SEARCH

SEARCH BY CITATION

Keywords:

  • cytokine;
  • Leishmania eukaryotic initiation factor;
  • leishmaniasis;
  • monocytes

Summary

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References

Leishmania eukaryotic initiation factor (LeIF) antigen, a Leishmania protein, was shown to induce IL-12, IL-10 and tumour necrosis factor-α (TNF-α) production by human monocytes-derived macrophages and dendritic cells from healthy individuals. This cytokine-inducing activity was previously found to be located in the amino-terminal region of LeIF protein. This study aimed at characterizing the cytokine-inducing activity of Leishmania infantum LeIF [Leishmania (L.) infantum (LieIF)] and at defining the fragments necessary for inducing cytokine secretion. Eleven rationally designed recombinant polypeptides, corresponding to the entire LeIF protein or parts of it, were expressed and used to stimulate monocytes from healthy individuals. Leishmania (L.) infantum was able to induce IL-12p70, IL-10 and TNF-α secretion in human monocytes. In addition, both amino- (1–226) and carboxyl-terminal (196–403) parts of the protein were shown to induce significant levels of the three cytokines analysed. However, IL-12p70-inducing activity was not significant when monocytes were stimulated with the fragments 129–226 and 129–261, inferring that IL-12p70-inducing activity was primarily located within amino acids 1–129 and 261–403. Although the full-length LieIF protein was a more potent inducer than the tested fragments, a significant cytokine-inducing activity was maintained in smaller amino acid regions. This work suggests that cytokine-inducing activity of LieIF or its parts could be exploited in vaccination or immunotherapy protocols.


Introduction

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References

Leishmania eukaryotic initiation factor (LeIF) is homologous to the eukaryotic initiation factor eIF4A, which is a prototype of the DEAD-box protein family. LeIF was first described as an antigen that induces the production of IL-12 and IFN-γ by human peripheral mononuclear cells (PBMCs) from either patients with leishmaniasis or normal individuals (1). In addition, LeIF induces the production of IL-12, IL-10 and TNF-α by human monocyte-derived macrophages and dendritic cells (2). Previous work indicated that the induction of cytokines appears to be located in the N-terminal part (1–226) of the LeIF protein, as the C-terminal part (196–403) did not induce any cytokines secretion by human macrophages and dendritic cells (2) or splenocytes (3). Leishmania eukaryotic initiation factor is also used as part of a trifusion recombinant protein vaccine, Leish 111f, which was shown to be protective in mice and hamster experimental models (4–6). These recombinant proteins, when administered as a cocktail, were efficient for immunotherapy (7).

The purpose of this work was to characterize the cytokine-inducing activity of the LeIF protein and fragments thereof encoded by the viscerotropic parasite Leishmania (L.) infantum (LieIF) in order to define the region(s) necessary to induce cytokines secretion by human monocytes. The protein fragments were defined to cover the entire LieIF sequence and complementing previously reported studies (2,3) and by protein comparisons, based on the solved crystal structures of other DEAD-box proteins (8,9) to delineate protein domains predicted to be more stable. In total, 11 recombinant proteins were constructed and expressed, and the purified polypeptides were used in assays to stimulate monocytes derived from PBMCs of healthy individuals and subsequently to measure production of IL-12p70, IL-10 and TNF-α cytokines.

Materials and methods

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References

Cloning

Nine recombinant polypeptides expressing parts of LieIF were constructed based on two approaches. In the first, five fragments (1–226, 1–195, 129–226, 129–261 and 196–403) were made based on the primary sequence of LeIF and on results published previously (2,3). The LieIF gene (1–403) and its fragments were amplified from Leishmania infantum (MHOM/TN/88/Aymen) genomic DNA by PCR using a 5′ oligonucleotide containing a NdeI site and a His-tag and a 3′ oligonucleotide containing an EcoRI site. The sequences of the oligonucleotides used for PCR amplification were as follow:

