SEARCH

SEARCH BY CITATION

Keywords:

  • acetic acid;
  • gastrointestinal (GI) microbiota;
  • irritable bowel syndrome (IBS);
  • Lactobacillus;
  • propionic acid;
  • Veillonella

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. Competing interests
  9. Grant support
  10. Financial disclosure
  11. Writing assistance
  12. References

Background  The profile of intestinal organic acids in irritable bowel syndrome (IBS) and its correlation with gastrointestinal (GI) symptoms are not clear. We hypothesized in this study that altered GI microbiota contribute to IBS symptoms through increased levels of organic acids.

Methods  Subjects were 26 IBS patients and 26 age- and sex-matched controls. Fecal samples were collected for microbiota analysis using quantitative real-time polymerase chain reaction and culture methods, and the determination of organic acid levels using high-performance liquid chromatography. Abdominal gas was quantified by image analyses of abdominal X-ray films. Subjects completed a questionnaire for GI symptoms, quality of life (QOL) and negative emotion.

Key Results  Irritable bowel syndrome patients showed significantly higher counts of Veillonella (P = 0.046) and Lactobacillus (P = 0.031) than controls. They also expressed significantly higher levels of acetic acid (P = 0.049), propionic acid (P = 0.025) and total organic acids (P = 0.014) than controls. The quantity of bowel gas was not significantly different between controls and IBS patients. Finally, IBS patients with high acetic acid or propionic acid levels presented with significantly worse GI symptoms, QOL and negative emotions than those with low acetic acid or propionic acid levels or controls.

Conclusions & Inferences  These results support the hypothesis that both fecal microbiota and organic acids are altered in IBS patients. A combination of Veillonella and Lactobacillus is known to produce acetic and propionic acid. High levels of acetic and propionic acid may associate with abdominal symptoms, impaired QOL and negative emotions in IBS.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. Competing interests
  9. Grant support
  10. Financial disclosure
  11. Writing assistance
  12. References

Irritable bowel syndrome (IBS) is a highly prevalent functional gastrointestinal (GI) disorder characterized by chronic abdominal pain or discomfort associated with disordered bowel habits.1 Patients with IBS often show psychological disturbances, such as anxiety, depression or somatization,2 and GI symptoms, all of which are known to reduce health-related quality of life (QOL).3 Although some pathophysiological features of IBS, including dysregulation of brain-gut interactions represented by gut dysmotility and visceral hypersensitivity4 have been clarified, the causes of these features have not been determined. Sensitization is likely to occur somewhere in the visceral afferent pathway, involving primary afferent neurons, the spinal cord, vagus nerve and/or brain. Abundant evidence has shown that local insult (postinfection, postsurgery, low-grade mucosal inflammation and changes in GI microbiota) as well as psychosocial stress and/or genetic factors aggrevate IBS features.5

The human GI microbiota constitute a complex ecosystem that is beneficial to the host under normal conditions.6 However, GI infection or administration of antibiotics perturbs the GI microbiota composition and has been linked to expression of functional GI symptoms.7 One study showed that mice treated with antibiotics have a perturbed GI microbiota composition and exhibit visceral hypersensitivity, as assessed by colorectal distention, which is normalized by administration of probiotics.8 O’Mahony et al.9 also reported that IBS symptoms (abdominal pain, bloating and bowel movement difficulty) are improved by administration of probiotics. Moreover, in a rat model of IBS, treatment with probiotics was shown to increase the pain threshold of colorectal distention by 20%.10 Therefore, the composition of GI microbiota seems to play an important role in IBS symptoms.

Using conventional culture methods or the quantitative real-time polymerase chain reaction (qPCR), recent studies have shown altered fecal microbiota in IBS patients.11,12 However, considering the major bacterial groups that constitute GI microbiota in humans,13 these studies lacked some important aspects. Firstly, bacterial groups were only partially investigated. Secondly, the results of different studies are inconsistent. Thirdly, no clear association between GI microbiota composition and IBS symptoms has been demonstrated.

Other studies have shown altered colonic fermentation and increased formation of gas in IBS patients.14–16 By focusing on fecal short-chain fatty acids (SCFAs) as the major end product of bacterial metabolism in the human large intestine, researchers have shown that SCFAs are increased in diarrhoea-predominant IBS patients and decreased in constipation-predominant IBS patients.15 However, another study observed the conflicting finding that SCFAs are decreased in diarrhoea-predominant IBS patients,16 suggesting that it is necessary to conduct a broader analysis of fecal microbiota, whole profiles of organic acids and simultaneous GI symptoms in IBS patients.

In this study, we tested the hypotheses that IBS patients show altered GI microbiota, have a different profile of organic acids and that IBS symptoms are related to the organic acids profile.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. Competing interests
  9. Grant support
  10. Financial disclosure
  11. Writing assistance
  12. References

Subjects

Twenty-six patients with IBS were recruited by direct advertisement in the Tohoku University Hospital and Campus, Japan. All patients were diagnosed with IBS after conducting a medical interview based on Rome II criteria17 and positive judgment by a Rome II modular questionnaire18 retrospectively and positively fulfilling Rome III criteria.2 According to Rome II criteria related to bowel habits, 11 subjects had constipation-predominant IBS (IBS-C), eight had diarrhoea-predominant IBS (IBS-D) and seven had mixed IBS (IBS-M).

