SEARCH

SEARCH BY CITATION

Keywords:

  • inflammation;
  • irritable bowel syndrome;
  • mast cells;
  • protease activated receptors

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Method
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Author Contributions
  9. References

Background  Growing evidence suggests that protease activated receptors (PARs) are mediators of persistent neuropathic pain, but their possible function as mediators in patients with post infectious irritable bowel syndrome (PI-IBS) remains to be further explored. This article aims to investigate the expression of PAR2 and PAR4 in the colonic mucosa of patients with PI-IBS, focusing on correlation with mast cell activation status.

Methods  A total of 17 normal controls and 23 patients with PI-IBS volunteered the study. The expression and localization of PAR2 and PAR4 were investigated by RT-PCR and immunohistochemistry, and the expression of PAR2 and PAR4 in the mast cells was examined using double-immunofluorescence staining.

Key Results  The immunohistochemical study revealed that epithelial and submucosal cells showed immunoreactivity for both PAR2 and PAR4. Protease activated receptor 4 mRNA expression and immunoreactivity were down-regulated in PI-IBS compared with the control group. Specifically, a reduced immunoreactivity for PAR4 was observed in mast cells of PI-IBS compared with normal controls, whereas there are no significant differences shown in PAR2 between the PI-IBS and the control group. It is also found that the PAR4 immunoreactivity decreases, while the activity of mast cells increases in PI-IBS rather than normal controls.

Conclusions & Inferences  This study outlines the down-regulation of PAR4 in the mast cells of PI-IBS. It could be of considerable interests in understanding the mechanisms involved in the persistent colonic hypersensitivity and their potential role as therapeutic targets for PI-IBS.


Abbreviations:
PARs

protease activated receptors

PI-IBS

post infectious irritable bowel syndrome

Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Method
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Author Contributions
  9. References

A recent systematic review and meta-analysis demonstrates that the risk of developing irritable bowel syndrome (IBS) increases sixfold along with gastrointestinal infection, this phenomenon is known as post infectious IBS (PI-IBS).1,2 After the resolution of the acute infection, patients with PI-IBS appear to have chronic mucosal immunologic disregulation with altered intestinal permeability and motility that can lead to persistent visceral hypersensitivity.3–5 However, our understanding of the maintenance mechanisms of peripheral and/or central sensitization remains limited in PI-IBS.1,6,7

Peripheral sensitization is manifested by nociceptors, which means that they do not only respond more vigorously to a suprathreshold stimulus but also require lowered threshold. Protease activated receptors (PARs) are highly expressed throughout the gastrointestinal tract, and numerous studies have been postulated to play a role in mediating visceral hypersensitivity.8,9 Agonists of PARs can signal to spinal afferent neurons to cause persistent neurogenic inflammation and hyperalgesia by unknown mechanisms.10,11 Protease activated receptors can also regulate intestinal permeability.12,13 Together, these results indicate that PARs is an important regulator of immune and inflammatory responses in the intestines. This family of seven transmembrane G protein coupled receptors currently includes four receptor subtypes (PAR1, PAR2, PAR3, PAR4).14 Recent studies demonstrated that PAR2 and PAR4 represented new roles in the modulation of visceral nociception.8,15 Therefore, a better understanding is needed on how expression and location of PAR2 and PAR4 in the colons of PI-IBS patients may contribute to the pathological conditions.

Although Northern-blot analysis has shown that mRNA for PAR2 and PAR4 are existing in small and large human intestines,16–18 the physiological role played by PARs in the gastrointestinal tract has to be further elucidated. Recent studies suggest that mast cells exert a key role in participating in the regulation of intestinal motility, visceral sensitivity, and mucosal and epithelial gut barrier function. Moreover, increasing number of activated mast cells and mast cell products have been found and described in IBS patients, but long-term changes in the excitability following mast cell degranulation have not been studied systematically.19–21 Protease activated receptors is highly expressed in the gastrointestinal tracts, where epithelial cells, mast cells and enteric neurons are localized. Various in vitro and in vivo investigations of different species suggest a functional role of PARs in mast cells and also a trigger or amplifier of the degranulation.22 However, the evidence of the expression and/or function of PARs in mast cells was lacking in IBS patients.

