SEARCH

SEARCH BY CITATION

Keywords:

  • enteric nervous system;
  • G-protein coupled receptors;
  • gastrointestinal motility;
  • myenteric plexus;
  • prokineticin

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References

Abstract  Prokineticins are novel peptides with reported effects on gastrointestinal contractility. Prokineticin actions are mediated by distinct prokineticin receptors (PKR1 and PKR2). This study investigated the role of prokineticin 1 in colonic contractility as well as sites of expression of its receptor in the mouse proximal colon by immunohistochemistry and confocal microscopy. Prokineticin 1 suppressed giant contractions in circular muscle. The inhibitory effect of prokineticin 1 on giant contractions was blocked by the nitric oxide synthase (NOS) inhibitor N(omega)-nitro-l-arginine methyl ester (l-NAME). In vitro, prokineticin 1 stimulated nitric oxide release from longitudinal muscle-myenteric plexus cultures. This effect was blocked by l-NAME. PKR1 is expressed on myenteric plexus neurons and colocalizes with a small subset of nNOS expressing neurons. This study suggests that PKR1 mediates an inhibitory effect in vitro, most likely through direct or indirect stimulation of nitric oxide release. PKR1 and its natural ligand, prokineticin 1 may be important for modulation of colonic motility.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References

Recently, two novel human peptides, prokineticin 1 and prokineticin 2 and their respective G-protein coupled receptors, prokineticin receptor 1 (PKR1) and prokineticin receptor 2 (PKR2), were cloned.1,2 Prokineticin 1 is widely expressed in the human gastrointestinal tract.1 Prokineticin 1 is the human homologue of a protein originally isolated from snake venom [mamba intestinal toxin1 (MIT1)] and frog skin secretions (Bv8; from Bombina variegata with a molecular mass ≈8 kDa).3,4 Human and mouse prokineticin are also named endocrine-gland vascular endothelial growth factor, based on angiogenic properties in human steroid glands.5

Prokineticins were named as such, for their ability to potently contract longitudinal guinea pig ileal smooth muscle strips.1 It has been suggested that recombinant prokineticins may provide novel therapeutic agents for gastrointestinal motility disorders.4 However, studies on the role of prokineticin 1 in gastrointestinal contractility are few and contradictory. Human recombinant prokineticin can potently contract isolated longitudinal guinea pig ileum, fundic muscle and proximal, but not distal colon.1 This contractile effect was blocked by calcium antagonists but not by tetrodotoxin (TTX) suggesting a direct effect of prokineticin on gastrointestinal smooth muscle. MIT1relaxes longitudinal proximal colon, whereas it contracts distal colon and ileal muscle in guinea pigs.3 MIT1 induced relaxation in proximal colon was inhibited by TTX, suggesting that MIT1 acts through inhibitory enteric neurons.

Human and mouse PKR1 are highly homologous G-protein coupled receptors. They belong to the neuropeptide Y receptor gene family with 36% and 33% overall amino acid identity, respectively. Despite homology to neuropeptide Y receptors, both receptors lack the ability to bind its ligands (neuropeptide Y, peptide YY or pancreatic polypeptide) or to activate signalling pathways in transfected cell lines.6 Thus far, prokineticins are the only identified natural ligands for the receptor.

Wood was the first to describe spontaneous propagating contractions of murine colonic circular muscle in vitro.7 These propagating contractions were originally referred to as colonic migrating myoelectric complexes (CMMC), and have been described in murine colon by other investigators.8–10 However, the term complexes refers to a group of contractions migrating together like those seen in the migrating motor complexes of the small intestine. The migrating phenomenon observed in the colon is different; it is a single large amplitude contraction that migrates distally. For this reason, in several recent publications, this phenomenon in the colon of rodent and non-rodent species has been called ‘Giant Migrating Contractions’.11–14 In an organ bath set-up only single high-amplitude contractions can be recorded and are thus referred to as giant contractions (GC).11–14 For the purpose of this study, GC are defined by a duration >150% and an amplitude >300% of phasic contractions as previously described in the rat colon.11 Contractility as used in this manuscript refers to an ability to contract.

