SEARCH

SEARCH BY CITATION

Keywords:

  • acute pancreatitis;
  • galanin;
  • galanin receptors;
  • galanin receptor 3

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgments
  9. Author contributions
  10. Competing interests
  11. Conflict of Interest
  12. References

Background  Galanin participates in the pathogenesis of acute pancreatitis (AP). The galanin receptor (GALR) sub-types involved, however, are unclear. We aimed to determine GALRs messenger RNA (mRNA) expression in mouse pancreas, describe their localization, and ascertain if GALR2 and GALR3 are involved in AP.

Methods  Galanin receptor expression in murine whole pancreas, acinar, and islet cells was quantified by polymerase chain reaction amplification of reverse-transcribed RNA for mRNA, Western blot analysis for protein and in situ hybridization for GALR localization. Isolated acinar cells were used to determine galanin’s effect on amylase secretion. Acute pancreatitis was induced in mice by caerulein injections. Mice, with and without AP, were treated with the highly selective GALR2 antagonist M871, or the specific GALR3 antagonist SNAP-37889. Indices of AP were measured at 12 h.

Key Results  Murine pancreas expresses mRNA for GALRs. In islets the expression of all GALR are comparable, whereas in acinar cells GALR3 is predominantly expressed. Western blot analysis confirmed that the GALR proteins are expressed by acinar cells. In situ hybridization analysis confirmed that GALR3 mRNA is present in islet and acinar cells, while mRNA for GALR1 and 2 is confined to islets. Galanin did not influence basal and caerulein-stimulated amylase release from acinar cells. M871 treatment reduced some, whereas SNAP-37889 treatment reduced all indices of AP (by 40–80%).

Conclusions & Inferences  Galanin receptor mRNA and protein are expressed in mouse pancreas, with GALR3 mRNA predominating. GALR3 antagonism reduced the severity of AP whereas GALR2 antagonism was less effective. GALR3 is a potential target for treatment of AP.


Abbreviations:
AP

acute pancreatitis

cDNA

complementary deoxyribonucleic acid

DEPC

diethyl pyrocarbonate

DIG

digoxigenin

DNA

deoxyribonucleic acid

DRG

dorsal root ganglia

GALR

galanin receptor

GALR1

galanin receptor 1

GALR2

galanin receptor 2

GALR3

galanin receptor 3

HPRT

hypoxanthine-guanine phosphoribosyltransferase

mRNA

messenger ribonucleic acid

MPO

myeloperoxidase

PCR

polymerase chain reaction

RNA

ribonucleic acid

RT-PCR

reverse transcriptase polymerase chain reaction

SEM

standard error of the means

SSC

standard saline citrate

UPW

ultra pure water

WM

Waymouth medium

Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgments
  9. Author contributions
  10. Competing interests
  11. Conflict of Interest
  12. References

Acute pancreatitis (AP) is an inflammatory disease of the pancreas that is associated with substantial morbidity.1,2 In about 20% of patients, the disease is severe with an attendant risk of mortality.3,4 Currently there is no specific treatment for AP. Standard therapy involves supportive management with fluid resuscitation and symptomatic relief. The complexity of the pathogenesis of AP has hampered the development of specific therapeutic agents. We recently provided evidence that the neuropeptide galanin,5 participates in the pathogenesis of experimental AP6,7 and its non-selective receptor antagonist, galantide, ameliorated the indices of AP in mice and the Australian possum.6,8,9

In the pancreas, galanin immunoreactivity is present in nerve fibres closely associated with blood vessels, the parenchyma and intrinsic ganglia.10 A subset of pancreatic islet cells also displays galanin immunoreactivity.11–13 In other systems, galanin acts via three G protein-coupled receptors designated as galanin receptor 1 (GALR1), 2 (GALR2) and 3 (GALR3), however, the pattern of distribution of these receptors in the pancreas is unknown. It is well documented that galanin modulates insulin secretion, whereas reports of its effects on pancreatic exocrine secretion are inconsistent.14–17 We recently showed that exogenous galanin inhibited basal and caerulein-stimulated amylase secretion at a concentration that mimics the effects of cholecystokinin at physiological levels.18 Further, we also demonstrated that galanin potentiated the amylase secretion induced by supramaximal concentrations of caerulein; conditions aimed at simulating those used in many rodent models of caerulein-induced AP.19 These effects of galanin were mediated via cholinergic nerves and islet secretion. Thus, the effect of galanin on isolated acinar cell amylase secretion requires clarification.

Chimeric peptide GALR antagonists are readily available, however, they are not receptor sub-type specific and their selectivity is poor.20 Although galantide ameliorates experimental AP, galanin acts in the central and peripheral nervous systems21 and hence non-specific antagonism of its receptors (as part of therapy) can potentially have distant/systemic effects. GALR1 is widely expressed in the brain and spinal cord, as well as in peripheral sites such as the small intestine and heart.22 The GALR sub-type(s) that mediate galanin’s role in AP are not known. Thus, it is pertinent to evaluate the distribution of GALRs in the pancreas to determine the predominant receptor sub-types and to explore the benefit of individually targeting these receptors in the treatment of AP. Recently, M871, a GALR2-selective peptide antagonist and SNAP-37889, a small non-peptide specific GALR3 receptor antagonist have been developed.23,24

The aim of this study was to determine (i) the expression and cellular localization of the GALRs using polymerase chain reaction (PCR) amplification of reverse-transcribed RNA, Western blot analysis and in situ hybridization techniques, (ii) if galanin modulates basal and/or stimulated secretion from isolated mouse acinar cells, and (iii) the role of GALR2 and 3 in caerulein-induced AP by evaluating the effects of M871 and SNAP-37889 administration on the severity of caerulein-induced AP in mice. For comparative purposes, galantide treatment was also evaluated.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgments
  9. Author contributions
  10. Competing interests
  11. Conflict of Interest
  12. References

The following studies were approved by the Animal Welfare Committee of Flinders University. Adult Swiss mice (15–30 g body weight) were used for all experiments.

Molecular studies

All procedures were conducted at room temperature unless otherwise stated. Mice were killed by cervical dislocation (three mice per experiment) and the pancreata were harvested, washed in ice-cold saline, pooled and minced. A proportion of the minced pancreata was snap frozen in liquid N2 and stored at −80 °C until required for RNA extraction.

