 351: 456460.
  • Timm, J., Lim, E.M., and Gicquel, B. (1994) Escherichia coli-mycobacteria shuttle vectors for operon and gene fusions to lacZ: the pJEM series. J Bacteriol 176: 67496753.
  • Weerdenburg, E.M., Abdallah, A.M., Mitra, S., de Punder, K., van der Wel, N.N., Bird, S., et al. (2012) ESX-5-deficient Mycobacterium marinum is hypervirulent in adult zebrafish. Cell Microbiol 14: 728739.
  • Xu, J., Laine, O., Masciocchi, M., Manoranjan, J., Smith, J., Du, S.J., et al. (2007) A unique Mycobacterium ESX-1 protein co-secretes with CFP-10/ESAT-6 and is necessary for inhibiting phagosome maturation. Mol Microbiol 66: 787800.
  • Zuber, B., Chami, M., Houssin, C., Dubochet, J., Griffiths, G., and Daffe, M. (2008) Direct visualization of the outer membrane of mycobacteria and corynebacteria in their native state. J Bacteriol 190: 56725680.

Supporting Information

  1. Top of page
  2. Summary
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental procedures
  7. Acknowledgements
  8. References
  9. Supporting Information
FilenameFormatSizeDescription
mmi8206-sup-0001-si.pdf2796K

 

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.