LieIF_15′ CAATTACATATGCATCACCATCACCATCACATGGCGCAGAATGATAAGATCGCC 3′
LieIF_1295′ CAATTACATATGCATCACCATCACCATCACGAGACCTTTGTCGGCGGCACGCGC 3′
LieIF_1955′ CATGGAATTCTTAGATCTCGTAAATCTGGTCCGCGAA 3′
LieIF_1965′ CAATTACATATGCATCACCATCACCATCACTTCCGCTTCCTGCCGAAGGACATC 3′
LieIF_2265′ CATGGAATTCTTAGTCGCGCATGAACTTCTTCGTCAG 3′
LieIF_2615′ CATGGAATTCTTACAGGTCCATCAGCGTGTCCAGCTT 3′
LieIF_4035′ CATGGAATTCTTACTCGCCAAGGTAGGCAGC 3′

In the second approach, we used the three-dimensional model based on the solved crystal structures of other DEAD-box proteins to define the LeIF domains [D1 + 25(1–238) and D2 (239–403)]. These domains and the protein deleted for the most divergent 25 amino-terminal residues (LeIFΔ25) were amplified by PCR using 5′ oligonucleotides containing SpeI and NdeI sites and a 3′ oligonucleotide containing an XhoI site. The sequences of the oligonucleotides used for PCR were as follow:

LieIF_5′5′ GCGCGACTAGTCATATGGCGCAGAATGATAAGATCG3
LieIFΔ25_5′5′ GCGCGACTAGTCATATGCCGTCCTTCGACGACATGC3
LieIFD1_3′5′ GCGCGCTCGAGCGTCAGGCTCTCGCGCTTC3
LieIFD2_5′5′ GCGCGACTAGTCATATGCTGGAGGGCATCAAGCAGTTC3
LieIF_3′5′ GCGCGCTCGAGCTCACCAAGGTAGGCAGCGAAG3

The underlined regions hybridized to the LeiIF sequence and the regions shown in bold are the inserted restriction sites. The 5′ extensions (GCGCG) facilitated cleavage by the restriction enzymes. The full-length protein was amplified with oligonucleotides LieIF_5′ and LieIF_3′, domain 1 (D1) was amplified with LieIFΔ25_5′ and LieIFD1_3′, domain 1 with the nonconserved amino-terminal extension (D1 + 25) with LieIF_5′ and LieIFD1_3′, domain 2 (D2) with LieIFD2_5′ and LieIF_3′, and the amino-terminal deletion (LieIFΔ25) was amplified with LieIFΔ25_5′ and LieIF_3′.

The PCR products were purified on 1% agarose gels and cloned into a pMOSBlue blunt-end vector (Amersham Biosciences, Buckinghamshire, UK) or bluescript plasmid (Stratagene, La Jolla, CA, USA) cut with SpeI and XhoI for fragments made by the first or second approaches, respectively. All recombinant constructs were confirmed by DNA sequencing.

Protein expression and purification

The LieIF (1–403) recombinant protein was purified from two different constructs as inclusion bodies, LieIF(I), or from soluble extracts, LieIF (S), as described previously (10). The five LieIF fragments defined on the basis of the primary sequence (1–226, 1–195, 129–226, 129–261 and 196–403) were subcloned into pET-17b vector (Novagen, San Diego, CA, USA) cut with NdeI and EcoRI. In the case of the other four LieIF-derived constructs (LeIFΔ25, D1 + 25, D1 and D2), the fragments were subcloned into pET-22b cut with NdeI and XhoI. All LieIF-derived fragments were expressed in the Origami E. coli strain (Novagen) and purified as previously described (11). The eluted proteins were stored at −80°C until needed. Protein concentrations were determined by the Bio-Rad Protein assay (Hercules, CA, USA) with BSA as a standard. Purity and concentrations were verified on 12% coomassie-stained SDS–PAGE gels.