The aims of this study were (1) to determine expression and distribution of PKR1 in mouse proximal colon; (2) to characterize cell types expressing PKR1 by using double-labelling immunofluorescent approaches with antibodies to neuronal nitric oxide synthase (marker for myenteric inhibitory motor neurons); (3) to determine the effect of prokineticin 1 on proximal colon contractility; and (4) to determine the effect of prokineticin 1 on nitric oxide release in vitro.

Material and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References

Animals

All mice were purchased from the Jackson Laboratory (Bar Harbor, ME, USA). Male mice were used from the following strains: C57BL/6J. The mice were 8–12 weeks of age at the onset of the experiment with body weights of 20–25 g. Experimental protocols involving animals were approved by the Institutional Animal Care and Use Committee (IACUC) in accordance with the guidelines provided by the National Institutes of Health.

Materials

Recombinant human EG-VEGF/PK1 was purchased from R&D Systems, Inc. (Minneapolis, MI, USA). The following antibodies were used for immunohistochemistry: prokineticin 1 from Phoenix Pharmaceuticals, Inc. (Belmont, CA, USA) dilution 1 : 500, PKR1 (GPR73A) from LifeSpan Biosciences (Seattle, WA, USA) dilution 1 : 1500, nNOS from Abcam (Cambridge, MA, USA) dilution 1 : 500, a mouse anti-human neuronal protein HuC/HuD (anti-HuC/D) labelled to biotin-XX from Molecular Probes (Eugene, OR, USA) dilution 1 : 100. Streptavidin-FITC from Southern Biotechnology Associates, Inc. (Birmingham, AL, USA) was used for the detection of the biotin-XX labelled anti-HuC/D antibody.

Reverse transcriptase-polymerase chain reaction

Reverse transcriptase-polymerase chain reaction (RT-PCR) was performed by the UTMB Recombinant DNA Laboratory. Total RNA was isolated from a full thickness section of the proximal colon of male mice, using the UltraspecTM RNA isolation system (Biotex Laboratories, Inc., Houston, TX, USA) and was treated with DNAse I. Two milligram of total RNA was reversed transcribed using Superscript II (Invitrogen, Sand Diego, CA, USA). PCR was performed using prokineticin 1 specific primers designed to amplify the 3 exons spanning coding region.5 The forward primer contained a HindIII site (prokineticin 1 forward primer GCGCAAGCTTATGAGAGGCGCTGTGCATATCTTC) and the reverse primer contained an XhoI site (prokineticin 1 reverse primer GCGCGCCTCGAGCAAAGTTGGCATTCTTCAAGTCCCG). PKR1 specific primers were designed to amplify the 2 exons spanning coding region.6 The forward primer contained a EcoRI site (PKR1 forward primer GAATTCATGGAGACCACTGTCGGGGCTC) and the reverse primer contained an XhoI site (CTCGAGCTACTTTAGTCTGATACAATCCACCTC3). PCR conditions for both prokineticin and PKR1 were as follows: initial denaturation at 95 °C for 2 min (one cycle), 94 °C for 30 s, 60 °C for 30 s, 72 °C for 2 min (30 cycles), 72 °C final extension for 10 min. The amplified prokineticin 1 cDNA was cleaved with the restriction enzymes HindIII and XhoI, cloned into the expression vector pSecTag2/hygromyc-epitope/his6 vector (Invitrogen) and its sequence verified. The amplified PKR1 cDNA was cleaved with the restriction enzymes EcoRI and XhoI, cloned into pCRII (TA Cloning system; Invitrogen) and its sequence verified.

Tissue processing and immunohistochemistry

Frozen sections  Mice were anaesthetized with ketamine (35 mg kg−1) and xylazine (10 mg kg−1) and transcardially perfused and fixed with ice-cold 4% paraformaldehyde (PFA) in 0.1 mol/L phosphate-buffered saline (PBS) pH 7.4. The proximal colon was removed approximately 1.5 cm from the cecum, postfixed in 4% PFA for 1 h at room temperature, and cryo protected by infiltration in 30% sucrose solution in PBS overnight at 4 °C. The tissue was placed in optimum cutting temperature (OCT) embedding medium (Tissue Tek, Sakura, Tokyo, Japan) and rapidly frozen over dry ice. Frozen sections (10 μm thick) were cut at −15 °C on a cryostat (TBS, Durham, NC, USA), placed on plus slides (VWR, West Chester, PA, USA) and stored at −80 °C until needed.

