SEARCH

SEARCH BY CITATION

Keywords:

  • Acanthamoeba keratitis;
  • cornea;
  • innate immunity;
  • Toll-like receptors

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. References

The pathogenesis of Acanthamoeba keratitis (AK) is complicated. In our previous studies, TLR4 was found involved in the process of infection by Acanthamoeba in human corneal cells. The purpose of this study was to investigate the role of Toll-like receptor 4 (TLR4) signalling pathway in Wistar rats challenged with Acanthamoeba. The rat model of AK was established. Corneas were collected and analysed by real-time PCR to assess the mRNA levels of TLR 2, 4, myeloid differentiation protein (MyD)88, nuclear factor (NF)-κB, extracellular signal-regulated kinase (ERK), interleukin (IL)-8, tumour necrosis factor (TNF)-α and interferon (IFN) –β. Immunocytochemistry and Western blot were conducted to examine the proteins of TLR2, TLR4, p-Erk1/2 and p-IκB. Specific inhibitors PDTC and U0126 were used to pretreat the animals to determine the exact receptor and signalling pathway involved in pathogenesis. Expressions of TLR4, MyD88, all three cytokines, NF-κB, p-IκB and p-Erk1/2 were increased in Acanthamoeba-treated rat corneas. PDTC inhibited the production of IL-8 and TNF-α, while U0126 inhibited the synthesis of IFN-β. TLR4 was involved in sensing the challenge of Acanthamoeba and inducing production of cytokines through TLR4–NF-κB and TLR4–Erk1/2 pathways in corneas of Wistar rats.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. References

Acanthamoeba keratitis (AK) is an infection caused by a genus of free-living Amoebae that produces blindness in humans. Acanthamoeba spp, distributes in a wide variety of environments, including air, soil, rivers, tap water and so on (1). Corneal injuries and polluted eye contact lenses are considered the most important risk factors for the infection (1–4). Incidence of AK was noticeably increased in the 1980s when corneal contact lenses became popular. For every 1 million contact-lens wearers, AK has been found in 1·36 patients in the United States, 3·06 in the Netherlands and 17·53–21·14 in England (2,3). In recent years, an elevated incidence of AK in patients not wearing contact lens has attracted attention. A study of 3183 patients with corneal infections conducted between 1999 and 2002 in India found 33 patients with positive Acanthamoeba infection (1·04%), 26 of which were peasants from remote rural areas with corneal injury from mud (4). Clinically, the resistance of Acanthamoeba cysts to most antimicrobial agents is a serious problem. Typically, AK patients have a delayed diagnosis, a long course of disease, a high risk of treatment failure and recurrence. When the protozoa damage corneal neurons, patients experience intense ophthalmalgia. Therefore, AK is one of the most difficult ocular infections to treat, with a mean treatment period of more than 5 months, surgical interventions in 50% of cases, loss of vision in more than 30% of patients, infection of the whole eye and, ultimately, enucleation in recalcitrant cases (3,5).

To solve the difficulties in AK treatment, many studies have been conducted on the pathogenesis of AK. In 1997, Yang Z reported that a kind of carbohydrate mediated the parasite–host interaction, which was considered the first step in AK pathogenesis (6). In 2000, Vemuganti GK reported that phagocytosis and apoptosis induced by the protozoa were also involved (7). In 2001, Na BK suggested that proteases secreted by the trophozoites played an important role in the penetration of the corneas by protozoa (8). Recently, a new kind of protein called mannose-binding protein (MBP) expressed on the cell surface of Acanthamoeba has been characterized and assumed to be a key factor for the trophozoites to invade host cells (9). But it still remains unclear what molecules in host cells mediate the parasite–host binding process and which intracellular signal cascades are triggered by this binding.

Innate immunity is the first line and natural barrier of defence against pathogens. Toll-like receptors (TLRs), found in the 1990s, are important components of innate immunity. They play a role in the detection of the pathogens by recognizing pathogen-associated molecular patterns (PAMPs), then initiating the signal cascades, and regulating synthesis of inflammatory cytokines in the host cells. To activate the innate immune response of host cells, different TLRs bind to different ligands such as bacteria, fungi, virus and spirochetes and so on (10–21).

In our previous studies, we found that TLR4 signalling pathway was activated in response to Acanthamoeba challenge and induced the production of inflammatory cytokines through TLR4–MyD88–NF-κB and TLR4–Erk1/2 pathways in human corneal cell lines (22). In the present study, we chose Wistar rats as model animal and investigated the in vivo role of TLR4 signalling pathway in the pathogenesis of AK.