Isolation of mouse acinar cells  The remaining minced pancreata (300–400 mg) were digested with collagenase P (2.5 mg; Roche, Mannheim, Germany) in 5 mL oxygenated Waymouth medium (WM) (GIBCO; Invitrogen, Paisley, UK) for 10 min at 37 °C in a shaking water bath (120 oscillations min−1) (Paton Industries, Adelaide, Australia), then the excess media was removed and followed by 15–30 min incubation in another 5 mL oxygenated WM media (37 °C) containing collagenase P (2.5 mg). The pancreatic cells were then dispersed manually by mechanical disruption using pipettes in the presence of soybean trypsin inhibitor (5 mg; Sigma-Aldrich, St Louis, MO, USA) and strained through 150 μm nylon mesh. The cells were resuspended with 10 mL of WM (37 °C) containing fetal calf serum (15 : 85 v/v) (GIBCO) and centrifuged for 1 min at 173 × g. This resuspension-centrifugation step was repeated another two times. The cell pellet was suspended in 5 mL oxygenated Minimum Essential Medium (GIBCO) at 37 °C. The viability of all batches of acinar cells were confirmed by trypan blue exclusion test and increased amylase secretion (at least a two-fold increase relative to controls) induced by caerulein (10−7 and 10−10 mol L−1 for 60 min at 37 °C). These cells were used for secretion studies or snap frozen in liquid nitrogen and stored at −80 °C for subsequent RNA extraction and Western blot analysis (see below).

Isolation of mouse pancreatic islets  Mice were killed by an anesthetic overdose with halothane. The bile duct was clamped at its entrance to the duodenum and 0.3 mL of RPMI medium (Sigma-Aldrich) supplemented with 0.5 mg mL−1 of collagenase P (Roche Diagnostics) was injected into the bile duct. Once fully distended, the pancreas was harvested and placed in 50 mL tube on ice. All subsequent procedures were performed at room temperature unless otherwise stated. Using aseptic technique, 10 mL of sterile RPMI medium (Sigma-Aldrich) (warmed to 37 °C) was added to the tube and incubated at 37 °C in a shaking water bath (100 oscillations min−1) for 15 min. The RPMI medium was then replaced with another 10 mL of sterile RPMI medium at 4 °C and vigorously shaken manually for 1 min to completely disrupt the pancreatic tissue. The digest was immediately passed through a sterile 500-μm stainless steel mesh (Sigma-Aldrich) and the filtrate collected in a 50 mL-tube. The tube was centrifuged at 45 × g for 2 min. This step was repeated twice. The supernatant was discarded and the tube inverted for a few minutes to remove any residual supernatant. The pellet was then resuspended in 10 mL of Histopaque–1077 (Sigma-Aldrich), overlayed with 5 mL of sterile RPMI medium and centrifuged at 750 × g for 10 min. Islets, which were present in the top RPMI layer, were carefully removed with a pipette. The islets were washed with 30 mL of sterile RPMI medium and centrifuged at 180 × g for 5 min. The supernatant was removed and the pellet was resuspended in 4 mL of sterile RPMI medium supplemented with 10% heat inactivated fetal calf serum (Invitrogen, Carlsbad, CA, USA). Islets were then plated onto sterile untreated 35-mm plastic Petri dishes (Iwaki, Sydney, Australia) and incubated in 95% O2 5% CO2 incubator at 37 °C for 12 h. Islets were then manually collected, replated and cultured for a further 36 h. Islets were manually collected and used for RNA extraction (4 days after isolation).

RNA extraction from whole pancreas and acinar cells  The extraction of RNA from pancreas and acinar cells was performed according to the previously described method.25 Freshly isolated acinar cell suspension (0.5 mL) was centrifuged for 1 min at 16 000 × g at 4 °C and the pellet resuspended in 0.5 mL of TRIzol® reagent (Invitrogen), rapidly mixed, snap frozen in liquid N2 and stored at −80 °C for subsequent RNA extraction. The concentration of RNA in each extract was determined by using a Biophotometer (Eppendorf North America, Hauppauge, NY, USA) and the quality of RNA was determined by electrophoresis (1% agarose gel). The final RNA solution was stored at −80 °C until required for cDNA synthesis.

RNA extraction from islet cells  Isolation of RNA was performed using TRIzol® Reagent (Invitrogen) and the protocol was based on the manufacturer’s instructions. All procedures were performed at 4 °C unless otherwise specified. Prior to RNA isolation, the islets were centrifuged at 160 × g for 7 min to completely lyse the cells. The medium was discarded and 800 μL of TRIzol® and 10 μL of 20 μg mL−1 RNase-free glycogen (Invitrogen) were added and the pellet resuspended with the aid of a pipette. This suspension was incubated in a 30 °C water bath for 5 min to complete the solubilization of the pellet. Thereafter, 200 μL of chloroform (Sigma-Aldrich) was added, manually shaken for 15 s and returned to the water bath for another 2–3 min after which the samples were centrifuged at 12 000 × g for 15 min. The upper aqueous phase was collected, transferred to a fresh tube and 500 μL of isopropyl alcohol (Labserv; Biolab Ltd, Mulgrave, Australia) for the precipitation of RNA. The tube was incubated in a 20 °C water bath for 10 min and centrifuged at 12 000 × g for 10 min. The supernatant was discarded and the pellet washed with 1 mL of 75% ethanol (Merck, Darmstadt, Germany) and then centrifuged at 7500 × g for 5 min. The supernatant was discarded, the pellet air dried at room temperature for approximately 15 min, then resuspended in 60 μL of RNase and DNase free H2O (Invitrogen) and incubated at 55 °C for 10 min. Resuspended RNA was stored at −80 °C until required. The islet RNA concentration and quality were assessed using Agilent Bioanalyzer electrophoresis (Agilent Biotechnology, Sydney, Australia).