Twenty-six healthy control subjects without GI symptoms were recruited by the same method. Age (control: 21.9 ± 2.9, IBS: 21.7 ± 2.0), sex (F/M; control: 13/13, IBS: 13/13) and socioeconomic background were matched in both groups. All subjects underwent a physical examination, laboratory examination (complete blood count, blood chemical analyses, serum high sensitive C-reactive protein and fecal haemoglobin) and radiological examination (abdominal X-ray film) and individuals with organic GI disease, systemic disease, past history of abdominal surgery, infection, immunodeficiency or pregnancy were excluded. Colonoscopy, sigmoidoscopy or barium enema were negative in six patients from their history. No participants had relatives with IBD. Eligible subjects gave their written informed consent before the beginning of the study. This study was approved by the Ethics Committee of Tohoku University Graduate School of Medicine.

Fecal sampling

In the months prior to participation, the frequency of consuming yogurt in IBS patients (1.98 ± 2.34 times per week) did not differ from that in controls (1.82 ± 1.52 times per week, P = 0.59). In the 2 weeks prior to fecal sampling, subjects were requested not to consume yogurt, as set out in previous studies.19,20 In the previous study, agents containing probiotics were administered to humans and stopped thereafter. On day 10 after stopping the administration of probiotics, levels of these bacteria returned to the levels before administration of probiotics. No subject received antibiotics during the abstention period. Fecal samples were obtained from all subjects within a week after abdominal X-ray radiography was performed. Each sample (approximately 1 g) was collected with disinfected plastic equipment after defecation. Samples were immediately refrigerated under anaerobic conditions and analysed within 36 h.

qPCR bacterial analysis

For quantitative real-time polymerase chain reaction (qPCR) analysis, total DNA was isolated from the feces, and PCR amplification and detection performed as described by Matsuki et al.21 DNA extracted from Ruminococcus productus YIT 6141T, Faecalibacterium prausnitzii YIT 6174, Bacteroides vulgatus YIT 6159T, Bifidobacterium longum YIT 4021T, Collinsella aerofaciens ATCC 25986T, Prevotella melaninogenica YIT 6039T, Clostridium innocuum YIT 10151T, Clostridium ramosum YIT 10062T, Veillonella parvula YIT 6072Tand Fusobacterium varium ATCC 8501T were used as real-time PCR controls for the group-specific g-Ccoc, sg-Clept, g-Bfra, g-Bifid, c-Atopo, g-Prevo, g-Ecylin, sg-Cram, g-Veillo and g-Fuso primers respectively.21–23 References that describe targets for the assays in detail are listed in Table 1.

Table 1.   16S rRNA gene-targeted group-specific primers used in this study
Target bacterial groupPrimerSequenceSize (bp)Reference
Clostridium coccoides groupg-Ccoc477-FAAATGACGGTACCTGACTAA44023
g-Ccoc895-RCTTTGAGTTTCATTCTTGCGAA
Clostridium leptum subgroupsg-Clept933-FGCACAAGCAGTGGAGT23921
sg-Clept1164-RCTTCCTCCGTTTTGTCAA
Bacteroides fragilis groupg-Bfra148-F2AYAGCCTTTCGAAAGRAAGAT49523
g-Bfra626-RCCAGTATCAACTGCAATTTTA
Bifidobacteriumg-Bifid153-FCTCCTGGAAACGGGTGG55023
g-Bifid699-RGGTGTTCTTCCCGATATCTACA
Atopobium clusterg-Atopo292-FGGGTTGAGAGACCGACC19021
g-Atopo488-RCGGRGCTTCTTCTGCAGG
Prevotellag-Prevo808-FCACRGTAAACGATGGATGCC51323
g-Prevo1311-RGGTCGGGTTGCAGACC
Eubacterium cylindroides groupg-Ecylin479-FGTGAYGGTAKCTTACCAGA41622
g-Ecylin886-RCTTGCGTGCATACTCCC
Clostridium ramosum subgroupsg-Cram171-FGACACTGCATGGTGACC46622
sg-Cram626-RGGTTTCTATGGCTTACTG
Veillonellag-Veillo68-FGRAGAGCGATGGAAGCTT45922
g-Veillo490-RCCGTGGCTTTCTATTCC
Fusobacteriumg-Fuso862-FCWAACGCGATAAGTAATC31722
g-Fuso1150-RGCAGGCAGTATCGCAT

Bacterial culture analysis

Fecal samples were diluted 10 times with anaerobic buffer, diluted a further 10 times, and plated on several culture media in a glove-box. The following culture media (all by Nikken Bio Medical Laboratory, Kyoto, Japan) and incubation conditions were used: DHL for Enterobacteriaceae (aerobic, 1 day, 37°C), COBA for Enterococcus (aerobic, 2 days, 37°C), modified LBS for Lactobacillus (anaerobic, 3 days, 37°C), egg yolk added CW for lecithinase-positive Clostridium (anaerobic, 1 days, 37°C). For the Clostridium difficile assay, fecal samples were added to anaerobic buffer and ethyl alcohol (95%) for 30 min and plated on modified CCMA (anaerobic, 2 days, 37°C). The number of colonies was identified by enzyme immunoassay (EIA; ImmunoCard C. difficile, Meridian, Diagnostics, Inc., Cincinnati, OH, USA). The total number of bacteria was counted microscopically by the DAPI (4′, 6′-diamidino-2-phenylindole) staining method as described by Matsuki et al.23

Organic acids analysis

A portion of feces was deproteinated with perchloric acid centrifuged, and the supernatant used for analysis of organic acids. The following eight organic acids were measured by high-performance liquid chromatography (HPLC) according to the method described in a previous report by Kikuchi et al.24: sodium salts of acetic acid, succinic acid, propionic acid, formic acid, butyric acid, valeric acid and iso-valeric acid, and lithium lactate (all HPLC grade, Kanto Chemical Co., Inc., Tokyo, Japan).