Longitudinal muscle-myenteric plexus preparations  Mice were anaesthetized with ketamine (35 mg kg−1) and xylazine (10 mg kg−1). The proximal colon was removed approximately 1.5 cm from the cecum. The colon section was placed into PBS. Under a dissecting microscope the mesentery was removed from the colon. Once the colon was cleaned of mesentery, the colon section was cut along the longitudinal plane and retained faecal material was removed. The section was fixed in acetone for 5 minutes and placed back into PBS in a Petri-dish. The tissue was pinned down with the mucosal site downward and the serosal site facing up. Under a dissecting microscope the muscle layer was gently separated from the underlying layers starting at the corner edges by slowly pulling one tiny section at a time with a forceps. After the muscle layer was separated, it was washed 3 × 10 minutes in PBS at room temperature.

Immunohistochemistry on frozen sections  Colonic tissue was re-hydrated in PBS for 20 minutes at room temperature, blocked with 5% normal serum for 1 hour at room temperature, washed in PBS, and incubated with primary antibodies diluted in PBS containing 1.5% normal serum overnight at 4 °C. Slides were rinsed in PBS at room temperature and incubated with the appropriate Alexa-conjugated secondary antibodies (Molecular Probes, Leiden, The Netherlands), dilution 1:200 for 1 hour at room temperature. Slides were washed in PBS, rinsed in dH2O and mounted with FluorSave (Calbiochem, La Jolla, CA). Controls for specificity of immunolabelling included omission of the primary antibody from the immunostaining procedure.

Immunohistochemistry on longitudinal muscle-myenteric plexus preparations  Colonic tissue was blocked with 5% normal serum and 0.3% Triton-X for 1 h at room temperature, washed in PBS, and incubated with primary antibodies diluted in PBS containing 1.5% normal serum at 4 °C for 48 h. Longitudinal muscle-myenteric plexus (LM-MP) preparations were washed in PBS overnight at 4 °C and incubated with the appropriate Alexa-conjugated secondary antibodies (Molecular Probes, Leiden, The Netherlands), dilution 1 : 200 for 1 h at room temperature. The biotin-XX anti-HuC/D antibody was detected by using fluorescently labelled streptavidin-FITC (1 : 500). Sections were washed in PBS, rinsed in dH2O and mounted with FluorSave (Calbiochem, La Jolla, CA, USA). Controls for specificity of immunolabelling included omission of the primary antibody from the immunostaining procedure. Three to five mice were used for cell counting. For each mouse, ganglia were randomly selected and the number of myenteric neurons expressing PKR1, HuC/D or nNOS were counted.

Image analysis

Images were captured using an Olympus BX60 microscope (Olympus, Melville, NY, USA) equipped with fluorescence and digital imaging with a cooled CCD camera (Photometrics CoolSNAP, Roper Scientific) and Metaview software (Universal Imaging Corp., West Chester, PA, USA).

Longitudinal muscle-myenteric plexus preparations co-localization analysis

For each mouse, five ganglia were randomly selected at magnification 20× and the number of myenteric neurons expressing prokineticin 1-immunoreactivity (PKR1-IR), HuC/D immunoreactivity (HuC/D-IR) or nNOS immunoreactivity (nNOS-IR) was counted. The average percentage of HuC/D-IR neurons containing PKR1, the average percentage of PKR1-IR neurons containing nNOS and the average number of nNOS-IR neurons containing PKR1 were calculated.

