SEARCH

SEARCH BY CITATION

Keywords:

  • colon;
  • nociception;
  • protease-activated receptor;
  • visceral hyperalgesia

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References

Abstract  The antinociceptive mechanism underlying protease-activated receptor-4 (PAR4) activation was studied in Fast Blue-labelled dorsal root ganglia (DRG) neurons from mouse colon which expressed transcript for PAR4. Whole cell perforated patch clamp recordings were obtained from these neurons and the effects on neuronal excitability of PAR4 activating peptides (AP) and reverse peptides (RP) were examined. A 3-min application of PAR4-AP (100 μmol L−1) markedly suppressed the number of action potential discharged at twice rheobase for up to 60 min. PAR4-RP had no effect. PAR4 application suppresses the excitatory effects of PAR2. These findings demonstrated that activation of PAR4 on colonic DRG neurons suppresses their excitability, suggesting these receptors could provide important targets for modifying pain in colonic GI disorders such as IBS and IBD.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References

Protease-activated receptors (PARs) play an important role in the modulation of visceral pain.1,2 Four members of the PAR family have been cloned and these G-protein coupled receptors3 are widely expressed in numerous tissues including the gastrointestinal tract. These receptors are activated by specific cleavage of the amino-terminal sequence by proteases which unmask a tethered ligand which in turn activates the receptor. PAR2 activation has been implicated in the genesis of hyperalgesia in a number of models of colitis. Recent studies have also suggested that other PARs, such as PAR4, may mediate an antinociceptive action2,4 presenting novel targets for treating pain.

PAR4 has been identified on a number of cell types including nociceptive dorsal root ganglia (DRG) neurons.4,5 Recent studies have shown that PAR4 activation significantly increased the nociceptive threshold in response to noxious stimuli and that selective activation of this receptor significantly reduced the carrageenan-induced inflammatory hyperalgesia and allodynia.4 It was unclear from these studies however, whether this action resulted from the activation of PAR4 directly on somatic DRG neurons and if so, how this affected the excitability of the neurons.

Synthetic activating peptides (APs) can mimic the tethered ligand of a number of PARs, including PAR4. In this study, we used RT-PCR combined with retrograde Fast Blue labelling to establish whether PAR4 was expressed on mouse colonic DRG neurons, and selective PAR4-APs to determine whether their activation alters intrinsic neuronal excitability.

Methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References

Drugs and reagents

Mouse PAR4-activating peptide [PAR4-AP, (AYPGKF-NH2)] and reverse peptide sequence, PAR4-reverse peptide, [PAR4-RP, (FKGPYA-NH2), control] were a gift from Dr. Vergnolle (University of Calgary). All other chemicals were obtained from Sigma (St Louis, MO, USA) unless otherwise noted.

Animals

Studies were conducted on CD-1 mice (Charles River Laboratories, Montreal, QC, Canada) of either sex (n = 25 animals), weighing 30–40 g and were approved by the Queen’s University Animal Care Committee.

To perform Fast Blue injections, a midline laparotomy was performed on anaesthetized mice and circumferential injections were performed, as previously described.6 Seven to ten days following Fast Blue injections, animals were sacrificed using sodium pentobarbital (200 mg kg−1 i.p.) and DRG (T9–L1) were obtained for subsequent experiments.

RT-PCR localization of PAR4

Fast Blue-labelled colonic DRG neurons were laser captured, as previously described.7 cDNA was prepared from RNA isolated from laser captured neurons and RT-PCR was performed using the protocol outlined by Asfaha et al.4 GAPDH oligonucleotides used were: (5′ primer GAPDH) CGGAGTCAACGGATTTGGTCGTAT; (3′ primer GAPDH) AGCCTTCTCCATGGTGGTGAAGAC, as in Asfaha et al.4 PAR4 primers were designed in-house using Invitrogen OligoPerfectTM Designer (Invitrogen, Carlsbad, CA, USA) and their specificity confirmed using Accelrys Gene; (5′ primer PAR4) ATGGTTCAGTGTTGCTGCTG; (3′ primer PAR4) AGGGCTCGGGTTTGAATAGT; gene access # was AF080215.

Electrophysiology

Neurons were acutely dissociated and perforated-patch-clamp experiments performed in current clamp at room temperature, as previously described.6,8 Signals were amplified using an Axopatch 200B amplifier and digitized with a Digidata 1322A A/D converter from Axon Instruments (San Jose, CA, USA). Signals were acquired at 20 kHz and stored on disk using Clampex 8.2 (Axon Instruments). Agonists were applied using a multi-barrel fast-flow solution-switching system (VC6; Warner Instruments, Hamden, CT, USA).