Quantification of bowel gas

Bowel gas was quantified as described previously.14 Plain X-ray film of the abdomen was taken before fecal sampling and abdominal radiographs digitized and transmitted to a computer. The region of bowel gas was identified and its outline traced on the monitor. The gas volume score (GVS) was calculated by the ratio of the quantity of bowel gas to the pixel value in the total area.

GI symptoms, QOL and negative emotion

Gastrointestinal symptoms, QOL and negative emotion were assessed by validated questionnaires in IBS patients and healthy controls. Gastrointestinal symptoms were evaluated by the IBS Severity Index (IBSSI),25 Gastrointestinal Symptoms Rating Scale (GSRS)26 and Self-reported IBS Questionnaire (SIBSQ).27 Disease-specific QOL was examined by the IBS-QOL,28 and general QOL was evaluated with a Short-Form 36-Item Health Survey (SF-36).29 Negative emotion was evaluated by the Self-rating Depression Scale (SDS),30 State-Trait Anxiety Inventory (STAI),31 Perceived Stress Scale (PSS)32 and Tronto Alexithymia Scale (TAS20).33 Alexithymia is a personality trait more frequently observed in patients with functional GI disorders.34 All questionnaires were validated in Japanese.

Statistical methods

spss (SPSS Japan Inc., Tokyo, Japan) ver. 12.0 was used for statistical analysis. The sample size was determined by a power calculation. The chi-square test was used to compare categorical data between IBS patients and controls. Numerical values are expressed as the mean ± SD. After checking the normal distribution, the Student’s t-test was used to compare IBS patients with controls. For non-normal distributions, the Mann–Whitney U-test was used. When IBS patients were classified into groups depending on the phenotype, one-way analysis of variance (anova) followed by post hoc test was performed. Correlations were analysed with the Spearman’s method. A P-value <0.05 was considered significant.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. Competing interests
  9. Grant support
  10. Financial disclosure
  11. Writing assistance
  12. References

Intestinal microbiota

Of the 10 bacterial groups assayed by qPCR, the Veillonella count was significantly higher in IBS patients (7.2 ± 0.8 log10 bacteria g−1) than controls (6.8 ± 0.7 log10 bacteria g−1, P = 0.046) (Table 2). No differences in other bacterial counts were observed between IBS patients and controls. The prevalence of positive bacterial detection by qPCR was similar between IBS patients and controls for all bacterial groups. When intestinal microbiota were assayed by the culture-based method, IBS patients showed a significantly higher Lactobacillus count (5.6 ± 1.9 log10 bacteria g−1) than controls (4.6 ± 1.6 log10 bacteria g−1, P = 0.031). Neither the Enterobacteriaceae nor Enterococcus count differed between IBS patients and controls. The mean l (+)-Clostridium count could not be determined due to a relatively low prevalence. However, the prevalence of l (+)-Clostridium in IBS patients (42%) was significantly less than in controls (69%, P = 0.046). The prevalence of positive bacterial detection by the culture-based method was similar between IBS patients and controls for the other bacterial groups. Clostridium difficile was not detected in any sample. The total number of bacteria assayed by DAPI staining was not significantly different between IBS patients and controls.

Table 2.   Comparison of GI microbiota between IBS patients and the controls
Target bacteriaControl (= 26)IBS (= 26)P value
  1. Data (log10 bacteria g−1) shown as mean ± SD (prevalence %). Comparison: t-test, *< 0.05. GI, gastrointestinal; IBS, irritable bowel syndrome.

Real-time PCR
 C. coccoides group10.6 ± 0.310.6 ± 0.40.456
 C. leptum subgroup10.1 ± 0.59.9 ± 0.50.252
 B. fragilis group9.9 ± 0.69.9 ± 0.70.996
 Bifidobacterium9.7 ± 0.99.4 ± 0.90.343
 Atopobium cluster9.4 ± 1.09.3 ± 1.00.703
 Prevotella6.4 ± 0.96.8 ± 1.50.197
 E. cylindroides group8.7 ± 0.88.6 ± 0.80.770
 C. ramosum subgroup8.0 ± 0.88.0 ± 0.80.886
 Veillonella6.8 ± 0.77.2 ± 0.80.046*
 Fusobacterium6.6 ± 1.06.7 ± 1.00.775
Culture-based method
 Lactobacillus4.6 ± 1.65.6 ± 1.90.031*
 Enterobacteriaceae6.9 ± 1.16.7 ± 0.90.534
 Enterococcus7.1 ± 1.27.1 ± 1.10.809
DAPI counting
 Total bacteria11.0 ± 0.310.9 ± 0.20.087