Materials and Methods

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. References

Culture of Acanthamoeba and preparation of stimulating solution

The Acanthamoeba, kindly provided by Beijing Eye Institute, was isolated from an 18-year-old patient with AK. They were identified being genotype T4 based on 18S rRNA gene sequences. The parasites were grown anaemically in 25-cm2 canted-neck tissue culture flasks containing 5 mL PYG medium (Peptone-Yeast-Glucose) at 28°C. After 10 days of culture, 95% was in trophozoite form. Then, approximately 1 × 106 cells of Acanthamoeba were harvested from each flask and washed three times with PBS by centrifugation at 500 g for 7 min. Each precipitate was suspended in 1 mL PBS to be used as the stimulating solution.

Animals

Fifty-five Wistar rats, regardless of their gender, weighing 280 g to 300 g, were obtained from the Animal Supply Centre of Shandong University. Animal care and treatment in this investigation complied with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. Slit lamp examination prior to the experiments was used to exclude any injury to the cornea. First 30 rats were used. They were randomly divided into groups A and B, fifteen in each. Rats in group A were used for slit lamp examination and photographing. Those in group B were used for pathological and molecular biological detection. Three days prior to any manipulation, antimicrobial chloromycin eye drops (Shandong Lukang Cisen pharmaceutical Co., limited, China) were applied frequently to the eyes of the rats.

Establishment of rat model of AK

Briefly, the Wistar rats in both groups were anaesthetized with an intraperitoneal injection of 10% chloral hydrate (3 mL/kg of body weight). Corneal anaesthesia was obtained with topical application of 0·4% Oxybuprocaine hydrochloride eye drops (Santen Pharmaceutical Co., Ltd. Osaka, Japan). After routine disinfection, the corneas of both eyes were scratched three times vertically and three times horizontally using a sterile 30-gauge syringe needle. The stimulating solution was applied to the scarified corneas of the right eye, while PBS was used on the left eye as control. Then the eyelids of all the right eyes were sutured to guarantee full contact between Acanthamoeba and the injured corneas. Topical application of erythromycin ophthalmic ointment (Lukang Co. Shandong, China) was used for antibacterial purposes. Twenty-four hours later, the stitches were removed and the corneas were monitored by slit lamp examination.

Observation on the pathology of the Keratitis

On days 1, 3, 7, 13 and 21 post-infection, the animals in group A were monitored by slit lamp examination. A grade of 0 to 4 was assigned to each, based on the following three criteria: area of opacity, density of opacity and surface regularity (Table 1). A normal, untreated cornea was given a score of 0 in each category and thus had a total score of 0. The scores from all three categories were calculated at 1, 3, 7, 13 and 21 days post-infection for each eye to yield a possible total score ranging from 0 to 12. A total score of 5 or less was categorized as mild infection, a total score of 6 to 9 was considered moderate and a total score of more than 9 was severe. Microscopic examination of 10% potassium hydroxide wet mounts of corneal scraping, HE staining of the corneal sections and incubation of corneal scraping tissues in Page’s culture medium (NaCl 120 mg, MgSO4·7H2O 4 mg, CaCl2·2H2O 4 mg, Na2HPO4 142 mg, KH2PO4 136 mg, in 1000 mL distilled water) were used to verify the models and exclude coinfection with bacteria or fungi. Corneas of the rats in group B were harvested at indicated time points for the following analysis.

Table 1.   Primers for Wistar rats
GeneSenseAntisensebp
  1. GAPDH, Glyceraldehyde-3-phosphate dehydrogenase.

TLR2GGAGACTCTGGAAGCAGGTGCGCCTAAGAGCAGGATCAAC245
TLR4CCAGAGCCGTTGGTGTATCTTCAAGGCTTTTCCATCCAAC239
MyD88GACTGCCAGAAATACATACGATCTCCTGCACAAACTCAA200
NF-κBGGCAGCACTCCTTATCAAGGTGTCGTCCCATCGTAG249
Erk1/2AAGCATTACCTTGACCAGCTTCCACGGCACCTTATTT137
IL-8TCCAGCCAGTTGCCTTCTTGGGTCTGTTGTGGGTGGTATCC105
TNF-αATGTGGAACTGGCAGAGGAGACGAGCAGGAATGAGAAGAGG96
IFN-βGAACTACATCAGCAGACAGAGCGACCACCATCCAGGCATAGC167
GAPDHGTATCGGACGCCTGGTTACATTTGATGTTAGCGGGAT-3′223