DNAse 1 treatment, reverse transcription and RT- PCR of RNA  RNA from whole pancreas and acinar cell samples were precipitated from formamide and dissolved in ultra pure water (UPW) (Fisher Biotec, West Perth, Australia). Islet RNA samples were in UPW after extraction and ready to use. Elimination of genomic DNA and RT of RNA were performed using the QuantiTect Reverse Transcription Kit (Qiagen, Doncaster, Australia) according to the manufacturer protocol. The synthesized cDNA was diluted by adding 25 μL of UPW.

GALR1, GALR2 and GALR3 mRNA, and hypoxanthine-guanine phosphoribosyltransferase (HPRT) RNA were detected by using 3 μL of cDNA in real-time PCR with an annealing temperature of 56 °C (GALR1), 61 °C (GALR2), 58 °C (GALR3), and 57 °C (HPRT) according to the previously published method.6 Hypoxanthine-guanine phosphoribosyltransferase was used as house keeping gene. The GALR expression data were normalized by dividing the target quantity of gene of interest by the target quantity of HPRT and displayed graphically as relative expression.

Western blot analysis  Stocks of frozen isolated acinar cells corresponding to 0.5 mL of cell suspension (see above) was resuspended in 0.2 mL of lysis buffer and subjected to Western blot analysis as previously described.6 Gels (12% pre-cast; Bio-Rad Laboratories Inc., Hercules, CA, USA) were loaded with 50 μg protein.

In situ hybridization In situ hybridization protocol was based in part on that described by Nuovo et al.26 Freshly resected mouse pancreata and dorsal root ganglia (T10-L2) were fixed in 4% paraformaldehyde (Merck) for 4–6 h. All procedures were conducted at room temperature unless otherwise stated. The fixed tissue was then placed in phosphate-buffered saline (PBS) containing 18% sucrose (Univar, Auburn, Australia) and subsequently frozen (−80 °C) in optimal cutting temperature (OCT) compound (Tissue-Tek®; Sakura, Torrance, CA, USA). Cryostat sections (12 μm) were then fixed by air drying on Super-Frost glass slides (Menzel-Glazer®, Braunschweig, Germany). The slides were incubated for 13 min with 2 μg mL−1 Proteinase K (Roche Diagnostics) in 0.05 mol L−1 Tris-Cl, 0.005 mol L−1 ethylene diamine tetraacetate pH 7.5. All buffers were prepared with diethyl pyrocarbonate (DEPC)-treated water unless otherwise stated. The sections were acetylated for 10 min with acetic anhydride (Sigma-Aldrich) (0.25% in 0.0018 mol L−1 HCl containing 1.33% ethanolamine) incubated for 4 h with 40 μL of prehybridization buffer [50% deionized formamide (#F9037; Sigma-Aldrich), 2% Denhardt’s reagent (#D2532; Sigma-Aldrich), 10% Dextran Sulphate (#D8906; Sigma-Aldrich), 2% Yeast t-RNA (10.5 mg mL−1, #R8508; Sigma-Aldrich), 2.5% Herring sperm DNA (#1146714001; Roche), 20× standard saline citrate (SSC) (Sigma-Aldrich) buffer, and DEPC-treated water] and then incubated overnight with 40 μL of denaturing hybridization buffer [0.25% CHAPS (Solon #0465-5g; Amresco), 0.1% Tween-20 (#P1379; Sigma-Aldrich)] containing 250 nmol L−1 denatured locked digoxigenin (DIG)-labeled nucleic acid probes (GALR1, GALR2, GALR3; Exiqon, Vedbaek, Denmark) in a hybridization oven at 55 °C. The probes were custom designed for us, using regions of GALR mRNA sequence we specified, and were labeled with DIG at the 5′ and 3′ end. The sequences were as follows: GALR-1 DIG gaatgtagttggatcgataggaat DIG, GALR-2 DIG gactcaggttccagcatgccac DIG, and GALR-3 DIG ttagtctagtctctccaccgcgca DIG.

The sections were then washed in 0.2× SSC and incubated with 0.2× SSC for 60 min at 60 °C. The sections were treated with levamisole (24%) (#L9756-5G; Sigma-Aldrich). The sections were then incubated with a blocking solution (1% blocking buffer and 1× maleic acid buffer, DIG Wash and Block Buffer Set (Roche Diagnostics) for 60 min and subsequently incubated overnight at 4 °C with anti-DIG antibodies (1 : 2000 dilution; Roche Diagnostics) in blocking solution. The slides were then washed in 1× wash buffer (DIG Wash and Block Buffer Set; Roche Diagnostics) and then incubated with the detection buffer (0.08 mol L−1 Tris-Cl containing 0.17 mol L−1 NaCl pH 9.5) for 10 min. The slides were then placed in a slide mailer containing nitro blue tetrazolium chloride/5-bromo-4-chloro-3-indolyl phosphate, toluidine salt) (1 : 500 dilution) (Roche Diagnostics). To verify the specificity of the signal, control slides were incubated with a scramble probe (sequence: DIG gtgtaacacgtctatacgccca DIG; Exiqon) and processed in an identical manner.

Amylase secretion studies

In light of the presence of GALR mRNA in acinar cells (see Results section), the effect of galanin on basal amylase secretion from acinar cells was studied. Many models of AP use supramaximal concentrations of caerulein to induce the disease. In order to understand the role of galanin in the context of the hypersecretion model of AP, the effect of galanin on amylase secretion induced by a supramaximal concentration of caerulein was also evaluated. Freshly isolated acinar (n = 5–7 preparations) were incubated with galanin (10−13–10−7 mol L−1), caerulein (10−12–10−7 mol L−1), alone or in combinations for 60 min at 37 °C. Control acinar cells were incubated in medium alone. Amylase secretion was expressed as percent of control.

AP studies

As the three GALRs are expressed in the mouse pancreas (see Results), one or more could participate in the pathogenesis of AP. However, as only a specific antagonist is available for GALR3 (SNAP-37889) and a highly selective antagonist for GALR2 (M871), these antagonists were selected for AP studies to evaluate the potential roles of these sub-types.

The day prior to the experiment, mice were randomly assigned to various experimental groups (see below). The mice were anesthetized and a blood sample was collected by orbital sinus bleeding to determine the baseline plasma amylase activity, as described by Rifai et al.25 The anesthesia was then reversed and the mice were fasted overnight with free access to water.