Organic acids

The acetic acid level in IBS patients (67.0 ± 18.8 μmol g−1) was significantly higher than in controls (56.7 ± 18.0 μmol g−1, = 0.049) (Fig. 1). In addition, IBS patients had a significantly higher level of propionic acid (20.5 ± 9.2 μmol g−1) than controls (15.3 ± 6.6 μmol g−1, = 0.025). However, there was no difference in the concentration of other organic acids between IBS patients and controls. The level of total organic acids in IBS patients (107.1 ± 31.1 μmol g−1) was significantly higher than in controls (85.8 ± 28.6 μmol g−1, = 0.014). While iso-valeric acid was detected in only one IBS patient, valeric acid was not detected in any subject. The prevalence of acetic acid and propionic acid detection was 100%, but the prevalence of detection of other organic acids was lower than 100%, and was similar between IBS patients and the controls. There were significantly positive correlations between acetic acid and propionic acid in controls (= 26, rs = 0.467, = 0.016), IBS patients (= 26, rs = 0.608, =0.001) and total subjects (= 52, rs = 0.595, < 0.001).

image

Figure 1.  Fecal organic acids in irritable bowel syndrome (IBS) patients and controls. Data (μmol g−1) are shown as means. Comparison: t-test, *P < 0.05.

Download figure to PowerPoint

Association between microbiota and organic acids

Using median values of Veillonella (7.10 log10 bacteria g−1) and Lactobacillus (5.15 log10 bacteria g−1), we divided all subjects into four groups: group A, high Veillonella and high Lactobacillus (= 17); group B, high Veillonella and low Lactobacillus (= 10); group C, low Veillonella and high Lactobacillus (= 9) and group D, low Veillonella and low Lactobacillus (= 16).

Total organic acid in group A (113.7 ± 29.7 μmol g−1) was found by Mann–Whitney U-testing to be significantly higher than in group D (82.6 ± 30.3 μmol g−1, = 0.037). Acetic acid in group A (65.3 ± 16.8 μmol g−1) showed trend to be higher than in group D (54.8 ± 19.8 μmol g−1, = 0.068).

Quantity of bowel gas

No difference in GVS was observed between IBS patients (0.043 ± 0.036) and controls (0.046 ± 0.025). There was no correlation between GVS and organic acid or between GVS and counts of bacteria.

GI symptoms, QOL and negative emotion

Irritable bowel syndrome patients had significantly more severe GI symptoms than controls in SIBSQ, IBSSI and all GSRS scales (Table 3). In addition, IBS patients showed significantly poorer IBS-QOL than controls. General QOL measured with SF-36, except for physical functioning, was poorer in IBS patients than controls (Table 3). Irritable bowel syndrome patients had higher scores of depression, state anxiety, trait anxiety and perceived stress than controls. Two factors of alexithymia (difficulty to identify feelings and externally oriented thinking) were significantly higher in IBS patients than controls.

Table 3.   GI symptoms, IBS-QOL, health-related QOL and negative emotion
 Control (= 26)IBS (= 26)P value
  1. Data (score) shown as median and range. Comparison: Mann–Whitney test, *< 0.05, **< 0.01, ***< 0.001. GI, gastrointestinal; IBS, irritable bowel syndrome; QOL, quality of life.

IBSSI30 (0–190)250 (75–400)<0.001***
GSRS
 Total1.3 (1.0–2.3)2.7 (1.3–5.0)<0.001***
 Reflex1.0 (1.0–2.0)1.5 (1.0–7.0)0.001**
 Abdominal pain1.2 (1.0–2.7)2.3 (1.0–6.3)<0.001***
 Indigestion1.3 (1.0–3.0)2.5 (1.0–5.0)<0.001***
 Diarrhoea1.0 (1.0–2.7)3.2 (1.0–7.0)<0.001***
 Constipation1.3 (1.0–4.0)3.0 (1.0–6.0)<0.001***
SIBSQ27 (14–42)51 (35–71)<0.001***
IBS-QOL
 Dysphoria100 (84.4–100)81.3 (25.0–100)<0.001***
 Interference with activity100 (78.6–100)78.6 (28.6–100)<0.001***
 Body image100 (75.0–100)81.3 (37.5–100)<0.001***
 Health worry100 (75.0–100)83.3 (16.7–100)<0.001***
 Food avoidance100 (58.3–100)79.2 (25.0–100)<0.001***
 Social reaction100 (75.0–100)84.4 (12.5–100)<0.001***
 Sexual function100 (87.5–100)100 (50.0–100)0.01**
 Impact on relationship100 (83.3–100)91.7 (58.3–100)<0.001***
SF-36
 Physical functioning (PF)100 (95.0–100)100 (65.0–100)0.102
 Role physical (RP)100 (62.5–100)90.6 (50.0–100)0.005**
 Bodily pain (BP)84.0 (32.0–100)62.0 (20.0–100)<0.001***
 General health (GH)84.5 (20.0–100)51 (25.0–97.0)<0.001***
 Vitality (VT)65.6 (12.5–87.5)50 (0.0–75.0)0.006**
 Social functioning (SF)100 (37.5–100)68.8 (0.0–100)<0.001***
 Role emotional (RE)91.7 (50.0–100)50.0 (0.0–100)0.013*
 Mental health (MH)72.5 (25.0–95.0)57.5 (5.0–90.0)0.01**
SDS34 (24–51)44.0 (25.0–65.0)<0.001***
STAI
 Total82.5 (61.0–125.0)101.0 (57.0–142.0)0.001**
 State anxiety39.5 (28.0–66.0)49.0 (31.0–73.0)0.009**
 Trait anxiety42.5 (29.0–62.0)51.0 (26.0–78.0)0.001**
PSS23.5 (8.0–38.0)31.0 (11.0–50.0)0.005**
TAS20
 Total46.5 (27.0–72.0)58.0 (33.0–70.0)0.016*
 Difficulty to identify feelings14.0 (7.0–29.0)20.0 (7.0–33.0)0.013*
 Difficulty to describe feelings14.0 (6.0–24.0)15.0 (8.0–20.0)0.514
 Externally oriented thinking18.5 (10.0–25.0)20.5 (13.0–28.0)0.022*