Real-time PCR analysis

Real-time PCR analysis was performed to detect the mRNA levels of TLR2, 4, NF-κB, Erk1/2, IL-8, TNF-α and IFN-β. Total RNA was isolated from rats’ corneas using TRIzol (Invitrogen, Glasgow, UK). After reverse transcription using the Thermo script TM, RT-PCR system for first-strand cDNA synthesis kit (Invitrogen, Carlsbad, CA, USA), PCR was performed using the Smart Cycler System (F. Hoffman-La Roche, Ltd., Basel, Switzerland) with SYBR green fluorescent dye. The reactions were conducted in a total volume of 20 μL containing 10 μL 0·1 × SYBR Green master mix (TOYOBO Co., Ltd. Osaka Japan.), 1 μL sense and 1 μL antisense primers of 1 μm, 1 μL of standard cDNA and 7 μL DEPC water, all in Light Cycler Capillaries (20 μL, Roche Diagnostics GmbH). Primers (Shanghai Biosune Biotechnology Co., Ltd, Shanghai, China) are listed in Table 1. All primers were verified by BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi) for specificity of the interested human genes. The mRNA expression of each gene of interest was normalized to that of Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as control.

Western blot analysis of TLR2, TLR4, p-IκB and p-Erk1/2

Corneas were collected at indicated time points and lysed by repeated freezing and thawing in RIPA buffer (50 mm Tris-HCl, 1% NP-40, 0·25% Na-deoxycholate, 150 mm NaCl, 1 mm Na3VO4 and NaF) containing protease inhibitors (1 μg/mL each of EDTA, phenyl methyl sulfonyl fluoride). Cornea lysates were then centrifuged at 12000 g for 15 min at 4°C. All supernatants were transferred to new Eppendorf tubes and boiled for 5 min in sample buffer (12 mm Tris-HCl, 100 nm glycine, 10% SDS, and 1% 2-mercaptoethanol and 0·1% bromophenol blue, pH 6·8). The total protein was quantified, and 30 μg of protein samples was subjected to 10% SDS–PAGE. After gel separation, proteins were transferred to nitrocellulose membranes with a Bio-Rad transferring apparatus. The membranes were blocked with 5% skim milk in Tris-buffered saline containing 0·05% Tween 20 for 2 h at room temperature before the overnight incubation at 4°C with primary antibodies (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) diluted (1 : 100) in TBST. After incubation with primary antibodies, nitrocellulose membranes were washed extensively with TBST, then incubated with secondary antibodies for 2 h at 37°C. The immunoreactive band was visualized using enhanced chemiluminescence detection reagent (ECL; GE healthcare, Amersham, UK).

Immunocytochemistry analysis of TLR2, 4, p-Erk1/2 and p-IκB

Corneas from Wistar rats were dehydrated, embedded with paraffin and then sectioned at a thickness of 5 μm. The sections were routinely dewaxed in dimethylbenzene-ethanol. Antigen repairing was achieved in citrate buffer at 95°C for 10 min. The sections were blocked with goat serum for 30 min, incubated with primary antibodies (abcam) at 4°C overnight, stained with rhodamine/FITC-labelled secondary antibodies (KPL, Gaithersburg, MD, USA) for 90 min at 37°C in a light-proof chamber. After 2 washes, slides were incubated in 1 μg/mL DAPI-methanol as a counterstain to visualize the nuclei. After being mounted with glycerol, the slides were examined and photographed using a fluorescence microscope (Olympus fluorescence convert microscope X81, Japan). PBS was used instead of primary antibodies as blank control.

Effect of inhibition of signalling pathways on cytokine production

In this study, 25 rats were used and classified into 5 groups as Group P, U, P±U, Neg and Group Pos., with five rats in each. PDTC (specific inhibitor of NF-κB pathway, Zhizhuang Biotechnology, Shanghai, China) and U0126 (specific inhibitor of Erk1/2 pathway, Zhizhuang Biotechnology, Shanghai, China) were injected subconjunctivally once a day for 3 days with the particular dosage of 120 mg/kg for PDTC and 0·1 mg/kg for U0126 per treatment prior to challenge. Those in groups P, U and P±U were pretreated with PDTC, U0126, PDTC±U0126 respectively. Group Neg. were normal rats without inhibitor or challenge and group Pos. were rats without inhibitor but challenge. Then rats were challenged as above-mentioned. Six hours after challenge, corneas were harvested for detection of the cytokines by real-time PCR.