The present study is designed to investigate whether PAR2 and PAR4 are existing in PI-IBS patients’ colons and whether they affect mast cell functioning. The aims of this study are: (i) to examine the expression and location of PAR2 and PAR4 in the colons of PI-IBS; (ii) to examine the expression of PAR2 and PAR4 in mast cells of the colon, specifically, the possible involvement of mechanisms about long-term changes in mast cell activation.

Method

  1. Top of page
  2. Abstract
  3. Introduction
  4. Method
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Author Contributions
  9. References

Subjects

Subjects were recruited through the local advertisement and participated in the study after signing the written consent form provided. The sample consisted of 23 patients (14 men, 9 women) who met the Rome III criteria for PI-IBS was seen in the Department of Gastroenterology of Qilu Hospital of Shandong University. In addition, 17 normal controls (9 men, 8 women) were recruited by the public advertisements followed by a thorough exclusion of gastrointestinal symptoms. The median (range) ages of patients and controls were 36 years old (18–59) and 39 years old (19–50), respectively. Post infectious irritable bowel syndrome is diagnosed on the basis of the onset of acute symptoms meeting diagnostic criteria for IBS (with Rome III criteria being the most recently defined) followed by an episode of acute infectious gastroenteritis characterized by two of the following symptoms and findings: fever, vomiting, diarrhea, and a positive stool culture result. However, patients should not meet the diagnostic criteria for IBS prior to the acute illnesses.23,24 All subjects were physically healthy, which is evaluated through medical history, physical examination, electrocardiogram, vital signs, and routine laboratory tests including the thyroid function test. None of the subjects were taking medications during the study or had any organic syndromes, including food allergy, coeliac disease, atopy, and severe clinical depression or anxiety. Furthermore, PI-IBS patients were asked to stop all drugs for their bowel symptoms 48 h before the challenge. They all signed the written consent form. The study was approved by the local Ethical Committees and conducted in accordance with the Declaration of Helsinki.

Tissue preparation

A left colonoscopy without sedation was performed on participants. Four different kinds of biopsies were conducted on each of the participant. The first one was for routine H&E histology to exclude the presence of microscopic colitis, the second one was for RT-PCR, the third one was prepared to determine the tryptase concentration by enzyme-linked immunosorbent assay (ELISA), and the last one was immediately placed in 10% formalin for immunohistochemistry and double-immunofluorescence staining. In this way, the materials for mRNA characterization and immunohistochemistry could not be obtained from the same biopsy.

RNA isolation and RT-PCR

Total RNA was extracted from cells using Trizol (GIBCO BRL) according to the manufacturer’s instructions. Complementary DNA was then synthesized from total RNA primed with oligo (dT) using reverse Transcriptase M-MLV (Takara Bio, Dalian, China) at 42° C for 1 h. The RT-PCR analysis was carried out using 1 μL of the cDNA products. The primer sequences for PAR2 were: forward, TGGATGAGTTTTCTGCATCTGTCC; reverse, CGTGATGTTCAGGGCAGGAATG; the product size, 491 bp; for PAR4 were: forward, AACCTCTATGGTGCCTACGTGC; reverse, CCAAGCCCAGCTAATTTTTG; the product size, 541 bp. The PCR was performed in a 50 μL volume containing a final concentration of 1 mmol L−1 primers, 200 mmol L−1 dNTPs and 1.25 u Taq polymerase (MBI Fermentas, Shenzhen, China). Cycling parameters were followed: for PAR2: 10 min at 94 ° C, followed by 30 cycles of 45 s at 94° C, 45 s at 60° C, 45 s at 72° C, and finally a 5-min extension step at 72° C; for PAR4: 3 min at 95° C, followed by 33 cycles of 30 s at 95° C, 30 s at 62° C, 30 s at 72° C, and finally a 5-min extension step at 72° C. The PCR products were electrophoresed on 1.5% agarose gels and visualized by ethidium bromide staining.25,26