Western blotting

Proximal colon tissue was homogenized in buffer consisting of 2% sodium dodecyl sulphate (SDS), 100 μmol L−1 protease cocktail inhibitor, 1 mmol L−1 phenylmethylsulphonyl fluoride, 1 mmol L−1 EDTA in 50 mmol L−1 Tris-buffered saline [TBS, 50 mmol L−1 Tris-HCl (pH 7.5), 150 mmol L−1 NaCl]. The samples were centrifuged at 14 000 g for 15 min and the supernatants transferred to new tubes. Protein concentrations were determined by bicinchoninic acid (BCA) protein assay (Pierce, Rockford, IL, USA) using Δ-globulinas a standard. The samples (40 μg each) were diluted in 4X SDS loading buffer [3 g Tris; 8 g SDS; 2.5 g dithiothreitol (DTT); 0.05 g Bromophenol blue; 40% (by volume) glycerol per 100 ml buffer], boiled for 5 min and loaded onto a 7.5% Tris-HCl gel. After electrophoresis, the proteins were electro-transferred onto nitrocellulose membrane and incubated for 1 h in 5% milk in TBS with 0.1% Tween 20. The blots were incubated with prokineticin 1 antibody (1 : 500 dilution) overnight at 4 °C followed by HRP-conjugated anti-rabbit immunoglobulin (Ig) (1 : 5000 dilution, Amersham Biosciences, Buckinghamshire, UK) for 1 h. Immunoreactive bands were detected by a chemiluminescent Western blot detection kit (Amersham) according to the manufacturer's instruction and exposed to Biomax film.

Organ bath studies

Organ bath studies were performed following a modified protocol by Gonzalez and Sarna.7 Mice were sedated with halothane and anaesthetized with ketamine 60 mg kg−1 i.p. The proximal colon was removed and placed in Krebs. Colonic rings, 3 mm wide, were cut and mounted in a 5-mL bath filled with oxygenated Krebs solution [130 mmol L−1 NaCl, 5 mmol L−1 KCl, 2.5 mmol L−1 CaCl2, 10 mmol L−1 glucose, 13 mmol L−1 sucrose, 20 mmol L−1N-2-hydroxyethylpiperazine-N′-2-ethane sulphonic acid (HEPES), pH 7.3] at 37 °C and equilibrated for 60 min. The bath solution was changed every 15 min until GC frequency and amplitude stabilized. The GC were defined as contractions of duration >150% and amplitude >300% of that of phasic contractions as previously described.10 Rings were stretched to 1 g tension. Increasing doses of PKC1 were tested (100 nmol L−1–100 μmol L−1) to obtain complete concentration–effect curves. Ten minute washes with Krebs solution were applied in between administration of peptide. In experiments with combined addition of antagonists and agonists, atropine 1 μmol L−1, the nitric oxide synthase inhibitor (NOS) N(omega)-nitro-l-arginine methyl ester (l-NAME) 100 μmol L−1, guanethidine 3 μmol L−1 and TTX 1 μmol L−1 were added to the bath 30 min prior to the addition of prokineticin 1. The dry weight of each muscle ring was measured after completion of the experiment.

Nitric oxide release assay

Longitudinal muscle-myenteric plexus preparations from the murine proximal colon were cultured at 37 °C in 5% CO2 for 2 h in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% foetal bovine serum and penicillin/streptomycin. LM-MPs were washed in Krebs solution two times for 5 min each. LM-MPs were incubated with Krebs for 5 min at 37 °C for basal release. LM-MPs were then incubated with either Krebs or Krebs containing prokineticin (1, 10 or 100 μmol L−1). In some experiments, l-NAME was added to the LM-MPs in Krebs for 10 min prior to the addition of prokineticin. At the end of the incubation periods, supernatants were collected and used for nitric oxide (NO) quantification. The LM-MPs were collected and their individual tissue weight was measured. NO levels were determined using a colorimetric kit (Calbiochem, San Diego, CA, USA) according to manufacturer's instructions. The assay kit is based on a modified Griess method that quantifies the combined levels of nitrite and nitrate as an indicator of NOS activity. Absorbance of samples were determined at 540 nm in an automated microplate reader and compared with a standard curve. NOS activity was expressed as μmol of NO generated per 10 mg tissue weight. Veratridine 100 μmol L−1 (Sigma, St Louis, MO, USA) was used as a positive control for NO release. LM-MP strips were excluded from analysis if NO release was not observed in response to veratridine.