Data analysis

Mean ± SE for repeated determinations was presented. All data were analysed using spss 12.0 program. The student’s t-test was used to determine statistical significance of difference. For all statistical analyses, the level of significance was accepted as < 0·05.

Results

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. References

Confirmation of Acanthamoeba infection

In this study, laboratory tests including 10% potassium hydroxide wet mount of corneal scraping tissues, HE staining of the corneal sections and incubation of corneal scrapings were used to confirm AK and exclude coinfections. The tests were negative for bacteria and fungi, and no colonies of bacteria or fungi formed in the culture medium. Trophozoites and cysts were observed on 10% potassium hydroxide wet mount of corneal scraping tissues under a duplex inverted microscope. Active trophozoites grew in PYG medium with corneal tissues after 10 days of incubation.

Clinical and pathological evaluation of the AK models

The clinical features of AK were recorded, scored and graded with the aid of a dissecting microscope and slit lamp examination at 1, 3, 7, 13 and 21 days post-infection. The pictures of slit lamp examinations on rats from group A are presented in Figure 1a. On the 7th day post-infection, nine rats developed severe inflammation with a total score of more than 9 and ring ulcers and obvious stroma abscess formed 3 days post-treatment. Four rats got scores ranging from 6 to 9 and the other two rats were scored <6. From the 13th day onwards, angiogenesis appeared in most rats and the infection gradually alleviated with ulcers decreasing and scar-repairing.

image

Figure 1.  Slit lamp pictures (a) of rats in group A and HE staining of corneal sections (b) of rats in group B. Untreated corneas were labelled control and 1, 3, 7, 13, 21 days were corneas examined at the indicated time points after the treatment. Rats were generally anaesthetized with 10% chloral hydrate (3 mL/kg) injected peritoneally and then examined with slit lamp. Original magnification, ×25. (a) Corneas of rats in group B were collected at indicated time points, and corneas were processed for HE staining to visualize the pathological changes that happened during the infection. Original magnification, ×400. (b).

Download figure to PowerPoint

The corneas of the animal models in group B were harvested and treated for pathological and molecular biological analysis. Figure 1b shows the typical pathological process of AK in the rats of group B. In uninfected rats (control), the epithelium and stroma were well defined, the stromal fibres were arranged regularly, and there were no inflammatory cells infiltrated. The other pictures labelled 1, 3, 7, 13 and 21 days are the corneal sections of rats collected at the indicated time points post-treatment. On the 1st day post-infection, a few inflammatory cells infiltrated beneath the corneal epithelia. On the days 3 to days 7, most of the epithelia and stroma were infiltrated by a large number of inflammatory cells and the structure of epithelia became unorganized. Tissue necrosis could be observed, and the whole structure of cornea was destroyed. On the 13th day, new blood vessels could be found all over the sections and a few inflammatory cells still remained. On the 21st day, the inflammatory cells disappeared and fibrosis of the stroma could be observed.

Expression of TLR2, 4 in corneas of rats

Real-time PCR and Western blot analysis were used to assess the expression of TLR2, 4. It showed that TLR4 expression had an obvious increase 1 day post-infection, reached a peak at the 7th day, and then decreased both at mRNA level (Figure 2a) and at protein level (Figure 2b). TLR2 was observed to have a similar trend, but at much lower levels. Immunocytochemistry analysis showed that TLR4 was found to have the strongest immunofluorescence staining 7 days after the challenge. TLR2 showed weaker staining than TLR4 (Figure 3).

image

Figure 2.  Enhanced expression of TLR4 was detected in corneas of rats (group B) challenged by Acanthamoeba compared with uninfected corneas (control). The corneas were collected at indicated time points (1, 3, 7, 13, 21 days) to be assessed by real-time PCR (a) and Western Blot analysis (b). Data are representative of three repeated experiments. ≤ 0·05.

Download figure to PowerPoint

image

Figure 3.  Immunofluorescence staining of TLR2 and 4 in corneal sections of rats in group B. In uninfected corneas (TLR2-N, TLR4-N), there is light staining of TLR2, 4. Three days after challenge, staining of TLR4 was significantly augmented in challenged corneas (TLR4-S). Change in TLR2 staining in challenged corneas (TLR2-S) was not so obvious. Sections without primary antibody incubation were used as control (Neg.C.) and showed no positive staining. DAPI counterstaining was used to visualize cell morphology. Original magnification: ×400.