Solutions were (mmol L−1): (pipette) 140 KCl, 10 HEPES, 5 EGTA, 4 Na2-ATP, 5 MgCl2, 2.5 CaCl2 with pH adjusted to 7.2 using KOH; (bath), 140 NaCl, 5 KCl, 1 MgCl2, 2 CaCl2, 10 HEPES and 10 d-glucose, with pH adjusted to 7.4 using NaOH.

In current clamp, cells displayed overshooting action potentials (peak ≥+50 mV) for the duration of the experiment. After a stable membrane potential was recorded for 5 min, membrane potential, rheobase, twice rheobase and input resistance were recorded (t = 0). Cells were then superfused with PAR4-AP or PAR4-RP (both 100 μmol L−1) for 3 min and the parameters were again measured 5, 10, 15, 20 and 25 min after application of the peptide. PAR2-AP (100 μmol L−1) was applied for 2 min with PAR4-AP following an initial application of PAR4-AP (2 min), in a separate series of experiments. Values obtained at various time points were expressed as a difference (absolute or percentage from the resting membrane potential at t = 0 min). Data are expressed as means ± SEM. A two-way analysis of variance (anova) with a Bonferroni post hoc test for significance was carried out to compare the results at every time point and data values were deemed statistically significant if P < 0.05. Fitting of data was done with the least squares method using the fit function in Prism 4.0 (graphpad software; GraphPad, La Jolla, CA, USA).

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References

PAR4 is expressed on colonic neurons

A PCR product of 465 bp was amplified from Fast Blue-labelled laser captured dorsal root ganglia neurons, demonstrating the presence of PAR4 mRNA in colonic DRG neurons (Fig. 1A).

image

Figure 1.  PAR4 activation of colonic dorsal root ganglia (DRG) neurons inhibits excitability. (A) PCR on laser captured microdissection (LCM) of Fast Blue-labelled DRG neurons shows PAR4 transcript in colonic neurons. (B) Representative traces showing typical rheobase and two times rheobase responses at 10 min following the onset of a 3-min application of PAR4 reverse peptide (PAR4-RP; 100 μmol L−1) (upper tracings) and 10 min following the onset of a 3-min application of PAR4 activating peptide (PAR4-AP; 100 μmol L−1). (C) Summary of effects of PAR4-AP on numbers of action potentials at twice rheobase compared with those with PAR4-RP showing a time dependent significant inhibition of excitability (anova, P < 0.05). (D) Summary of effects of PAR4-AP on rheobase compared with those obtained with PAR4-RP. anova did not reveal a significant difference. When the 10-min time point alone was compared to baseline, given the time dependent effects also observed when the two times rheobase was studied (i.e. see C.), a paired t-test shows a significant difference (P < 0.05). (E and F) PAR4-AP significantly reduces the effect of PAR2-AP on action potential count at twice rheobase (n = 5; P = 0.046) and rheobase (= 5; P = 0.038). The solid bars represent the PAR2-AP (100 μmol L−1) application for 2 min to both groups of cells, the clear bars represent the PAR4-AP (100 μmol L−1) application for 4 min to the PAR4-AP group of cells (clear circles).

Download figure to PowerPoint

Activation of PAR4 on nociceptive DRG neurons decreases excitability

Current clamp recordings were obtained from 30 Fast Blue-labelled DRG neurons. Only small neurons were chosen for the study (cell diameter <25 μm and a capacitance <40 pF), some of which have previously been shown to have the properties exhibited by nociceptors.8

The application of PAR4-AP significantly decreased the number of action potentials fired at two times rheobase 10-min postapplication (64% of initial number) (Fig. 1B,C). The number of action potentials fired at twice rheobase significantly decreased from an average of 4.64 ± 0.76 prior to the application of PAR4-AP to 2.76 ± 0.54 ten minutes after a 3-min application of PAR4-AP (n = 13; P < 0.05). This decrease in excitability remained up to 25 min post PAR4-AP application (n = 8). In two of these cells, stable recordings were maintained for 60 min and these findings persisted. In contrast, the application of the PAR4-RP did not significantly alter the number of action potentials fired at twice rheobase (n = 7).