Statistical analysis

Organ bath study analysis  The contractions were recorded and analysed by a digital data acquisition system. Contractile activity was analysed from computer traces using Acq knowledge software (BIOPAC Systems, Inc., Santa Barbara, CA, USA). Frequency of GC was determined by the number of contractions over 5 min at baseline and 5 min following administration of the agonist. Amplitude was measured as the difference between precomplex and maximum peak height.

Results were expressed as the mean ± SE of the mean SEM of responses of individual muscle rings. The n-value represents the number of animals. Statistical analysis was performed using Student's t-test. Significance level was set at P < 0.05.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References

Prokineticin 1 and the prokineticin receptor 1 are expressed in mouse proximal colon

The entire coding region of prokineticin 1 and its receptor were amplified from adult mouse proximal colon by RT-PCR from total RNA and the sequences were confirmed. Prokineticin 1 protein expression was confirmed by Western blot analysis (Fig. 1A). No band was identified with a secondary antibody alone control (data not shown). PKR1-immunoreactivity (PKR1-IR) was detected in the myenteric plexus (Fig. 1B). Thus, prokineticin 1 and PKR1 are both expressed in adult mouse proximal colon. Furthermore, PKR1 is expressed in the myenteric plexus.

image

Figure 1.  (A) Western blot of murine proximal colon protein probed with an antibody specific for prokineticin 1 (arrow points toward 10.5 kDa band corresponding to prokineticin 1). (B) prokineticin receptor 1-immunoreactivity (PKR1-IR) was detected in the neurons from the myenteric plexus (arrows) in cross-sections of the mouse proximal colon. CM, circular muscle; LM, longitudinal muscle; magnification = 40×.

Download figure to PowerPoint

Effects of prokineticin 1 on spontaneous giant contractions in the mouse proximal colon

Prokineticin 1 decreased the frequency and amplitude of spontaneous GC in the mouse colon (Fig. 2). GC occurred at a frequency of 2.22 × 0.48/5 min with a mean amplitude of 5.1 × 1 mN at baseline. Prokineticin 100 nmol L−1 did not alter the frequency, but prokineticin 1, 10and 100 μmol L−1, significantly decreased the frequency to 0.89 × 0.20, 0.56 × 0.30 and 0.22 × 0.15 GC/5 min, respectively (n = 8, P < 0.05). This effect on frequency occurred in association with a decrease in amplitude. Prokineticin 1, 10 and 100 μmol L−1, significantly decreased the amplitude to 3.25 × 0.85, 2.20 × 0.80 and 1.43 × 0.40 mN, respectively (n = 8, P < 0.05). The dose response curve yielded an IC50 of prokineticin of 53.7 μmol L−1.

image

Figure 2.  (A) Organ bath tracings showing the effect of prokineticin 1 (prokin1) 1, 10 and 100 μmol L−1 on murine proximal colon on GC. Ten minute washes were administered in between the administration of the peptide to allow for GC to return to baseline activity. (B) Quantitative analysis of GC frequency (n = 8 mice) following increasing concentrations of prokin 1 (*P < 0.05 by Student's t-test for comparison with baseline frequency). (C) Quantitative analysis of amplitude (n = 8 mice) following increasing concentrations of prokin 1 (*P < 0.05 by Student's t-test for comparison with baseline amplitude).

Download figure to PowerPoint

Under non-cholinergic–non-adrenergic conditions, prokineticin 100 μmol L−1 significantly decreased the amplitude of the contractions from 3.54 × 1.13 to 1.04 × 0.27 mN (n = 5; P < 0.05) (Fig. 3A).

image

Figure 3.  Organ bath tracings demonstrating the effect of prokineticin 1 (prokin 1) 100 μmol L−1 on murine proximal colon rings. (A) in the presence of l-NAME 100 μmol L−1/guanethidine 3 μmol L−1. (B) in the presence of atropine 1 μmol L−1/guanethidine 3 μmol L−1. (C) in the presence of tetrodotoxin 1 μmol L−1.