Download figure to PowerPoint

Production of cytokines

Quantitative real-time PCR analysis was used to examine the mRNA levels of IL-8, TNF-α and IFN-β in both normal and challenged corneas of rats. All three kinds of cytokines had elevated expression levels in challenged corneas compared with uninfected (control) corneas (Figure 4a). IL-8 and TNF-α had similar changing trends: they began to increase shortly after the challenge, reached the peak at 7th day and then decreased. The activation of IFN-β seemed to be delayed. It began to increase at 3rd day after challenge, kept increasing until the 13th day and slightly decreased before the observation ended.

image

Figure 4.  Production of cytokines in rat corneas in group B (a) and the effect of pathway inhibitors on cytokine production in rats corneas of group Neg. P, U, P±U and group Pos. During the 21 days observed, all three kinds of cytokines were produced in response to Acanthamoeba challenge (a) compared with untreated corneas (control). Seven days after PDTC and/or U0126 pretreatment, cytokines production induced by Acanthamoeba challenge was inhibited differentially. Data are representative of three repeated experiments. ≤ 0·05.

Download figure to PowerPoint

Expression of downstream molecules in TLR signalling pathways

The downstream genes of TLRs signalling pathway MyD88, NF-κB and Erk1/2 were tested to determine which pathway was activated in infected corneas. The mRNA expressions of MyD88 and NF-κB were proved to be augmented in Acanthamoeba- treated corneas according to the PCR analysis. (Figure 5a).

image

Figure 5.  Expressions of NF-κB were increased at mRNA level (a) in rats’ corneas after challenge compared with untreated corneas (control). Expression of Erk1/2 kept constant during the time observed. Data from PCR are representative of three experiments and are presented as mean ± SEM. ≤ 0·05. p-Erk1/2 and p-IκB were found to be enhanced by Western Blot (b). Figures are representative of three repeated experiments.

Download figure to PowerPoint

Western blot analysis showed that in normal rats, both p-IκB and p-Erk1/2 were expressed at a very low level and barely detectable (Figure 5b). Three days after challenge, expressions of both p-IκB and p-ERrk1/2 were increased significantly. p-IκB reached the highest level at the 7th day and then decreased, which accompanied the initiation of inflammation. p-Erk1/2 reached a peak at the 7th day and was observed at a high level until 21 days after challenge, which was in accordance with the recovery of the infection.

Immunofluorescence staining showed that p-IκB was mostly expressed in nuclei and p-Erk1/2 was expressed in both cytoplasm and nuclei (Figure 6). p-IκB was found to have the strongest immunofluorescence staining 7 days after the challenge. p-Erk1/2 had intense staining from 7 days after challenge to the end of the observation time.

image

Figure 6.  Immunofluorescence staining of p-IκB and p-Erk1/2 (B) in the cornea of rats. In uninfected corneas (p-IkB –N, p-Erk1/2-N), there is light staining of p-IkB and p-Erk1/2. Three days after challenge, staining of p-IκB and p-Erk1/2 (p-IkB-S, p-Erk1/2-S) was significantly augmented. Corneal sections without primary antibody incubation were used as negative control (Neg. C) and showed no fluorescein staining. DAPI counterstaining was used to visualize cell morphology. Original magnification: ×400.

Download figure to PowerPoint

Effect of inhibition of signalling pathways on cytokine production

The study showed that PDTC, the specific inhibitor of NF-κB, inhibited the production of IL-8 and TNF-α induced by Acanthamoeba challenge, while U0126, the inhibitor of MEK, inhibited the production of IFN-β (Figure 4b).

Discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. References

Corneal infectious disease is the leading cause of blindness worldwide. AK is an infection with relatively low incidence. But as no effective methods have been suggested in the treatment of AK, it remains one of the most serious blinding corneal infectious diseases.