Induction of AP

Acute pancreatitis was induced as previously described.6,8 Twelve hours after AP induction the mice were anesthetized and a post-treatment blood sample was collected by orbital sinus bleeding. The mice were then killed by exsanguination under anesthesia and the pancreas was harvested for subsequent assessment of myeloperoxidase (MPO) activity and histological examination to determine the severity of AP as previously described.8,27 The plasma samples were assayed for amylase.8 The plasma amylase activity was expressed as IU L−1 and MPO activity U mg protein−1. Tissue for histological examination was fixed overnight in 10% buffered formalin solution (Orion Laboratories Pty Ltd, Perth, Australia) before standard hematoxylin and eosin processing.

Histological examination

Pancreatic sections (5 μm) were subjected to point counting.8,25 Edema (expressed as points 100 points−1) and abnormal acinar cells (expressed as % of the total acinar cells) were quantified.

Treatment groups

In separate groups of mice, AP was induced as described above with and without administration of the galanin antagonist galantide (Bachem AG, Bubendorf, Switzerland), M871 (generously provided by UE Sollenberg, Stockholm University, Stockholm, Sweden) or SNAP-37889 (generously provided by LA Blackshaw, University of Adelaide, Adelaide South Australia, Australia) with each caerulein injection. M871 and SNAP-37889 were administered at 20 or 40 nmol kg−1 (n = 8–11 per group), whereas galantide was administered at 40 nmol kg−1 (n = 8 per group). The control groups (n = 4–6 per group) comprised of mice which received seven injections of saline, M871 or SNAP-37889 (both 20 and 40 nmol kg−1), or galantide (40 nmol kg−1) alone (in saline; total injection volume 0.15 mL). Stock solutions of the galantide and M871 were prepared in saline containing 0.01% bovine serum albumin (Sigma-Aldrich) and SNAP-37889 in saline.

Statistical analysis

The statistical analysis utilized SPSS (version 11.5; SPSS Inc., Chicago, IL, USA). All data are expressed as mean ± SEM of n number of animals or preparations. The data were analyzed using Kruskal–Wallis or Mann–Whitney tests, as appropriate. Statistical significance was accepted at the < 0.05 level.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgments
  9. Author contributions
  10. Competing interests
  11. Conflict of Interest
  12. References

GALR relative expression

The three GALRs are expressed in the mouse pancreas but their relative expression varies with the different cell types studied (Fig. 1). The expression of GALR3 was significantly higher than GALR1 and GALR2 in the whole pancreas (< 0.009) but the expression of GALR1 and GALR2 was not significantly different (Fig. 1A). In the isolated acinar cells, expression of GALR3 was also the highest of the three receptors (< 0.005; Fig. 1B) and there was no significant differences between the expression of GALR1 and GALR2. Islet cells also expressed the three GALR, but at comparable levels (P > 0.05; Fig. 1C). Western blot analysis demonstrated that isolated acinar cells express the three GALR proteins (Fig. 1D).

image

Figure 1.  The relative expression of galanin receptors (GALR) mRNA in mouse whole pancreas, isolated acinar and islets cells. The expression of the GALR mRNA is relative to that of the housekeeping gene. Panel A shows the relative expression of the GALR mRNA in whole pancreas. GALR3 mRNA shows the highest expression followed by GALR1 mRNA = GALR2 mRNA (n = 5). Panel B displays the relative expression of the GALR mRNA from isolated acinar cells. GAL3 mRNA shows the highest expression followed by GalR1 mRNA = GalR2 mRNA (n = 5). Panel C illustrates the relative expression of GALR mRNA from isolated islets cells. GALR mRNA 1, 2 and 3 are equally expressed. *< 0.05 compared with GALR1 and < 0.05 compared with GALR2). Absence of error bars indicates that the SEM was too small to illustrate. Panel D shows a representative image of a Western blot illustrating the expression of GALR1, 2 and 3 protein extracted from one sample of isolated acinar cells. Samples were run in triplicate.

Download figure to PowerPoint

In situ hybridization  To determine the localization of GALR mRNA within the mouse pancreas, in situ hybridization experiments were conducted using DIG-labeled probes. Hybridization signal representing GALR1 (Fig. 2A) and GALR2 (Fig. 2C) were observed in the islet cells while that for GALR3 was evident in islets and acinar cells (Fig. 2E,F). No signal was detected in the pancreas with the scramble probe (Fig. 2B,D). Mouse dorsal root ganglia were used as a positive control for GALR1 and GALR2 which produced positive signal (Fig. 2G,H).

image

Figure 2.  Representative images illustrating the localisation of galanin receptor (GALR) mRNA in the normal mouse pancreas by in situ hybridization. Panel A, the GALR1 probe produced patchy signal (*) from islet cells (IC) with no signal associated with acinar cells (AC). Panel B, the scramble probe failed to produce signal i.e. background. Panel C, shows signal (*) associated with IC incubated with the GALR2 probe. Panel D, the same large islet incubated with the scramble probe and no signal is evident. Panel E, both IC and AC generated signal (*) when incubated with the GALR3 probe. The signal appears stronger on the periphery of the islet (arrow). Panel F, both IC and AC generated signal with the GALR3 probe (*), but the IC signal appears weaker than generated by the AC. The wall of the vein (V) shows background signal equivalent to that associated with the scramble probe (not shown). Panels G & H, positive controls with signal (*) generated from mouse dorsal root ganglia (DRG) incubated with GALR1 and GALR2 probes, respectively (20× magnification).