The rheobase was not significantly altered by the presence of PAR4-AP when an anova was performed. Given the significant decrease in the number of action potentials at t=10 we performed a paired t-test analysis which showed a significant increase in the rheobase at this time point (106 ± 26 pA) when compared to t = 0 (71 ± 16 pA; 50% average increase; n = 13; < 0.05). This difference was not seen in the control cells (P > 0.3; n = 7).

The application of PAR4-AP did not significantly alter the resting membrane potential or input resistance of the cells (data not shown).

Activation of PAR4 attenuates the effects of PAR2 on nociceptive neurons

PAR2 activating peptide (SLIGRL-NH2) is known to increase the excitability of nociceptive DRG neurons.8. PAR4-AP opposed the effects of PAR2-AP in current clamp recordings (both 100 μmol L−1) (Fig. 1E,F). Following a 2-min application, the increase in action potential count at twice rheobase produced by PAR2-AP was reduced by PAR4-AP from 158.2 ± 91% to 113.3 ± 50.6% (n = 5 for both, P = 0.046). Similarly, PAR2-AP reduced rheobase by 54.2 ± 15.0%, vs only a 25.11 ± 27.2% reduction when PAR4-AP was co-applied (n = 5 for both, P = 0.038).

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References

This study examined whether the recently reported antinociceptive actions of PAR4 seen in whole animal studies of colitis4 could result, at least in part, from changes in the intrinsic excitability of DRG neurons. Our RT-PCR studies of Fast Blue-labelled neurons demonstrated for the first time that colonic neurons express transcript for PAR4. Activation of these receptors inhibits the excitability of these neurons. Moreover, given that multiple PARs could be simultaneously activated, we studied the effects of combined PAR4 and PAR2 activation and found PAR4 suppresses the pro-nociceptive actions of PAR2. Together, these studies suggest that activation of the PAR4 receptors on colonic nociceptive DRG neurons suppresses their excitability and as a result could be an important target for treating pain originating from the colon.

The major finding in the electrophysiological studies was that PAR4 activation resulted in a marked reduction (∼50%) in action potential discharge. This action was specific to PAR4 activation, because the RP had no effect on any of the measured electrophysiological properties of the neurons. The ionic mechanism which underlies this inhibition requires further study but inferences can be drawn from recordings of the passive membrane properties of the neurons. The PAR4-AP had no effect on resting membrane potential or input resistance, suggesting that the affected channels were not open at or near the resting potential. Thus the kinetic properties of voltage gated channels, such as IA K+ currents or Nav 1.8 sodium currents which are known to influence discharge firing rates, are likely modified by PAR4 activation.

The change in rheobase observed at t = 10 corresponded with the significant decrease in the number of action potentials fired at 2 times rheobase at the same time point. This is consistent with a second messenger mediated cascade being responsible for the decrease in neuronal excitability observed in presence of PAR4. The intracellular signalling events mediated by PAR4 are poorly understood for most cells and have not been studied in neurons. Detailed studies are needed to establish the pathways mediating the PAR4 effects on intrinsic neuronal excitability and its ability to inhibit the excitatory actions following PAR2 activation.

Other studies also addressed the question as to whether PAR4 antinociceptive actions observed in whole animal studies resulted from direct effects on DRG neurons or were secondary to activation of adjacent immune cells. Whole animal studies demonstrate that intra-colonic administration of PAR4-AP could inhibit PAR2 and TRPV4 agonist induced hyperalgesia. These studies also used Ca2+ imaging techniques to suggest that stimulation of PAR4 suppresses TRPV1, TRPV4 and PAR2 induced currents.4,9. While this approach does not measure ionic currents in neurons using more direct electrophysiological techniques, the finding implied PAR4 activation could directly affect neurons. The current study provides direct support for this concept and unequivocal evidence that suppression of intrinsic excitability can contribute to the observed antinociceptive PAR4 actions.

In summary, we have shown that activation of PAR4 antinociceptive actions result, at least in part, from suppression of the intrinsic excitability of DRG neurons. Moreover, we have demonstrated that actions occur in colonic DRG neurons. Thus, the findings provide evidence to support the study of these receptors as novel targets for pain reduction in GI disorders such as IBS and IBD.

Acknowledgments

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References

SV was supported by an operating grant from the Canadian Institutes of Health Research, and a Research Scientist award from the Crohn’s & Colitis Foundation of Canada. RK was supported by the GIDRU Canadian Institutes of Health Research training grant in Digestive Sciences. The authors thank Iva Kosatka and Margaret O’Reilly for expert technical assistance.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. References