In our previous studies (22), we found that in cultured human corneal epithelial cells and corneal stromal fibroblasts, TLR4 was activated in response to Acanthamoeba challenge and signalled through TLR4–NF-κB and TLR4–Erk1/2 pathways to induce the production of inflammatory cytokines. The TLR4–NF-κB pathway was activated early and induced the secretion of IL-8 and TNF-α. The TLR4–Erk1/2 pathway was activated later and induced the production of IFN-β. The expression of TLR2 was also found to be elevated. To determine whether TLR2 played a role in the infectious process, we pretreated the cells with neutralizing antibodies to TLR2 and/or TLR4. It was found that cytokine production induced by Acanthamoeba in cells pretreated with TLR4 antibody was decreased significantly, and that in cells pretreated with TLR2, antibody showed no alteration (22) In this study, we investigated the expression and function of TLR2, 4 and their signalling pathway in Wistar rats challenged by Acanthamoeba. Our results indicated that Acanthamoeba up-regulated the expression of TLR4 and the mRNA levels of inflammatory cytokines IL-8, TNF-α and IFN-β. Gene transcriptions of MyD88, NF-κB and protein levels of p-Erk1/2 and p-IκB were also activated by Acanthamoeba challenge in rats.

A growing number of agonists have been identified as ligands of TLR2 or TLR4 since TLRs were found (23) TLR2 has been reported to be the receptor for a growing number of agonists, including peptidoglycan and lipoteichoic acid of Gram-positive bacteria, (24,25) zymosan of fungi, (26) glycoinositolphospholipids of Trypanosoma cruzi, (27) some viruses and host metabolites such as heat shock protein and so on (28,29). In some studies, it was found that TLR4 responded to lipopolysaccharide of Gram-negative bacteria, (30) fusion protein of respiratory syncytial virus, (15) and some host metabolites (31). They recognized PAMP, initiated intracellular signal cascades and gene expression of downstream molecules (12,14,23). In this study, the expression of TLR4 was also up-regulated both at the mRNA level and at the protein level in response to Acanthamoeba challenge. What was different from the findings in human corneal cell lines was that no expressional elevation of TLR2 at mRNA or protein levels was detected in rat model of AK. Only TLR4 plays a role of sensing the challenge of Acanthamoeba both in vivo and in vitro.

Inflammatory cytokines reinforced the inflammatory response by modulating the activation of immunocytes after the pathogen invasion and induced pathogen clearance, as well as host cell death (32,33) We found that the inflammatory cytokines TNF-α, IL-8 and IFN-β were produced with the increased expression of TLR4 in Acanthamoeba-treated rats. IL-8 and TNF-α were synthesized soon after the challenge and decreased after 7 days, which suggested that they may be a kind of early response cytokine and act as chemotactic mediator for lymphocytes in the inflammatory response. We found that IFN-β was increasingly expressed 1 day after infection and kept increasing in the time observed and was thought to have immune adjuvant effect in corneal infection. TNF-α has been proved to be a kind of apoptosis-inducing cytokines and may play the same role in this process, which resulted in the tissue (34).

On ligand-binding, most TLRs recruit the adapter molecule MyD88 (myeloid differentiation protein 88) through homotypic interaction with a TIR domain presenting in its terminus, which is MyD88-dependent pathway (11,20). This in turn leads to the activation of p38, JNK and NF-κB, which is essential for the expression of many cytokines and chemokines such as IL-6, -8 and TNF-α. While TLR4 is a unique member of the TLR family in that except for MyD88-dependent pathway, it also signals through MyD88-independent pathway leading to activation of the transcription factors interferon regulatory factor (IRF) -3, -7 and production of IFN-β (35). Based on this theory, the expression level of IFN-β in this study partly reflected the importance of TLR4.

It was noticeable that most of the infected rats in our study recovered at the end of the observation, which was not a common occurrence in human beings. No reliable reports have been found to explain this at present.

In conclusion, our data indicated that human corneal stromal fibroblasts expressed multiple Toll-like receptors and Toll-like receptor 2, 4 and was up-regulated in response to Acanthamoeba challenge. TLR4 induced the synthesis of inflammatory factors IL-8, TNF-α through MyD88–NF-κB pathway and IFN-β through ERK1/2 pathway. This finding provided more fundamental information that might help understand further the mechanism of corneal innate immunity against pathogen infection and also revealed new potential therapeutic targets of AK as well as other Acanthamoeba-related infection.

Acknowledgement

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. References

The authors thank Professor Fu-shin X. Yu, Wayne State University for agents and technical support, and Beijing Eye Institute for providing Acanthamoeba and culture procedures. The authors also thank Leander Roessler for the help in revising the manuscript. None of the authors have any conflicts of interest to disclose. Supported by Natural Science Foundation of Shandong Province Grant Y2008C21 and National Natural Science Foundation of China Grant 30872807.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and Methods
  5. Results
  6. Discussion
  7. Acknowledgement
  8. References