Download figure to PowerPoint

Secretion studies  These studies were performed to determine if acinar cells have functional GALR involved in the regulation of amylase secretion. Amylase secretion from freshly isolated acinar cells was stimulated by caerulein in a concentration-dependent manner (< 0.05 compare with control; Fig. 3A). The peak amylase secretion was evoked with 10−10 mol L−1 caerulein and declined with higher concentrations of secretagogue. Galanin alone did not influence basal amylase secretion (Fig. 3B). Co-incubation with galanin did not modify supramaximal caerulein-stimulated amylase secretion from acinar cells (Fig. 3C).

image

Figure 3.  Effects of caerulein, galanin or combinations of both on amylase secretion from mouse pancreatic acinar cells. Caerulein-stimulated amylase secretion from isolated acinar cells in a concentration-dependent manner (panel A). Galanin did not influence basal amylase secretion from isolated acinar cells (panel B). Supramaximal caerulein (10−7 mol L−1) stimulated amylase secretion for acinar cells which was unaffected by the co-incubation with galanin (panel C). The dashed line indicates the control activity set to 100%. The dotted line (panel C) indicates the secretion due to caerulein (10−7 mol L−1) alone. *< 0.05 compared with control; < 0.05 compared with galanin (10−8 mol L−1) alone.

Download figure to PowerPoint

AP studies Treatment with M871 or galantide AP was successfully induced with caerulein injections. The AP-induced hyperamylasemia was reduced by approximately 40% by galantide treatment (< 0.05; Fig. 4A). In contrast, administration of M871 had no significant effect on AP-induced hyperamylasemia (Fig. 4A). The activity of plasma amylase following administration of the galanin antagonists alone were comparable with the activities following saline administration and not different for pretreatment activity.

image

Figure 4.  Effect of administration of M871 and galantide (GT) at induction of acute pancreatitis (AP) on AP-induced hyperamylasemia (panel A), pancreatic myeloperoxidase (MPO) activity (panel B) and pancreatic damage expressed as percentage of abnormal pancreatic acinar cells (panel C). A significant increase was noted in the amylase and MPO activity, as well as, in the number of abnormal acinar cells following the induction of AP. GT, but not M871, reduced the caerulein-induced hyperamylasemia. The activity of amylase in each group prior to AP induction (pretreatment) is depicted by the open bars. Treatment with GT and M871 (at the lower dose) at AP induction reduced the MPO activity compared with the activity in the AP-alone group. Only GT reduced the percentage of abnormal acinar cells, panel C. The control groups representing administration of GT, M871 or saline (vehicle) alone are shown. The dose of galanin antagonists administered (nmol kg−1), is indicated in parentheses. Data are expressed as IU L−1 for amylase and IU mg protein−1 for MPO activity. Data are presented as mean ± SEM (n = 8–11). Absence of error bars indicates that the SEM was too small to illustrate. *< 0.05 compared with AP alone.

Download figure to PowerPoint

Pancreatic MPO activity for the various groups is shown in Fig. 4B. As expected, the MPO activity in the AP group was significantly greater than the control groups. Treatment with galantide reduced the MPO activity by about 80% of that in the AP group (< 0.05). Treatment with M871 at 20 nmol kg−1 (but not 40 nmol kg−1) also significantly reduced the AP-induced MPO activity by about 65% (< 0.05). The MPO activity in the antagonist alone groups was not different from that in the saline control group.

The percentage of abnormal acinar cells induced by AP was reduced by approximately 80% following galantide treatment (< 0.05; Fig. 4C). In contrast, administration of M871 had no statistically significant effect on the percentage of AP-induced abnormal acinar cells.

The AP-induced pancreatic edema, as assessed by point counting, was not influenced by M871 treatment (data not shown), whereas galantide treatment reduced the point score from 14.04 ± 1.29 points 100 points−1 for the AP group to 7.86 ± 3.02 points 100 points−1 (< 0.05). The pancreatic edema in the galantide or M871 alone control groups were not statistically different from that in the saline control.

Treatment with SNAP-37889: The AP-induced hyperamylasemia was reduced by approximately 55–65% by treatment with SNAP-37889 (< 0.05; Fig. 5A). The activity of plasma amylase following administration of SNAP-37889 alone were comparable with the activities following saline administration and not different from pretreatment activity.

image

Figure 5.  Effect of administration of SNAP-37889 (SNAP) at induction of acute pancreatitis (AP) on AP-induced hyperamylasemia (panel A), pancreatic myeloperoxidase (MPO) activity (panel B) and pancreatic damage expressed as percentage of abnormal pancreatic acinar cells (panel C). A significant increase was noted in the amylase and MPO activity, as well as, in the number of abnormal acinar cells following the induction of AP. SNAP, at the low and high dose, reduced the caerulein-induced hyperamylasemia. The activity of amylase in each group prior to AP induction (pretreatment) is depicted by the open bars. Treatment with SNAP at the higher dose only reduced the MPO activity compared with the activity in the AP-alone group. Both doses of SNAP reduced the percentage of abnormal acinar cells, panel C. The control groups representing administration of SNAP or saline (vehicle) alone are shown. The doses of SNAP administered (nmol kg−1), is indicated in parentheses. Data are expressed as IU L−1 for amylase and IU mg protein−1 for MPO activity. Data are presented as mean ± SEM (n = 8–11). Absence of error bars indicates that the SEM was too small to illustrate. *< 0.05 compared with AP alone.

Download figure to PowerPoint

The pancreatic MPO activity induced by AP was also reduced by treatment with SNAP-37889 (Fig. 5B). Treatment with SNAP-37889 (40 nmol kg−1 but not 20 nmol kg−1) reduced the MPO activity by 60% of that in the AP group (< 0.05). The MPO activity in the antagonist alone groups was not different from that in the saline control group.

The percentage of abnormal acinar cells induced by AP was reduced by approximately 70% with SNAP-37889 treatment (< 0.05; Fig. 5C). The percentage of abnormal acinar cells in the SNAP-37889 alone control groups were not statistically different from that in the saline control.

The AP-induced pancreatic edema, as assessed by point counting (15.90 ± 1.13 points 100 points−1) was significantly reduced by SNAP-37889 treatment to 9.70 ± 1.11 and 5.86 ± 1.62 points 100 points−1 for the 20 and 40 nmol kg−1 doses, respectively. The pancreatic edema in the SNAP-37889 alone control groups were not statistically different from that in the saline control.