Tryptase measurement

For all participants, colonic mucosa were rapidly immersed in hard plastic tubes containing 1 mL of Hank’s buffer saline solution (HBSS), and continuously oxygenated (95% O2/5% CO2) at 37° C. After 20-min incubation, the solution was removed and centrifuged at 200 g for 10 min before being filtered with centrifuge tube filters to remove bacterial components. Biopsies were blotted and weighted after collecting the SUP. The tryptase concentration of colonic mucosa cultured supernatants were determined by ELISA.

Immunohistochemistry

As primary antibodies, rabbit polyclonal IgG PAR2 (Santa Cruz Biotechnology, Santa Cruz, CA, USA, working dilution 1 : 100) and rabbit polyclonal IgG PAR4 (Santa Cruz Biotechnology, working dilution 1 : 100) were used and rabbit Immuno staining system (sc-2051, Santa Cruz Biotechnology) was used as the staining system. The sections were cut (4 μm), dried for 2 h at 60° C, and then dewaxed in xylene and rehydrated in a descending ethanol series. Microwave-induced epitope retrieval techniques were used for antigen retrieval as follows: Place slides in citrate buffer (pH 6.0) and in a microwave oven at 120 °C and 60 °C for 20 min. Leave the sections stand at room temperature to cool. Sections were incubated for 10 min in 3% hydrogen peroxide to quench endogenous tissue peroxidase. The sections were then washed with phosphate-buffered saline (PBS) and incubated with 10% normal goat serum for 10 min to reduce non-specific staining. The specimens were incubated with the respective primary antibodies in a moist chamber overnight at 4 °C. The specimens were washed with PBS and incubated in a secondary antibody for 30 min at 37 °C. The sections were washed three times in PBS and incubated with the DAB reagent for 5 min at room temperature (controlled the stain under the microscope). The sections were washed with water to end the reaction. Finally, the sections were counterstained with the hematoxylin, cleared in alcohol and xylene and mounted. As the negative control, incubation with the primary antibody and blocking peptide was omitted. An Olympus B × 40 light microscope connected to an Olympus DP71 digital camera (Olympus Company, Tokyo, Japan) was used to capture images from immunohistochemical staining. At least eight individual 40× fields per group were captured for counting. The number of cells expressing PAR2 or PAR4 in that subset was counted with Image Pro Plus 5.0 software. The number of positively stained cell was expressed as a percentage of the total number of cells.

Double immunofluorescence

Before use the fluorescent antibody, the specimen processing steps are same as immunohistochemistry. The specimens were then incubated with mast cell tryptase Ab-2 (mouse monoclonal antibody; Thermo Fisher Scientific, Rockford, IL, USA) at 1 : 400 dilution at 4° C in a moist chamber overnight. The specimens were washed with PBS and incubated in a Rhodamine (TRITC)-conjugated AffiniPure Goat Anti-Mouse IgG (Sigma-Aldrich, St-Louis, MO, USA, working dilution 1 : 100) for 1 h at 37° C in the dark. The sections were then washed with PBS three times and incubated with the other primary antibodies, rabbit polyclonal IgG PAR at 1 : 100 dilution at 4° C in a moist chamber overnight. Subsequently, the specimens were washed three times in PBS, and immunol Fluorence Staining Kit with FITC-Labeled Goat Anti-Rabbit IgG (Sigma, working dilution 1 : 100) was used for 1 h at 37° C in the darkness. Specimens were then washed three times with PBS and covered with cover slides with VECTASHIELD Mounting Medium containing DAPI, at last examined immediately under Olympus I × 71 fluorescence microscope connected to a Olympus DP71 digital camera (Olympus Company) at appropriate wavelengths. At least eight individual 60× fields per sample were captured for counting with Image Pro Plus 5.0 software. The number of mast cells expressing PAR2 and PAR4 was counted as a percentage of the total number of mast cells. The area of mast cells was counted with Image Pro Plus 5.0 software.