Download figure to PowerPoint

In order to determine whether NO release may play a role in the inhibition of contractions in the mouse proximal colon, the effects of prokineticin on GC was determined in the presence of the NOS inhibitor l-NAME (Fig. 3B). l-NAME increased the GC frequency to 16.0 × 2.8/5 min. Prokineticin 100 μmol L−1 did not significantly alter the frequency (16.1 × 3.1 GC/5 min vs 13.4 × 2.5 GC/5 min; n = 6; P = NS) or amplitude (2.57 × 0.79 mN vs 2.24 × 0.48 mN; n = 6; P = NS) of GC in the presence of l-NAME.

Finally, to determine whether the effect of prokineticin was neuronally mediated, the effects of prokineticin were determined in the presence of the neuronal blocker TTX (Fig. 3C). TTX increased the GC frequency to 14.0 × 4.24/5 min. Prokineticin 1 did not alter the frequency or amplitude of contraction in the presence of TTX. Taken together, the data suggest that the effect of prokineticin 1 may involve NO release.

The prokineticin receptor 1 is co-expressed with HuC/D and nNOS in myenteric neurons

To further characterize PKR1 expression in the mouse myenteric plexus, double–labelling immunohistochemistry was performed with HuC/D, a neuronal marker, as well as nNOS, the enzyme responsible for synthesis of the main inhibitory neurotransmitter NO (Fig. 4). PKR1-IR was detected in myenteric neurons. Double labelling immunohistochemistry showed PKR1 is expressed by neurons and that a subpopulation of PKR1-IR neurons express nNOS.

image

Figure 4.  Double-label immunofluorescence of longitudinal muscle-myenteric plexus preparations (LM-MPs) in the mouse proximal colon showing colocalization of prokineticin receptor 1 (PKR1) with (A) HuC/D and (B) nNOS.

Download figure to PowerPoint

Quantification analysis showed that 23.8 × 1.85 % of all HuC/D -IR neurons express PKR1 (504 neurons, three mice). Of PKR1-IR neurons, 7.7 × 1.02 % express nNOS-IR (233 neurons, three mice). Conversely, 5.6 × 1.98% of nNOS-IR neurons expressed PKR1-IR (318 neurons, three mice). Thus, mouse myenteric plexus neurons express PKR1, which co-localizes with a small subgroup of nNOS-IR neurons.

Prokineticin 1 can stimulate nitric oxide release from longitudinal muscle-myenteric plexus preparations

To determine whether the inhibitory effect of prokineticin 1 on GC is mediated through NO release, the effect of prokineticin 1 on NO release from cultured LM-MPs was examined. LM-MPs treated with prokineticin 1 secreted significantly higher concentrations of NO than controls. Concentrations of NO produced by increasing doses of prokineticin (1, 10 and 100 μmol L−1) were 0.59 × 0.22 μmol per 10 mg tissue weight, 1.19 × 0.28 μmol per 10 mg tissue weight, and 1.55 × 0.39 μmol per 10 mg tissue weight, respectively (Fig. 5) with a calculated EC50 of 20.0 μmol L−1. l-NAME 100 μmol L−1 blocked prokineticin evoked NO release. Thus, prokineticin can stimulate NOS-mediated NO release from cultured LM-MPs in vitro.

image

Figure 5.  Effect of prokineticin 1 (prokin 1) 1, 10 and 100 μmol L−1 on NO release from cultured longitudinal muscle-myenteric plexus preparations (LM-MP). Prokineticin 1 enhanced NO release in a dose-dependent manner. This effect was blocked by l-NAME (*P < 0.05 by Student's t-test for comparison with basal NO release).

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References

This study demonstrates for the first time that (1) prokineticin 1 and its receptor, PKR1, are expressed in the murine proximal colon; (2) PKR1 is localized to neuronal structures of the murine proximal colon; (3) PKR1-IR co-localizes with a subset of nNOS positive neurons; (4) prokineticin 1 inhibits spontaneous GC in the mouse proximal colon and that this effect is NO-mediated.