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgments
  9. Author contributions
  10. Competing interests
  11. Conflict of Interest
  12. References

Our previous studies have implicated galanin in the pathogenesis of AP.6,7 We have demonstrated in this report that the three known GALRs are expressed in the whole mouse pancreas, with the expression of GALR3 predominant. We have shown for the first time that islet and acinar cells express all three GALRs (mRNA and protein). In islet cells, the relative expression of mRNA for each GALR is similar whereas in acinar cells GALR3 relative expression is predominant. Our isolated acinar cells studies suggest that these GALR do not mediate amylase secretion. Using in situ hybridization, we have demonstrated that GALR3 mRNA is localized on the acinar and islets cells while GALR1 and 2 mRNA are localized on the islet cells alone. Further, our AP studies have demonstrated that treatment with SNAP-37889 significantly ameliorated all indices of AP measured, implicating a major role for GALR3. M871 treatment only reduced MPO activity, suggesting a role for GALR2 in the inflammatory response28 and its attendant neutrophil recruitment. Overall these data suggest that GALR3 may be a suitable, specific therapeutic target for the treatment of AP.

The development of a specific treatment for AP has been hampered by the complex nature of the disease. Previous attempts at targeting exocrine secretion or specific portions of the inflammatory cascade have not met with much success.29 Over the last few years, our laboratory has focussed on galanin and its effects in the pancreas. We have described some of the effects of galanin which may contribute to AP. Exogenous galanin was shown to decrease pancreatic vascular perfusion while galantide increased it.7 We demonstrated that the significant changes in vascular perfusion during induction of AP30 were also modified by exogenous galanin and galantide.9 Studies using murine pancreatic lobules showed that galanin influenced pancreatic exocrine secretion and that it could contribute to the development of AP by potentiating the hypersecretory stimulus of caerulein on acinar cells via the modulation of islet hormone release.18,19 This work was substantiated by findings that the severity of AP was reduced in galanin knock-out mice and additionally that treatment with galantide and M35 (another non-specific receptor antagonist) reduced the severity of AP.6,8,31 Recently, Schmidhuber et al.32 described an important role for galanin in neurogenic inflammation in the murine skin. Our data suggest a similar phenomenon may occur in the pancreas, indicative of a possible role for galanin in neurogenic inflammation, however, further studies are required to establish this.8,33

Peptide therapeutics is a growing field34 and the use of peptides for the treatment of AP has seen limited application. Peptides offer several advantages as therapeutic agents, particularly the potential for minimal central side-effects.34 However, given the widespread distribution and role played by galanin in the nervous and cardiovascular systems21,35 it is possible that despite its proven beneficial effect in AP, a non-specific receptor antagonist like galantide or M35 could have the potential for effects in other organs systems. Thus, it is pertinent to clarify the distribution of GALRs in the pancreas with an aim to identify a more specific therapeutic target for AP.

The molecular expression of GALR sub-types in the pancreas has received little attention and receptor localization studies have not been reported. GALR3 mRNA is expressed in human pancreas,36 and we previously established that the mouse pancreas expresses the three GALR sub-types with GALR3 the most highly expressed.37 This finding is in contrast to the murine brain and skin where GALR1 and GALR2 are the most highly expressed.28,38 Our current findings highlight for the first time the higher expression of GALR3 in pancreatic acinar cells and suggest that this is the major pancreatic GALR sub-type in normal pancreas. Interestingly, galanin modulates inflammatory edema formation via GALR3 in the mouse skin microvasculature.39 The significant reduction in pancreatic MPO activity in vivo using SNAP-37889 suggests that GALR3 is important for mediating galanin’s effects on inflammation in the pancreas, as well. Based on the available literature, potential sources of endogenous galanin include intrinsic and extrinsic pancreatic neurons, including sensory nerves10,11 and a sub-set of the islet cell population which have been reported in several species to be galanin immunoreactive.11,12

The finding that galanin failed to modulate amylase secretion from isolated acinar cells suggests that the GALR sub-types expressed by these cells are not involved in the regulation of amylase secretion. This finding is consistent with our previous studies that showed that galanin potentiated amylase secretion by regulating insulin and somatostatin release via the ‘islet-acinar axis.’19 The patchy in situ hybridization signal for GALR1 from the islets and the modest effect of the GALR2 antagonist in vivo indicate that GALR3 is probably the major receptor mediating galanin’s actions on exocrine secretion. The GALR expressed by acinar cells may be involved in the regulation of cell growth40,41 and/or secretory pathways different from amylase as observed in other cells of the gastrointestinal tract.42

The GALR sub-types which mediate the effects of galanin during AP were unclear, prior to this study. The data from the in vivo studies on the effectiveness of SNAP-37889 in ameliorating the indices of AP (including histological damage) confirms that GALR3 is the most important of the GALRs involved in AP. The potential benefits of such a finding are manifold. Firstly, our previous studies with galanin, suggest that it is involved in multiple steps in the pathogenetic pathway of AP.6,7,19 Additionally, some of its actions may be interlinked with several other previously recognized mechanisms in the pathogenesis of AP, viz. neurogenic inflammation,8 neutrophil recruitment and activation,33 somatostatin’s inhibitory effect on pancreatic exocrine secretion19,43 and inhibition of bicarbonate secretion.44 Thus, antagonism of galanin’s actions, which are wide ranging, affords targeting multiple sites of action in AP rather than individual sites of action. In our view, this represents a more realistic approach to developing a therapy for AP. Secondly, the benefit of identifying a therapeutic agent with a specific target site (i.e. GALR3) has the potential to reduce the extra-pancreatic effects that may be encountered with a non-specific receptor antagonist. While these findings are promising, further studies are needed to test such a molecule in higher vertebrates and in other models of AP before progressing towards the development of a safe molecule for clinical use.

Conclusions

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgments
  9. Author contributions
  10. Competing interests
  11. Conflict of Interest
  12. References

In conclusion, our data demonstrate for the first time the distribution of GALRs in the murine pancreas and supports our previous findings that the effect of galanin on hyperstimulated pancreatic exocrine secretion is mediated via islet hormones. The findings of this study also implicate the GALR3 sub-type as the major GALR involved in the induction and progression of caerulein-induced AP in mice. A minor role for the GALR2 sub-type is also evident. Overall these data present for the first time GALR3 as a potential target for therapy in AP aimed at targeting multiple steps in the pathogenesis.