Statistical analysis

For each studied parameter, data were expressed as mean ± SD. Statistical analyses were performed by Student’s t-test. A probability level less than 0.05 was considered statistically significant.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Method
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Author Contributions
  9. References

Expression and location of PAR2 and PAR4 in colon of PI-IBS

A PCR product corresponding to the predicted size of the PAR2 and PAR4 signal was amplified from RNA prepared from the colon, showing the presence of PAR2 and PAR4 in those tissues. The expression of PAR2 mRNA, in relation to β-actin, was 4.317 ± 0.154 in controls, and 5.027 ± 0.126 in patients, whereas the expression of PAR4 mRNA, in relation to β-actin, was 5.528 ± 0.153 in controls, and 3.406 ± 0.172 in patients. Protease activated receptor 4 mRNA expression significantly decreased in PI-IBS compared with the control group (P < 0.05). In contrast, there is no significant difference between normal controls and patients in terms of PAR2 (Fig. 1).

image

Figure 1.  Gel electrophoresis of PAR2 (picture A), and PAR4 (picture B) reverse transcription-polymerase chain reaction products in colon tissue. Marker: 100 bp DNA ladder; β-actin: 268 bp; PAR2: 491 bp; PAR4: 541 bp. PAR4 mRNA expression significantly decreased in PI-IBS compared with the control group (< 0.05), whereas PAR2 was not significantly different compared with the control group.

Download figure to PowerPoint

Immunohistochemistry revealed that PAR2 and PAR4 protein were expressed on epithelial surfaces and submucosa. The total immunoreactivity for PAR2, in relation to the area of mucosal tissue, was 13.765 ± 5.426 in controls and 14.609 ± 6.111 in PI-IBS patients. Immunoreactivity for PAR4 was 11.529 ± 4.679 in controls and 8.739 ± 3.744 in patients. There was a decrease in PAR4 immunoreactivity in PI-IBS (P < 0.05). Protease activated receptor 2 immunoreactivity was not significantly different in PI-IBS compared with the control group. Furthermore, distribution pattern of PAR2 and PAR4 in colon was of no significant difference between normal control and PI-IBS (Fig. 2).

image

Figure 2.  Representative immunostaining for the PAR2 in paraffin sections of normal colonic mucosa (A) and colonic tissues from patients with PI-IBS (B): PAR2 immunoreactivity was not significantly different compared with the control group. Representative immunostaining for the PAR4 in paraffin sections of normal colonic mucosa (C) and colonic tissues from patients with PI-IBS (D): Immunoreactivity for PAR4 significantly decreased in mast cells of PI-IBS compared with normal controls. (DAB, Original magnification ×400). In these colonic paraffin sections, clear immunoreactivity of PARs was presented in the epithelial and submucosal cells.

Download figure to PowerPoint

Number and activity of mast cells in colon of PI-IBS

The presence of mast cells was investigated in the biopsy samples of both groups. The immunoreactivity for mast cell tryptase was examined by immunofluorescence staining. There were no significant differences in the number of mast cells (PI-IBS: 6.141 ± 1.490 cells & normal controls: 5.172 ± 1.245). However, the number of activated mast cells increased in PI-IBS (PI-IBS: 2.832 ± 1.186 cells & normal controls: 1.537 ± 0.578) (P < 0.01). The tryptase concentration of colonic mucosa cultured supernatants in PI-IBS patients (10.415 ± 2.102 ng mL−1) was higher than that in controls (7.024 ± 1.743 ng mL−1), the difference was statistically significant (P < 0.01). A significant increase in the area of mast cells was also observed in tissues from PI-IBS patients compared with normal controls, with a 1.58 fold increase (< 0.01) (Fig. 3).

image

Figure 3.  A significant increase in the area of mast cells (tryptase positively stained cell) was observed in tissues from PI-IBS patients compared with normal controls, with a 1.58-fold increase (< 0.01) (A). The concentration of tryptase in the colonic mucosa of PI-IBS patients also increased significantly (P < 0.01) (B).