Association between organic acids and GI symptoms, QOL or emotion

Using the mean acetic acid level (67.0 μmol g−1), IBS patients were classified into two groups: those with high acetic acid levels (= 13) and those with low acetic acid levels (= 13). One-way anova indicated a significant difference in the severity of abdominal pain in IBSSI (< 0.001), severity of bloating in IBSSI (< 0.001) and general health in SF-36 (< 0.001) among controls, IBS patients with low acetic acid levels, and IBS patients with high acetic acid levels. Post hoc analysis showed that IBS patients with high acetic acid levels had significantly higher scores of abdominal pain in IBSSI (= 0.041), severity of bloating in IBSSI (= 0.034) and significantly lower scores of general health in SF-36 (= 0.036) than IBS patients with low acetic acid levels (Fig. 2).

image

Figure 2.  Association between acetic acid level and irritable bowel syndrome (IBS) phenotypes; (A) severity of abdominal pain in IBSSI (< 0.001), (B) severity of bloating in IBSSI (< 0.001) and (C) general health in SF-36 (< 0.001). Post hoc analyses: *< 0.05, vs IBS patients with low acetic acid level, +< 0.05, +++< 0.001, vs controls.

Download figure to PowerPoint

Post hoc analysis also showed that IBS patients with low acetic acid levels had significantly higher scores of severity of abdominal pain in IBSSI (< 0.001), severity of bloating in IBSSI (P = 0.013) and significantly lower scores of general health in SF-36 (P = 0.017) than controls. Moreover, a comparison of IBS patients based on acetic acid levels (high vs low) allowed the differentiation of IBS phenotypes. IBS patients with high acetic acid levels had a significantly higher total score of SIBSQ (= 0.050) and less vitality of SF-36 (=0.029) than IBS patients with low acetic acid levels.

Using the mean propionic acid level (20.5 μmol g−1), IBS patients were classified into two groups: those with high propionic acid levels (= 14) and those with low propionic acid levels (= 12). One-way anova indicated a significant difference in the abdominal pain score of GSRS (< 0.001), total score of GSRS (< 0.001), total score of IBSSI (< 0.001) and externally oriented thinking of TAS20 (= 0.002) among controls, IBS patients with low propionic acid levels and IBS patients with high propionic acid levels.

Post hoc analysis showed that IBS patients with high propionic acid levels had significantly higher abdominal pain scores of GSRS (= 0.023), total score of GSRS (= 0.009), total score of IBSSI (= 0.042) and externally oriented thinking of TAS20 (= 0.043) than IBS patients with low propionic acid levels (Fig. 3). Post hoc analysis also showed that IBS patients with low propionic acid levels had significantly higher abdominal pain scores of GSRS (= 0.015), total score of GSRS (< 0.001) and total score of IBSSI (< 0.001) than controls. Moreover, the comparison of IBS patients based on propionic acid levels (high vs low) allowed the differentiation of IBS phenotypes. Irritable bowel syndrome patients with high propionic acid levels scored a significantly more severe degree of abdominal pain in IBSSI (= 0.046), severity of bloating in IBSSI (< 0.001), less general health in SF-36 (P = 0.017) and more trait anxiety (P = 0.015) than IBS patients with low propionic acid levels.

image

Figure 3.  Association between propionic acid level and irritable bowel syndrome (IBS) phenotypes; (A) abdominal pain score of Gastrointestinal Symptoms Rating Scale (GSRS) (< 0.001), (B) total score of GSRS (< 0.001), (C) total score of IBSSI (< 0.001) and (D) externally oriented thinking of TAS20 (= 0.002). Post hoc analyses: *< 0.05, **< 0.01, vs IBS patients with low propionic acid level, +< 0.05, ++< 0.01, +++< 0.001, vs controls.

Download figure to PowerPoint

Correlational analyses also supported a significant association between acid level (acetic, propionic or total) and IBS phenotypes. Abdominal bloating of IBSSI significantly correlated with level of acetic acid (total sample: = 52, rs = 0.387, P = 0.005, IBS: = 26, rs = 0.438, P = 0.025), propionic acid (total sample: rs = 0.562, P < 0.001, IBS: rs = 0.659, P < 0.001) and total organic acids (total sample: rs = 0.409, P = 0.003, IBS: rs = 0.460, P = 0.018) (data not shown).

Association between bowel pattern and microbiota or organic acids

One-way anova indicated a significant difference in the Lactobacillus count among controls, IBS-D, IBS-C and IBS-M patients (= 0.047). However, the post hoc test suggested that there was no significant difference among these groups. A significant difference in the Veillonella count was observed by one-way anova among controls, IBS-D, IBS-C and IBS-M patients (= 0.038). The post hoc test indicated that the Veillonella count in IBS-M patients was significantly higher than in controls (= 0.043). There was no significant difference in other microbiota or organic acids among controls, IBS-D, IBS-C and IBS-M patients.