Cell preparation

Blood donations were collected from consented healthy donors. Monocytes were generated from PBMCs by adherence to gelatin/plasma-coated flasks as previously described (12). Nonadherent cells were removed, and adherent cells were collected and washed. The purity of monocytes was determined by FACS staining using anti-CD14, anti-CD3 and anti-CD19 monoclonal antibodies (BD Biosciences Pharmingen, San Diego, CA, USA). Isotype-matched control antibodies were used for detecting nonspecific binding to cells.

Cytokine assay

Recombinant proteins were tested for the absence of contaminating LPS in preliminary experiments. They were proteinase K sensitive and polymyxin B resistant. IL-12p70, IL-10 and TNF-α levels were measured using the enzyme-linked immunosorbent sandwich assay method (13). Purified and biotinylated antibodies specific for these cytokines and human recombinant cytokines used as standards were purchased from BD Biosciences Pharmingen (San Diego, CA, USA).

Statistical analysis

Statistical analysis was performed using S-plus software version 6.2. One-side and two-side paired t-tests were used for comparing mean difference in the levels of cytokines. Correction for multiple testing was performed using Holm’s approach (14). Statistical significance was concluded when adjusted P-values were <0·05.

Results and discussion

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References

The LieIF recombinant proteins purified from soluble extracts, LieIF (S), or from inclusion bodies, LieIF(I) (Figure 1), were used to stimulate human monocytes and their effects on IL-12p70, IL-10 and TNF-α production by human monocytes were determined and compared to those observed in cultures with and without LPS stimulation. Both forms induced the production of similar high specific levels of IL-12p70 by IFN-γ-primed monocytes (Table 1). These IL-12p70 levels were comparable to those observed in IFN-γ-primed monocytes stimulated with LPS (Table 1). The enhancement of IL-12p70 production induced by LieIF was dose dependent (data not shown). Leishmania (L.) infantum (I) and LieIF (S) also induced high specific levels of IL-10 and TNF-α production that were significantly higher than those observed in LPS-stimulated monocytes (Table 1). These results demonstrated that the two forms of LieIF protein were able to induce high specific levels of IL-12p70, IL-10 and TNF-α in human monocytes. Furthermore, our results suggested that the solubility and biochemical activities of the LieIF (S) and LieIF (I) were not important determinants for this activity because the former was shown previously to hydrolyse ATP in vitro in an RNA-dependent reaction, while the latter was inactive (11). Modulation of cytokine production by human and murine antigen-presenting cells was previously described for the orthologous proteins in L. braziliensis (LbeIF) (2) and L. major (LmeIF) (3). It should be noted that the capacity of LieIF protein to induce IL-10 does not exclude the fact that this protein could constitute a potential adjuvant candidate because this property could be compatible with the induction of an appropriate Th1 phenotype that is tightly controlled by IL-10 (15,16). Consistent with this suggestion, despite its IL-10-inducing capacity, LeIF protein has already been used in association with a synthetic molecule representing five copies of the MUC1 (tumour-associated antigen MUC1 mucin) tandem repeat peptide, and it has been shown to promote induction of Th1-type responses in chimpanzees, which lead the authors to suggest that this molecule may constitute a safe and effective cancer vaccine (10).

image

Figure 1.  Expression and purification of the recombinant proteins. (a) Sequence of Leishmania infantum. The DEAD-box protein conserved motifs are as shown, and the positions of the different protein fragments used are as indicated. Aliquots of purified proteins from (b) inclusion bodies or (c) soluble extracts were resolved by SDS–PAGE gel and stained with Coomassie brilliant blue. The positions of the Bio-RAD prestained markers (in KDa) are indicated at the left. The His-Δ25LieIF had similar purity to LieIF (not shown). LieIF, Leishmania (L.) infantum.