Download figure to PowerPoint

Expression of PAR2 and PAR4 in mast cells of colon

To clarify the PAR2 and PAR4 status of mast cells, double immunofluorescence staining was performed. The majority of mast cells expressed PAR2 and PAR4. Immunoreactivity for PAR4 significantly decreased in mast cells of PI-IBS (53.696 ± 12.452) compared with the normal controls (67.706 ± 12.479) (P < 0.05), whereas PAR2 was not significantly different compared with the control group (Fig. 4).

image

Figure 4.  Immunofluorescence staining showed mast cells (red), immunofluorescence staining showed PARs positive cells (green) on epithelial surfaces and submucosa, double immunofluorescence staining showed that some mast cells were immunoreactive for PAR (yellow). Immunofluorescent determination of mast cells degranulation was shown, a significant increase in tryptase expression area was observed in tissues from PI-IBS patients(B, D) compared with normal controls (A, C). A reduced immunoreactivity for PAR4 was determined in mast cells of PI-IBS (D) compared with normal controls (P < 0.05) (C), whereas PAR2 was not significantly different compared with the control group (A and B). (Scale bars 25 μm, Magnification ×600).

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Method
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Author Contributions
  9. References

In this study, RT-PCR and immunohistochemistry were used to clarify that PAR2 and PAR4 were present in the colonic mucosa of patients with PI-IBS. Subsequently, PAR2 and PAR4 status of mast cells in PI-IBS was also examined. The results described here provide the first evidence that immunoreactivity for PAR4, but not for PAR2, significantly changes in mast cells of PI-IBS compared with the normal controls.

As intestinal inflammation is associated with the generation and release of proteases that are potential activators of PARs, there have been considerable interests in the role of PARs in inflammatory diseases of the intestine, where proteases from the circulation, inflammatory cells, and the intestinal lumen could alter neuronal excitability and induce alterations in motility, secretion, and pain perception.27,28 These studies about PARs have important implications for the pathophysiology of PI-IBS, especially in the maintenance mechanisms of visceral hypersensitivity after gastrointestinal infection. However, the information on the localization of PARs in intestinal tissue is lacking in PI-IBS.29 We found a clear expression of both PAR2 and PAR4 in normal human intestine and PI-IBS patients. Furthermore, location studies in the intestines showed the highest concentrations of PARs were also expressed in the human intestinal submucosa apart from their existences in the human intestinal mucosa. However, it is yet unknown what is the function of PARs in this intestinal compartment. It could be assumed that PARs plays a role in a wide range of processes including endothelial cell functions, platelet activation and homeostasis, somatic and visceral nociceptive response, and gastrointestinal functions, such as intestinal motility and inflammatory response.30–32 It is therefore important to obtain the information about PARs expression and distribution in human intestines. In our study, PAR2 mRNA expression and immunoreactivity did not show significant differences between PI-IBS and the control group, while PAR4 expression significantly decreased in PI-IBS. No major changes in the PARs expression pattern were seen. There was also no relation with the grade of symptom. These data suggested PAR4 might play a new role in the modulation of visceral nociception in PI-IBS. Some recent studies have reported that the PAR4 agonist had antinociceptive effects.8,33,34 Augéet al. provided the evidence for a role of PAR4 agonists modulate colonic nociceptive response, intracolonic administration of the PAR4 agonist, was able to significantly inhibit PAR2 agonist- and transient receptor potential vanilloid-4 (TRPV4) agonist-induced allodynia and hyperalgesia in response to colorectal distension. The role of endogenous PAR4 in visceral pain processing was also confirmed using PAR4 deficient mice, which exhibited increased nociceptive behaviors in response to intracolonic administration of mustard oil compared to controls.8,35 Although the underlying mechanism has not been established, PAR4 activation by cathepsin G can exert the antinociceptive effect by participating in the regulation of intestinal permeability, visceral sensitivity, and possible micro-inflammation in the mucosa of IBS patients.36 Moreover, Asfaha et al. showed that PAR4 was expressed in sensory neurons isolated from the DRG that expressed the sensory neuropeptides CGRP and SP, and the PAR4 agonist reduced the calcium signal of DRG neurons in response to KCl, suggesting that PAR4 activation could inhibit the nociceptive signal in DRG neurons.33 In our studies, PAR2 was not significantly different in PI-IBS compared with the control group. The result is not in accordance with the concept that PAR2 represents an important receptor mediating the symptoms of IBS.12,15,37,38 The difference between the conflicting results may be attributed to the different counting methods or the use of animal species.