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. Competing interests
  9. Grant support
  10. Financial disclosure
  11. Writing assistance
  12. References

This study is the first to show that an altered profile of intestinal microbiota and unbalanced fecal organic acid levels are associated with IBS. Our findings prove the three hypotheses that we set out to test: that IBS patients in this study had higher counts of Lactobacillus and Veillonella than controls, higher levels of acetic acid, propionic acid and total organic acids than controls, and that levels of acetic acid and propionic acid were associated with GI symptoms, impaired QOL and negative emotion.

The Lactobacillus count observation is consistent with the results of earlier studies showing that IBS patients have higher (or similar) bacterial counts of Lactobacillus than controls.11 Our results also support the report by O’Mahony et al.9 that showed Lactobacillus had no effect on IBS patients. These altered profiles of intestinal microbiota seem to be associated with increased organic acid levels in IBS patients. A previous study showed that in patients with small bowel bacterial overgrowth syndrome, the total concentration of SCFAs in jejuna secretions was approximately four times higher than in healthy subjects.35 Patients with bacterial overgrowth have a colon-like flora in the small intestine, and altered microbiota in the jejunum is responsible for most of the SCFAs in the jejunal secretion.35 Intake of antibiotics has also been shown to have pronounced effects on fecal SCFA excretion and to reduce the total concentration of SCFAs.36Lactobacillus are divided into two species based on the fermentation pattern. The homofermentative species produce lactic acid only from glucose, while the heterofermentative species metabolize lactic acid and acetic acid from glucose or fructose.37 Our result of the Veillonella count is also consistent with that of a study showing that IBS patients have a higher count of Veillonella than controls.11Veillonella is known to transform lactic acid into acetic acid and propionic acid,38 so our results strongly suggest that increased Lactobacillus and Veillonella counts result in the production of higher levels of acetic acid and propionic acid from gut lumen nutrients in IBS patients. In this study, simultaneous measurement of fecal microbiota and organic acid levels enabled us to identify the link between intestinal microorganisms and their products in IBS patients.

In this study, an association between organic acids and IBS symptoms on the visceral sensation indicates that increased chemical stimuli could be one of the origins or exacerbating factors in IBS. Visceral hypersensitivity in IBS patients is considered to be mechanosensitive,4 while chemosensitivity and chemical stimuli in IBS patients is largely unknown. The GI tract receives dual extrinsic sensory innervation, from both spinal and vagal afferents.4 Spinal afferents terminate in the serosa and underlying muscle layer, while vagal afferents terminate close to the mucosal epithelium, where they are exposed to chemicals absorbed from the lumen or mediators released from enteroendocrine cells or immune cells.39

Aerssens et al.39 reported that stress-induced postinflammatory visceral hypersensitivity is due to alterations in chemosensitivity. In stressed and postinfected mice, gene expression of both transient receptor potential cation channel subfamily V member 1 (Trpv1) and transient receptor potential cation channel subfamily A member 1 (Trpa1) is up-regulated in afferent neurons.39 Trpv1 is an acid-sensing ion channel, activated by capsaicin, noxious heat (with a thermal threshold >43°C) and protons (acidification), which causes pain in vivo.40 It has also been reported that 10-day-old rat pups treated with an intracolonic infusion of 0.5% acetic acid show higher sensitivity to colorectal distention than those treated with an infusion of saline.41 In the same model, it was shown that Trpv1 expression is increased in dorsal root ganglia and that Trpv1 antagonism attenuates visceral sensitivity.41 Indeed, patients with rectal hypersensitivity have increased Trpv1 immunoreactivity in sensory nerve fibres.42 Trpa1 also contributes to the mechanosensory function of the vagal/pelvic mucosal afferents and splanchnic/pelvic serosal/mesenteric afferents, and is involved in the sensitization of these afferents by diverse noxious stimuli.43 Therefore, our current results are in accordance with the recent concept of visceral sensation.

High levels of acetic acid and propionic acid were associated with poor QOL and negative emotion in this study. An earlier study found that vagal afferent input from acid-exposed gut mucosa leads to the activation of subcortical brain nuclei that are involved in emotional, behavioural, neuroendocrine, autonomic and antinociceptive reactions to noxious stimuli.44 Therefore, sustained acid stimuli in the GI tract may induce poor QOL and negative emotion. In this study, IBS subtypes according to predominant bowel pattern were not associated with levels of organic acids, but were associated with bacterial counts of Lactobacillus and Veillonella. This is probably due to the small sample size of each subtype, that is, only the Veillonella count in the IBS-M patient count was high in the post hoc test. These findings are not surprising because bowel patterns in IBS patients alter over time.45 The lack of meaningful association between microbiota/organic acids and the diarrhoea/constipation score of GSRS also supports the concept that altered microbiota/organic acids relate to visceral sensation phenotypes in IBS.

The strengths of the present study include the simultaneous assessment of microbiota, organic acid levels and quantitative IBS phenotypes. In addition, identified microbiota and organic acids have feasible cause–result relationships, while increased organic acid levels are associated with some, although not all, IBS features. However, a limitation is that our results show no difference in bowel gas volume between controls and IBS patients, which is inconsistent with the results of an earlier study.14 Because IBS patients in this study showed a higher abdominal bloating score, increased sensitivity to the same mechanical stimuli as the controls may be more important in IBS than increased gas volume. Other limitations include the incomplete analysis of microbiota, possibly caused by different methodologies and/or a different microbiota focus14 producing different results, and the fact that the patient dietary profile, with the exception of yogurt, was lacking. In IBS patients, precise dietary behaviour which may differ from that of healthy controls has not been extensively reported and would be a useful focus for future studies. Due to the limitations of the present study, further investigation into the GI microbiota in IBS patients, and an examination of human brain–gut–bacterial interactions is warranted.