Download figure to PowerPoint

Table 1.   Cytokine production by human monocytes
 Mean of cytokine productionaCytokine ratiob
IL-12p70 (ng/mL)P-valueIL-10 (ng/mL)P-valueTNF-α (ng/mL)P-valueIL-12p70 IL-10IL-12p70 TNF-αTNF-α IL-10
  1. LieIF, Leishmania (L.) infantum.

  2. aMonocytes were generated from 2 × 106 peripheral mononuclear cells of five healthy donors and stimulated with 10 μg/mL recombinant proteins or 1 μg/mL LPS. Data for IL-12p70 are obtained from monocytes primed with 3000 U/mL IFN-γ for 12 h, and results are shown from supernatants taken after 24 h. Data for IL-10 and TNF-α are obtained from monocytes without IFN-γ activation, and results are shown from supernatants taken after 18 h. Mean ± SEM was calculated from five healthy donors. P values reported correspond to comparisons with nonstimulated monocytes (ns). Cytokine ratio is the quotient of the indicated cytokine production by monocytes in response to the respective stimulus. NS, not significant.

  3. bRatios were calculated before rounding.

ns0·034 ± 0·020·032 ± 0·030·16 ± 0·06
LPS1·8 ± 0·9<0·050·65 ± 0·13<0·016·5 ± 1·7<0·012·80·289·9
LieIF(I)3·9 ± 1·1<0·022·1 ± 0·3<0·0019·3 ± 1·8<0·0011·80·424·4
1–2261·7 ± 0·7<0·051·4 ± 0·3<0·017·8 ± 1·9<0·011·20·215·7
1–1951·4 ± 0·6<0·051·2 ± 0·3<0·017·4 ± 1·8<0·011·10·196·0
129–2261·0 ± 0·3NS0·63 ± 0·13<0·015·0 ± 1·3<0·017·9
129–2611·2 ± 0·6NS0·96 ± 0·23<0·015·3 ± 1·3<0·015·6
196–4032·7 ± 0·7<0·020·62 ± 0·07<0·019·3 ± 1·6<0·0014·30·2915
LieIF(S)3·8 ± 1·1<0·022·1 ± 0·3<0·019·3 ± 1·7<0·011·80·414·5
LieIFΔ252·9 ± 0·9<0·052·0 ± 0·4<0·018·4 ± 1·8<0·011·50·354·3
D1 + 25 (1–238)2·8 ± 0·9<0·051·5 ± 0·4<0·017·6 ± 1·3<0·011·90·365·2
D1 (25–238)2·6 ± 0·9<0·051·4 ± 0·3<0·017·0 ± 1·3<0·011·90·384·9
D2 (239–403)1·5 ± 0·6<0·021·1 ± 0·2<0·016·1 ± 1·4<0·011·40·245·4

To define the fragments necessary for inducing cytokine secretion by LieIF, a total of 11 recombinants corresponding to LieIF and its different overlapping polypeptides rationally designed to cover the entire protein were constructed, expressed and purified (Figure 1). Purity of these proteins was estimated to be >90%. The identity of each protein was verified using anti-His and anti-LieIF antibodies (data not shown). The effects of the different LeIF fragments, purified from inclusion bodies [LieIF (I) fragments 1–226, 1–195, 129–226, 129–261, 196–403] or from soluble extracts [LieIF (S) fragments LieIFΔ25, D1 + 25, D1, D2], on the production, of cytokines by human monocytes were determined. Cytokine levels were compared to those observed in supernatants of nonstimulated, LieIF(I) or LieIF(S)-stimulated monocytes. As shown in Table 1, unlike for the fragments 129–226 and 129–261, the fragments 1–226, 1–195 and 196–403 induced high specific levels of IL-12p70 in IFN-γ-activated monocytes. These results suggested that IL-12p70-inducing activity displayed by the fragment 1–226 and 196–403 could be located in the regions 1–129 and 261–403, respectively. We also observed that the levels of IL-12p70 induced by LieIF(I) were significantly higher than those induced by any of its fragments (data not shown).