Trypsin, tryptase, and PARs AP evoke transient depolarization of submucosal neurons followed by a prolonged hyperexcitability that can last for several hours.39 This remarkable long-term hyperexcitability also can be observed after degranulation of mast cells.40,41 So, we did a further experiment to obtain the information about PARs expression and distribution in mast cells. In our study, we did not find an increase in the number of mast cells present in the biopsies from controls or PI-IBS patients, but we detected a significant increase in the activity of mast cells in PI-IBS compared with control biopsies. It suggests that more mast cells are actively degranulating in tissues of IBS patients than the normal control group, which is consistent with the study done by Cenac et al.37 Tryptase could be in direct contact with enteric or primary afferent nerves, and induce hyperexcitability.19,22,42 Thus, activated mast cells induce long-term excitability of submucosal neurons. As the expression of PARs on mast cells has not been investigated, possible physiological/pathophysiological roles for PAR2 and PAR4 in mast cells degranulation are poorly understood. Using double immunofluorescence technique, we confirmed a clear expression of both PAR2 and PAR4 on mast cells. Our study showed that immunoreactivity for PAR4 significantly decreased in mast cells of PI-IBS, it is also found that the PAR4 immunoreactivity decreases followed by the increase in the activity of mast cells in PI-IBS rather than normal controls. Whereas, PAR2 was not significantly different in PI-IBS compared with the control group. The present results highlight PAR4 may be another potential endogenous suppressor to visceral hypersensitivity in PI-IBS. By and large, a hypothesis is proposed: gastrointestinal infection may induce mast cell activation, while mast cell induced visceral hypersensitivity is mediated by a mechanism involving the activation of the PARs pathway; PARs might further change the release of a range of mediators by mast cells contributing to the persistent sensitization of nociceptors and increased intestinal permeability. Although there is no direct evidence supporting this hypothesis, the demonstration of such a relationship may have important implications for understanding the maintenance mechanisms of peripheral sensitization in PI-IBS.

Reverse transcriptase polymerase chain reaction and immunohistochemical techniques are used to demonstrate the distribution of PAR2 and PAR4 in human colons. The newly discovered role of PAR4 in modulating visceral pain develops our growing understanding of the colonic hypersensitivity and their potential role as therapeutic targets for PI-IBS. Further studies have to be done to obtain more detailed information about the precise role of the PARs on the gastrointestinal epithelia function.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Method
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Author Contributions
  9. References

The study was granted and supported by National Natural Science Foundation of China (No. 30700358). It was also supported by Outstanding Youth scientist research Foundation of Shandong Province (No. 2007BS03044). The authors acknowledge the following individuals for their contributions: Yu Yanxia, Jia Xiaoqing and Liu Xiaoqin.

Author Contributions

  1. Top of page
  2. Abstract
  3. Introduction
  4. Method
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Author Contributions
  9. References

WH & ZW performed double-immunofluorescence staining, and analyzed the data; WH & XL collected case data and analyzed the data; WH & CG designed the research study, performed ELISA, immunohistochemistry, and wrote the paper.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Method
  5. Results
  6. Discussion
  7. Acknowledgements
  8. Author Contributions
  9. References