This is the first study to describe the presence of spontaneous single GC in the mouse colon in an organ bath set-up. The shape of the spontaneous GC is similar to the spontaneous GC described in the rat colon using a similar organ bath set-up.11,12 The frequency of the mouse proximal colon GC is approximately 27 h−1, whereas in the rat colon they have been described at a frequency of approximately 40 h−1.12 The organ bath set-up measures single contractions only and does not allow for evaluation of the migration of GC. The frequency of spontaneous GC was enhanced by l-NAME and TTX. This is consistent with previous observations in the rat colon, in which it was demonstrated that GC are tonically inhibited by non-adrenergic, non-cholinergic inhibitory neurons.12

The proximal colon is functionally and anatomically different from the distal colon. The myenteric plexus of the proximal colon has more NOS-containing cells and has greater NOS activity compared with the distal colon, resulting in greater non-adrenergic, non-cholinergic NO-mediated relaxation in the proximal colon.12 In our preliminary studies, prokineticin 1 had a clear inhibiting effect on spontaneous GC in the proximal colon but not in the distal colon. Thus, further pharmacological and immunohistochemical studies focused on the proximal colon. The data from this study are therefore not representative for the colon as a whole.

Each peptide has its own affinity for its receptor and inhibitory and excitatory concentrations for different peptides can range from the nanomolar to millimolar range. We first recognized an inhibitory effect of prokineticin at a concentration of 1 μmol L−1. The calculated IC50 for the effect of prokineticin on the inhibition of GC was 50 μmol L−1.

The current data are in line with a study published by Schweitz et al.3 who demonstrated that the snake homologue of prokineticin relaxed longitudinal proximal colon in a neuronally mediated manner. However, our results differ from a study by Li et al.1 in which human recombinant prokineticin contracted longitudinal guinea pig proximal, but not distal colon. This discrepancy can be explained by several differences. Firstly, the present study was completed in mice as opposed to guinea pigs. Secondly, the present study studied the effect of prokineticin 1 on full thickness circular muscle rings as opposed to longitudinal muscle strips. Full thickness rings allow for a more physiological assessment of the colonic tissue, as all layers remain intact. Furthermore, rings more frequently exhibit GC than muscle strips.11

This study suggests a role for PKR1-mediated nitric oxide release from the myenteric plexus in the inhibition of GCs in the mouse proximal colon for the following reasons. Firstly, PKR1 receptors are expressed on a subset of NOS expressing neurons. Secondly, treatment with l-NAME blocked the inhibitory effect of prokineticin 1 on spontaneous GC activity of circular muscle in whole proximal colon rings. Thirdly, in vitro data showed prokineticin 1 induced nitric oxide release. Because both prokineticin 1 and its receptor PKR1 are expressed within the gastrointestinal tract, it is conceivable that autocrine mechanisms of action are important in the activation of the PKR1 receptor and subsequent nitric oxide release. Further investigations to clarify whether prokineticin co-localizes with its receptor are needed to explore this hypothesis.

Although the immunohistochemical data indicate that a subset of PKR1 is expressed on inhibitory motor neurons, the vast majority of nNOS-IR neurons in the proximal colon do not express immunohistochemically identifiable PKR1 receptors and many neurons expressing PKR1 receptors do not express nNOS. The significant suppression of GCs as well as the significant release of nitric oxide in response to prokineticin, suggests that prokineticin, in addition to stimulating NOS inhibitory motor neurons, might activate pools of inhibitory musculomotor neurons that use other inhibitory neurotransmitters (e.g. vasoactive intestinal peptide and adenosine triphosphate).15,16 Further studies are needed to fully characterize the nature of PKR1 expressing neurons.

In summary, this study demonstrates for the first time that PKR1 is expressed by the myenteric plexus of the mouse proximal colon. PKR1 modulates inhibitory neurotransmitter release through activation of NOS. Because prokineticin 1 is expressed within the gastrointestinal tract, it is possible that autocrine mechanisms of action are important, although further investigations to clarify whether the peptide co-localizes with its receptor are needed. PKR1 and its ligand may be important in the modulation of colonic motility.