Acknowledgments

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgments
  9. Author contributions
  10. Competing interests
  11. Conflict of Interest
  12. References

This work was supported by grants in aid from BioInnovation SA, Flinders Partners and the Cancer Council of South Australia. The authors wish to acknowledge J Kazenwadel, N Harvey and E Paterson from the Centre for Cancer Biology, Institute of Medical and Veterinary Sciences, Adelaide, South Australia who contributed to the development of the in situ hybridization protocol used in the experiments reported here. The authors thank R Haberberger and M Michael for advice on the in situ hybridization studies. The authors also wish to thank Sunil Tam Tam for supplying the dorsal root ganglia used in the in situ hybridization experiments. Finally, the authors are greatly indebted to UE Sollenberg and LA Blackshaw for the generous gift of M871 and SNAP-37889, respectively.

Author contributions

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgments
  9. Author contributions
  10. Competing interests
  11. Conflict of Interest
  12. References

SGB was involved in conception, design, analysis and interpretation of data; development and conduct of the in situ hybridization studies; drafting the article, critical revision of the manuscript for important intellectual content; MB was involved in drafting of the manuscript, conduct, analysis and interpretation of molecular studies and acinar cell studies; MZ was involved in conduct of experiments, acquisition of data, analysis and interpretation of data relating to M871; DJH was involved in conception and design of the study, design of the probes used for molecular and in situ hybridization studies, drafting of the manuscript, study supervision, critical revision of the manuscript for important intellectual content; OAS was involved in conduct of experiments, acquisition of data, analysis and interpretation of Western blot analysis; HP was involved in preparation of isolated islet cells, analysis and interpretation of data and drafting the manuscript; ML was involved in analysis and interpretation of molecular data; DJK was involved in conception and design of the isolated islets cell experiments, drafting of the manuscript, study supervision; ACS was involved in conduct of studies relating to galantide and SNAP-37889, analysis and interpretation of data; CJC was involved in conception and design of all aspects of the study, critical revision of the manuscript for important intellectual content; CS was involved in design of the study, development of the in situ hybridization protocol, conduct of the in situ hybridization studies and analysis of data; JT was involved in conception and design of all aspects of the study, critical revision of the manuscript for important intellectual content; GTPS was involved in conception and design of all aspects of the study, study supervision, conduct of studies relating to SNAP-37889, drafting of the manuscript, critical revision of the manuscript for important intellectual content.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Materials and methods
  5. Results
  6. Discussion
  7. Conclusions
  8. Acknowledgments
  9. Author contributions
  10. Competing interests
  11. Conflict of Interest
  12. References
  • 1
    Barreto SG, Rodrigues J. Comparison of APACHE II and Imrie Scoring Systems in predicting the severity of acute pancreatitis. World J Emerg Surg 2007; 2: 33.
  • 2
    Barreto SG, Rodrigues J. Acute pancreatitis in Goa – a hospital-based study. J Indian Med Assoc 2008; 106: 5756.
  • 3
    Lund H, Tonnesen H, Tonnesen MH, Olsen O. Long-term recurrence and death rates after acute pancreatitis. Scand J Gastroenterol 2006; 41: 2348.
  • 4
    Williams M, Simms HH. Prognostic usefulness of scoring systems in critically ill patients with severe acute pancreatitis. Crit Care Med 1999; 27: 9017.
  • 5
    Tatemoto K, Rokaeus A, Jornvall H, McDonald TJ, Mutt V. Galanin – a novel biologically active peptide from porcine intestine. FEBS Lett 1983; 164: 1248.
  • 6
    Bhandari M, Thomas AC, Hussey DJ et al. Galanin mediates the pathogenesis of cerulein-induced acute pancreatitis in the mouse. Pancreas 2010; 39: 1827.
  • 7
    Brooke-Smith ME, Carati CJ, Bhandari M, Toouli J, Saccone GT. Galanin in the regulation of pancreatic vascular perfusion. Pancreas 2008; 36: 26773.
  • 8
    Barreto SG, Carati CJ, Schloithe AC, Toouli J, Saccone GT. The combination of neurokinin-1 and galanin receptor antagonists ameliorates caerulein-induced acute pancreatitis in mice. Peptides 2010; 31: 31521.
  • 9
    Bhandari M, Thomas A, Carati C, Kawamoto M, Toouli J, Saccone G. Galanin antagonism modifies hyperenzymemia and pancreatic vascular perfusion (PVP) changes induced by acute pancreatitis (AP) in a possum model. Pancreas 2006; 33: 4478.
  • 10
    Messell T, Harling H, Bottcher G, Johnsen AH, Holst JJ. Galanin in the porcine pancreas. Regul Pept 1990; 28: 16176.
  • 11
    Adeghate E, Ponery AS. Large reduction in the number of galanin-immunoreactive cells in pancreatic islets of diabetic rats. J Neuroendocrinol 2001; 13: 70610.
  • 12
    Baltazar ET, Kitamura N, Hondo E, Narreto EC, Yamada J. Galanin-like immunoreactive endocrine cells in bovine pancreas. J Anat 2000; 196(Pt 2): 28591.
  • 13
    Barreto SG, Carati CJ, Toouli J, Saccone GT. The islet-acinar axis of the pancreas: more than just insulin. Am J Physiol Gastrointest Liver Physiol 2010; 299: G1022.
  • 14
    Ahren B, Andren-Sandberg A, Nilsson A. Galanin inhibits amylase secretion from isolated rat pancreatic acini. Pancreas 1988; 3: 55962.
  • 15