All LieIF(I) fragments were able to induce significant IL-10 and TNF-α levels in monocytes that were significantly lower or comparable to those observed with the entire LieIF(I) protein (Table 1). We also analysed IL-12p70, IL-10 and TNF-α induction by the different domains purified from the soluble extracts in monocytes. LieIFΔ25, D1 + 25, D1 and D2 recombinant proteins induced significant levels of IL-12p70 in IFN-γ -primed human monocytes, (Table 1). IL-12p70 levels induced by LieIF(S) and LieIFΔ25 were comparable, suggesting that the deletion of the 25 amino-terminal residues, most divergent and unique to LieIF, did not affect the induction of IL-12p70 and therefore that this region, which seems to play an important role in the interaction between LieIF and other translation initiation factors (11), may not be necessary for IL-12p70-inducing activity. Similar IL-12p70 levels were induced by D1, D2 and D1 + 25, which were significantly lower than those induced by LieIF(S) (Table 1). Similar TNF-α and IL-10 levels were observed after stimulation with LeIFΔ25 and LeIF(S), while those induced by D1, D1 + 25 and D2 domains were significantly lower than induced by LieIF (Table 1). Contrary to the results of literature obtained with LbeIF and LmeIF, LieIF does not contain polarity because both the N-terminal (1–226) and C-terminal parts of LieIF protein were able to induce the secretion of significant amounts of IL-12p70, TNF-α and IL-10 cytokines in human monocytes. The same results were obtained with D1 and D2 domains corresponding to the N- and C-terminal regions, respectively. These conflicting results could be due to amino acid differences in the C-terminal parts of the proteins from L. infantum and L. braziliensis at positions 363 (arginine vs. valine) and 384 (alanine vs. glycine), respectively.

To further characterize the cytokine induction activity of LieIF and its fragments, we have compared the IL-12p70, IL-10 and TNF-α production by monocytes by determining the cytokine ratios (Table 1). IL-12p70/IL-10 and TNF-α/IL-10 ratios were similar for LieIF(I) and LieIF(S) proteins. All the recombinant proteins have IL-12p70/IL-10 and TNF-α/IL-10 ratios superior to 1, suggesting a prevalence of Th1 cytokine induction. Interestingly, the highest IL-12p70/IL-10 and TNF-α/IL-10 ratios were observed for the fragment 196–403 suggesting its importance in vaccination or immunotherapeutic protocols.

The results of this study demonstrate that the L. infantum eIF4A homologue is able to induce high levels of Th1-associated cytokines by human monocytes. This activity is retained by C-terminal 196–403 fragment as well as the N-terminal 1–226 fragment. More interestingly, our results suggest that this cytokine-inducing activity may be restricted to smaller fragments 1–129 and 261–403, and this will need to be further demonstrated. It should however be noted that the full-length recombinant protein was more effective than any of the fragments tested; however, the highest IL-12/IL-10 and TNF-α/IL-10 ratios were associated with fragment 196–403. It remains interesting to identify the smallest fragment necessary for cytokine-inducing activities because, unlike for the full-length proteins, small molecules retain immunomodulatory properties (like IL-12 induction) while avoiding some deleterious responses.

Acknowledgements

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References

We thank Wafa Markikou and Besma Ben Daamer for cells preparation. We thank Merherzia Ben Fadhel for sequencing. We are grateful to Dr Mohamed Maâmer (the Blood Transfusion Service of Tunis) and especially donors for providing us blood. This study received financial support for MESRST-Tunisia (LR00SP04) and from the UNICEF/WHO/WorldBank/UNDP special programme for research and training on tropical diseases TDR (A30134). The study was approved by the ethical review board of the Pasteur Institute of Tunis.