Acknowledgments

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. Competing interests
  9. Grant support
  10. Financial disclosure
  11. Writing assistance
  12. References

The authors thank members of the Yakult Central Institute, Hiromi Setoyama, Taeko Hara and Toshihisa Ohta for their assistance.

Financial disclosure

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. Competing interests
  9. Grant support
  10. Financial disclosure
  11. Writing assistance
  12. References

The authors disclose no financial arrangement (including consultancies, stock ownership, equity interests, patent-licensing arrangements, research support, major honoraria) they may have with a company whose product figures prominently in the submitted manuscript.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Acknowledgments
  8. Competing interests
  9. Grant support
  10. Financial disclosure
  11. Writing assistance
  12. References
  • 1
    Chang L, Toner BB, Fukudo S et al. Gender, age, society, culture, and the patient’s perspective in the functional gastrointestinal disorders. Gastroenterology 2006; 130: 143546.
  • 2
    Longstreth GF, Thompson WG, Chey WD, Houghton LA, Mearin F, Spiller RC. Functional bowel disorders. Gastroenterology 2006; 130: 148091.
  • 3
    Gralnek IM, Hays RD, Kilbourne AM et al. The impact of irritable bowel syndrome on health-related quality of life. Gastroenterology 2000; 119: 65460.
  • 4
    Fukudo S, Nomura T, Muranaka M, Taguchi F. Brain-gut response to stress and cholinergic stimulation in irritable bowel syndrome. A preliminary study. J Clin Gastroenterol 1993; 17: 13341.
  • 5
    Barbara G, De Giorgio R, Stanghellini V et al. A role for inflammation in irritable bowel syndrome? Gut 2002; 51(Suppl. 1): i414.
  • 6
    Sonnenburg JL, Angenent LT, Gordon JI. Getting a grip on things: how do communities of bacterial symbionts become established in our intestine? Nat Immun 2004; 5: 56973.
  • 7
    Spiller RC. Postinfectious irritable bowel syndrome. Gastroenterology 2003; 124: 166271.
  • 8
    Verdú EF, Bercik P, Verma-Gandhu M et al. Specific probiotic therapy attenuates antibiotic induced visceral hypersensitivity in mice. Gut 2006; 55: 18290.
  • 9
    O’Mahony L, McCarthy J, Kelly P et al. Lactobacillus and bifidobacterium in irritable bowel syndrome: symptom responses and relational to cytokine profiles. Gastroenterology 2005; 128: 54151.
  • 10
    Rousseaux C, Thuru X, Gelot A et al. Lactobacillus acidophilus modulates intestinal pain and induces opioid and cannabinoid receptors. Nat Med 2007; 13: 357.
  • 11
    Malinen E, Rinttilä T, Kajander K et al. Analysis of the microbiota of irritable bowel syndrome patients and healthy controls with real-time PCR. Am J Gastroenterol 2005; 100: 37382.
    Direct Link:
  • 12
    Kassinen A, Kroqius-Kurikka L, Mökivuokko H et al. The feacal microbiota of irritable bowel syndrome patients differs significantly from that of health subjects. Gastroenterology 2007; 133: 2433.
  • 13
    Franks AH, Harmsen HJ, Raangs GC et al. Variations of bacterial populations in human feces measured by fluorescent in situ hybridization with group-specific 16S r RNA-targeted oligonucleotide probes. Appl Environ Microbiol 1998; 64: 333645.
  • 14
    Koide A, Yamaguchi T, Odaka T et al. Quantitative analysis of bowel gas using plain abdominal radiograph in patients with irritable bowel syndrome. Am J Gastroenterol 2000; 95: 173541.
    Direct Link:
  • 15
    Mortensen PB, Andersen JR, Arffmann S et al. Short-chain fatty acids and the irritable bowel syndrome: the effect of wheat bran. Scand J Gastroenterol 1987; 22: 18592.
  • 16
    Treem WR, Ahsan N, Kastoff G et al. Fecal short-chain fatty acids in patients with diarrhea-predominant irritable bowel syndrome: in vitro studies of carbohydrate fermentation. J Pediatr Gastroenterol Nutr 1996; 23: 2806.
  • 17
    Tompson WG, Longstreth GF, Drossman DA et al. Functional bowel disorders and functional abdominal pain. Gut 1999; 45(Suppl. 2): II437.
  • 18
    Drossman DA, Talley NJ, Whitehead WE, et al. Research diagnostic questions for functional gastrointestinal disorders: Rome II modular questionnaire: investigations and respondent forms. In: DrossmanDA, CorazziariE, TalleyNJ, ThompsonWG, eds. Rome II: The Functional Gastrointestinal Disorders, 2nd edn. McLean, VA: Degnon Associates, 2000: 669714.
  • 19
    Matsumoto K, Takada T, Shimizu K et al. The effects of a probiotic milk product containing Lactobacillus casei strain Shirota on the defecation frequency and the intestinal microbiota of sub-optimal health state volunteers: a randomized placebo-controlled cross-over study. Biosci Micobiota 2006; 25: 3948.