Acknowledgments

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References

The author thanks Joshua Scott for technical assistance with the experiments. The author thanks Thomas G. Wood, PhD, Director of the UTMB Molecular Genomics Core, for the cloning of prokineticin 1 and the PKR1. The author thanks Maria-Adelaide Micci, PhD, and Sushil K. Sarna, PhD, for critical review of the manuscript. The study was funded by NIH grant DK56338, which supports the Texas Gulf Coast Digestive Diseases Center.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Material and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References
  • 1
    Li M, Bullock CM, Knauer DJ, Ehlert FJ, Zhou QY. Identification of two prokineticin cDNAs: recombinant proteins potently contract gastrointestinal smooth muscle. Mol Pharmacol 2001; 59: 6928.
  • 2
    Lin DC, Bullock CM, Ehlert FJ, Chen JL, Tian H, Zhou QY. Identification and molecular characterization of two closely related G protein-coupled receptors activated by prokineticins/endocrine gland vascular endothelial growth factor. J Biol Chem 2002; 277: 1927680.
  • 3
    Schweitz H, Pacaud P, Diochot S, Moinier D, Lazdunski M. MIT(1), a black mamba toxin with a new and highly potent activity on intestinal contraction. FEBS Lett 1999; 461: 1838.
  • 4
    Mollay C, Wechselberger C, Mignogna G et al. Bv8, a small protein from frog skin and its homologue from snake venom induce hyperalgesia in rats. Eur J Pharmacol 1999; 374: 18996.
  • 5
    LeCouter J, Lin R, Frantz G, Zhang Z, Hillan K, Ferrara N. Mouse endocrine gland-derived vascular endothelial growth factor: a distinct expression pattern from its human ortholog suggests different roles as a regulator of organ-specific angiogenesis. Endocrinology 2003; 144: 260616.
  • 6
    Parker R, Liu M, Eyre HJ et al. Y-receptor-like genes GPR72 and GPR73: molecular cloning, genomic organisation and assignment to human chromosome 11q21.1 and 2p14 and mouse chromosome 9 and 6. Biochim Biophys Acta 2000; 1491: 36975.
  • 7
    Wood JD. Electrical activity of the intestine of mice with hereditary megacolon and absence of enteric ganglion cells. Am J Dig Dis 1973; 18: 47788.
  • 8
    Bywater RA, Small RC, Taylor GS. Neurogenic slow depolarizations and rapid oscillations in the membrane potential of circular muscle of mouse colon. J Physiol 1989; 413: 50519.
  • 9
    Spencer NJ, Hennig GW, Dickson E, Smith TK. Synchronization of enteric neuronal firing during the murine colonic MMC. J Physiol 2005; 564(Pt 3): 82947.
  • 10
    Powell AK, O‘Brien SD, Fida R, Bywater RA. Neural integrity is essential for the propagation of colonic migrating motor complexes in the mouse. Neurogastroenterol Motil 2002; 14: 495504.
  • 11
    Gonzalez A, Sarna SK. Different types of contractions in rat colon and their modulation by oxidative stress. Am J Physiol Gastrointest Liver Physiol 2001; 280: G54654.
  • 12
    Gonzales A, Sarna SK. Neural regulation of in vitro giant contractions. Am J Physiol Gastrointest Liver Physiol 2001; 281: G27582.
  • 13
    Karaus M, Sarna SK. Giant migrating contractions during defecation in the dog colon. Gastroenterology 1987; 92: 92533.
  • 14
    Li M, Johnson CP, Adams MB, Sarna SK. Cholinergic and nitrergic regulation of in vivo giant migrating contractions in rat colon. Am J Physiol Gastrointest Liver Physiol 2002; 283: G54452.
  • 15
    Hansen MB. The enteric nervous system I: organisation and classification. Pharmacol Toxicol 2003; 92: 10513.
  • 16
    Bornstein JC, Costa M, Grider JR. Enteric motor and interneuronal circuits controlling motility. Neurogastroenterol Motil 2004; 16(Suppl. 1): 348.