References

  1. Top of page
  2. Summary
  3. Introduction
  4. Materials and methods
  5. Results and discussion
  6. Acknowledgements
  7. References
  • 1
    Skeiky YA, Guderian JA, Benson DR, et al. A recombinant Leishmania antigen that stimulates human peripheral blood mononuclear cells to express a Th1-type cytokine profile and to produce interleukin 12. J Exp Med 1995; 181: 15271537.
  • 2
    Probst P, Skeiky YA, Steeves M, Gervassi A, Grabstein KH & Reed SG. A Leishmania protein that modulates interleukin (IL)-12, IL-10 and tumor necrosis factor-alpha production and expression of B7-1 in human monocyte-derived antigen-presenting cells. Eur J Immunol 1997; 27: 26342642.
  • 3
    Skeiky YA, Kennedy M, Kaufman D, et al. LeIF: a recombinant Leishmania protein that induces an IL-12-mediated Th1 cytokine profile. J Immunol 1998; 161: 61716179.
  • 4
    Skeiky YA, Coler RN, Brannon M, et al. Protective efficacy of a tandemly linked, multi-subunit recombinant leishmanial vaccine (Leish-111f) formulated in MPL adjuvant. Vaccine 2002; 20: 32923303.
  • 5
    Coler RN, Goto Y, Bogatzki L, Raman V & Reed SG. Leish-111f, a recombinant polyprotein vaccine that protects against visceral Leishmaniasis by elicitation of CD4+ T cells. Infect Immun 2007; 75: 46484654.
  • 6
    Sakai S, Takashima Y, Matsumoto Y, Reed SG, Hayashi Y & Matsumoto Y. Intranasal immunization with Leish-111f induces IFN-gamma production and protects mice from Leishmania major infection. Vaccine 2010; 28: 22072213.
  • 7
    Badaro R, Lobo I, Nakatani M, et al. Successful use of a defined antigen/GM-CSF adjuvant vaccine to treat mucosal Leishmaniasis refractory to antimony: a case report. Braz J Infect Dis 2001; 5: 223232.
  • 8
    Caruthers JM, Johnson ER & McKay DB. Crystal structure of yeast initiation factor 4A, a DEAD-box RNA helicase. Proc Natl Acad Sci U S A 2000; 97: 1308013085.
  • 9
    Sengoku T, Nureki O, Nakamura A, Kobayashi S & Yokoyama S. Structural basis for RNA unwinding by the DEAD-box protein Drosophila Vasa. Cell 2006; 125: 287300.
  • 10
    Barratt-Boyes SM, Vlad A & Finn OJ. Immunization of chimpanzees with tumor antigen MUC1 mucin tandem repeat peptide elicits both helper and cytotoxic T-cell responses. Clin Cancer Res 1999; 5: 19181924.
  • 11
    Barhoumi M, Tanner NK, Banroques J, Linder P & Guizani I. Leishmania infantum LeIF protein is an ATP-dependent RNA helicase and an eIF4A-like factor that inhibits translation in yeast. FEBS J 2006; 273: 50865100.
  • 12
    Jones BM, Nicholson JK, Holman RC & Hubbard M. Comparison of monocyte separation methods using flow cytometric analysis. J Immunol Methods 1989; 125: 4147.
  • 13
    Sassi A, Louzir H, Ben Salah A, Mokni M, Ben Osman A & Dellagi K. Leishmanin skin test lymphoproliferative responses and cytokine production after symptomatic or asymptomatic Leishmania major infection in Tunisia. Clin Exp Immunol 1999; 116: 127132.
  • 14
    Holm S. A simple sequentially rejective multiple test procedure. Scand J Stat 1979; 6: 6570.
  • 15
    Trinchieri G. Interleukin-10 production by effector T cells: Th1 cells show self control. J Exp Med 2007; 204: 239243.
  • 16
    O’Garra A & Vieira P. T(H)1 cells control themselves by producing interleukin-10. Nat Rev Immunol 2007; 7: 425428.