  • 20
    Brigidi P, Vitali B, Swennen E et al. Effects of probiotic administration upon the composition and enzymatic activity of human fecal microbiota in patients with irritable bowel syndrome or functional diarrhea. Res Microbiol 2001; 152: 73541.
  • 21
    Matsuki T, Watanabe K, Fujimoto J et al. Use of 16S rRNA gene-targeted group-specific primers for real-time PCR analysis of predominant bacteria in human feces. Appl Environ Microbiol 2004; 70: 72208.
  • 22
    Matsuki T, Fujimoto J, Watanabe K. Group-specific PCR primers for the detection of human intestinal bacteria. Japanese patent 2007–20423.
  • 23
    Matsuki T, Watanabe K, Fujimoto J et al. Development of 16S rRNA-gene-targeted group-specific primers for the detection and identification of predominant bacteria in human feces. Appl Environ Microbiol 2002; 68: 544551.
  • 24
    Kikuchi H, Tajima T. Correlation between water-holding capacity of different types of cellulose in vitro and gastrointestinal retention time in vivo of rats. J Sci Agric 1992; 60: 13946.
  • 25
    Francis CY, Morris J, Whorwell PJ. The irritable bowel severity scoring system: a simple method of monitoring irritable bowel syndrome and its progress. Aliment Pharmacol Ther 1997; 11: 395402.
  • 26
    Svedlund J, Sjödin I, Dotevall G. GSRS – a clinical rating scale for gastrointestinal symptoms in patients with irritable bowel syndrome and peptic ulcer disease. Dig Dis Sci 1988; 33: 12934.
  • 27
    Shinozaki M, Fukudo S, Hongo M et al. High prevalence of irritable bowel syndrome in medical out-patients in Japan. J Clin Gastroenterol 2008; 42: 10106.
  • 28
    Drossman DA, Patrick DL, Whitehead WE et al. Futher validation of the IBS-QOL: a disease-specific quality-of-life questionnaire. Am J Gastroenterol 2000; 95: 9991007.
    Direct Link:
  • 29
    Ware JE Jr, Sherbourne CD. The MOS 36-item short-form health survey (SF-36). I. Conceptual framework and item selection. Med Care 1992; 30: 47383.
  • 30
    Zung WW. A self-rating depression scale. Arch Gen Psychiatry 1965; 12: 6370.
  • 31
    Speilberger CD, Gorsuch RL, Lushene RE. STAI Manual. Palo Alto (CA): Consulting Psychologist Press, 1970: 2349.
  • 32
    Cohen S, Tyrrell DA, Smith AP. Psychological stress and susceptibility to the common cold. N Engl J Med 1991; 325: 60612.
  • 33
    Bagby RM, Parker JD, Taylor GJ. The twenty-item Toronto Alexithymia Scale – I. Item selection and cross-validation of the factor structure. J Psychosom Res 1994; 38: 2332.
  • 34
    Taylor GJ. Recent developments in alexithymia theory and research. Can J Psychiatry 2000; 45: 13442.
  • 35
    Hoverstad T, Bjornaklett A, Fausa O et al. Short-chain fatty acids in the small-bowel bacterial overgrowth syndrome. Scand J Gastroenterol 1985; 20: 4929.
  • 36
    Hoverstad T, Carlstedt-Duke B, Lingaas E et al. Influence of oral intake of seven different antibiotics on faecal short-chain fatty acid excretion in health subjects. Scand J Gastroenterol 1986; 21: 9971003.
  • 37
    Hegazi FZ, Abo-Elinaga IG. Degradation of organic acids by dairy lactic acid bacteria. Zentralbl Bakteriol Naturwiss 1980; 135: 21222.
  • 38
    Durant JA, Nisbet DJ, Ricke SC. Comparison of batch culture growth and fermentation of a poultry Veillonella isolate and selected Veillonella species groen in a defined medium. Anaerobe 1997; 3: 3917.
  • 39
    Aerssens J, Hillsley K, Peeters PJ et al. Alteration in the brain–gut axis underlying visceral hypersensitivity in Nippostrongylus brasilinensis-infected mice. Gastroenterology 2007; 132: 137587.
  • 40
    Tominaga M, Julius D. Capsaicin receptor in the pain pathway. Jpn J Pharmacol 2000; 83: 204.
  • 41
    Winston J, Shenoy M, Medley D et al. The vanilloid receptor initiates and maintains colonic hypersensitivity induced by neonatal colon irritation in rats. Gastroenterology 2007; 132: 61527.
  • 42
    Chan CLH, Facer P, Davis JB et al. Sensory fibres expressing capsaicin receptor TRPV1 in patients with rectal hypersensitivity and feacal urgency. Lancet 2003; 361: 38591.
  • 43
    Brierley SM, Hughes PA, Page AJ et al. Novel and specific roles for the inon channel TRPA1 in visceral sensory transduction. Gastroenterology 2008; 134(Suppl. 1): A8.
  • 44
    Michl T, Jocic M, Heinemann A et al. Vagal afferent signaling of a gastric mucosal acid insult to medullary, pontine, thalamic, hypothalamic and limbic, but not cortical, nuclei of the rat brain. Pain 2001; 92: 1927.
  • 45
    Drossman DA, Morris CB, Hu Y et al. A prospective assessment of bowel habit in irritable bowel syndrome in women: defining an alternator. Gastroenterology 2005; 128: 5809.