    Flowe KM, Lally KM, Mulholland MW. Galanin inhibits rat pancreatic amylase release via cholinergic suppression. Peptides 1992; 13: 48792.
  • 16
    Herzig KH, Brunke G, Schon I, Schaffer M, Folsch UR. Mechanism of galanin’s inhibitory action on pancreatic enzyme secretion: modulation of cholinergic transmission – studies vivo and in vitro. Gut 1993; 34: 161621.
  • 17
    Runzi M, Muller MK, Schmid P, von Schonfeld J, Goebell H. Stimulatory and inhibitory effects of galanin on exocrine and endocrine rat pancreas. Pancreas 1992; 7: 61923.
  • 18
    Barreto SG, Woods CM, Carati CJ et al. Galanin inhibits caerulein-stimulated pancreatic amylase secretion via cholinergic nerves and insulin. Am J Physiol Gastrointest Liver Physiol 2009; 297: G3339.
  • 19
    Barreto SG, Carati CJ, Schloithe AC, Toouli J, Saccone GT. Galanin potentiates supramaximal caerulein-stimulated pancreatic amylase secretion via its action on somatostatin secretion. Am J Physiol Gastrointest Liver Physiol 2009; 297: G126873.
  • 20
    Bartfai T, Langel U, Bedecs K et al. Galanin-receptor ligand M40 peptide distinguishes between putative galanin-receptor subtypes. Proc Natl Acad Sci U S A 1993; 90: 1128791.
  • 21
    Merchenthaler I, Lopez FJ, Negro-Vilar A. Colocalization of galanin and luteinizing hormone-releasing hormone in a subset of preoptic hypothalamic neurons: anatomical and functional correlates. Proc Natl Acad Sci USA 1990; 87: 632630.
  • 22
    Habert-Ortoli E, Amiranoff B, Loquet I, Laburthe M, Mayaux JF. Molecular cloning of a functional human galanin receptor. Proc Natl Acad Sci USA 1994; 91: 97803.
  • 23
    Sollenberg U, Lundstrom L, Bartfai T, Langel U. M871 – a novel peptide antagonist selectively recognizing the galanin receptor type 2. Int J Pept Res Ther 2006; 12: 1159.
  • 24
    Swanson CJ, Blackburn TP, Zhang X et al. Anxiolytic- and antidepressant-like profiles of the galanin-3 receptor (Gal3) antagonists SNAP 37889 and SNAP 398299. Proc Natl Acad Sci USA 2005; 102: 1748994.
  • 25
    Rifai Y, Elder AS, Carati CJ et al. The tripeptide analog feG ameliorates severity of acute pancreatitis in a caerulein mouse model. Am J Physiol Gastrointest Liver Physiol 2008; 294: G10949.
  • 26
    Nuovo GJ, Elton TS, Nana-Sinkam P, Volinia S, Croce CM, Schmittgen TD. A methodology for the combined in situ analyses of the precursor and mature forms of microRNAs and correlation with their putative targets. Nat Protoc 2009; 4: 10715.
  • 27
    Moore-Olufemi SD, Xue H, Attuwaybi BO et al. Resuscitation-induced gut edema and intestinal dysfunction. J Trauma 2005; 58: 26470.
  • 28
    Schmidhuber SM, Santic R, Tam CW, Bauer JW, Kofler B, Brain SD. Galanin-like peptides exert potent vasoactive functions in vivo. J Invest Dermatol 2007; 127: 71621.
  • 29
    Bang UC, Semb S, Nojgaard C, Bendtsen F. Pharmacological approach to acute pancreatitis. World J Gastroenterol 2008; 14: 296876.
  • 30
    Brooke-Smith M, Sandstrom P, Carati C, Thomas A, Toouli J, Saccone G. Necrosis and reduced vascular perfusion in models of moderate and severe acute pancreatitis. Pancreatology 2003; 3: 261.
  • 31
    Kawamoto M, Bhandari M, Thomas A, Carati C, Toouli J, Saccone G. The galanin antagonists galantide and M35 but not M40 ameliorate caerulein-induced acute pancreatitis in mice. Pancreatology 2007; 7: 231.
  • 32
    Schmidhuber SM, Starr A, Wynick D, Kofler B, Brain SD. Targeted disruption of the galanin gene attenuates inflammatory responses in murine skin. J Mol Neurosci 2008; 34: 14955.
  • 33
    Barreto S, Carati C, Schloithe A et al. The efficacy of combining feG and galantide in mild caerulein-induced acute pancreatitis in mice. Peptides 2010; 31: 107682.
  • 34
    McGregor DP. Discovering and improving novel peptide therapeutics. Curr Opin Pharmacol 2008; 8: 6169.
  • 35
    Diaz-Cabiale Z, Parrado C, Vela C et al. Role of galanin and galanin(1-15) on central cardiovascular control. Neuropeptides 2005; 39: 18590.
  • 36
    Kolakowski LF Jr, O’Neill GP, Howard AD et al. Molecular characterization and expression of cloned human galanin receptors GALR2 and GALR3. J Neurochem 1998; 71: 223951.
  • 37
    Li X, Hussey D, Mayne G et al. Galanin receptors 1, 2 and 3 are expressed in the normal mouse pancreas. Pancreatology 2007; 7: 230.
  • 38
    Branchek T, Smith KE, Walker MW. Molecular biology and pharmacology of galanin receptors. Ann NY Acad Sci 1998; 863: 94107.
  • 39
    Schmidhuber SM, Rauch I, Kofler B, Brain SD. Evidence that the modulatory effect of galanin on inflammatory edema formation is mediated by the galanin receptor 3 in the murine microvasculature. J Mol Neurosci 2009; 37: 17781.
  • 40
    Trejter M, Brelinska R, Warchol JB et al. Effects of galanin on proliferation and apoptosis of immature rat thymocytes. Int J Mol Med 2002; 10: 1836.
  • 41
    Kanazawa T, Kommareddi PK, Iwashita T et al. Galanin receptor subtype 2 suppresses cell proliferation and induces apoptosis in p53 mutant head and neck cancer cells. Clin Cancer Res 2009; 15: 222230.
  • 42
    Bjorkqvist M, Bernsand M, Eliasson L, Hakanson R, Lindstrom E. Somatostatin, misoprostol and galanin inhibit gastrin- and PACAP-stimulated secretion of histamine and pancreastatin from ECL cells by blocking specific Ca2+ channels. Regul Pept 2005; 130: 8190.
  • 43
    Barreto SG, Carati CJ, Schloithe AC, Toouli J, Saccone GT. Octreotide negates the benefit of galantide when used in the treatment of caerulein-induced acute pancreatitis in mice. HPB (Oxford) 2010; 12: 40311.
  • 44
    Brodish RJ, Kuvshinoff BW, Fink AS, McFadden DW. Inhibition of pancreatic exocrine secretion by galanin. Pancreas 1994; 9: 297303.