gid1, a gibberellin-insensitive dwarf mutant, shows altered regulation of probenazole-inducible protein (PBZ1) in response to cold stress and pathogen attack

Authors


Setsuko Komatsu. Fax: +81 29 838 7408; e-mail: skomatsu@affrc.go.jp

ABSTRACT

A recessive gibberellin (GA)-insensitive dwarf mutant of rice, gibberellin-insensitive dwarf1 (gid1), has been identified, which shows a severe dwarf phenotype and contains high concentrations of endogenous GA. To elucidate the function of gid1, proteins regulated downstream of gid1 were analysed using a proteomic approach. Proteins extracted from suspension-cultured cells of gid1 and its wild type were separated by two-dimensional polyacrylamide gel electrophoresis (2D-PAGE). Of a total of 962 proteins identified from the suspension-cultured cells, 16 were increased and 14 were decreased in gid1 compared with its wild type. Among the proteins hyper-accumulated in gid1 were osmotin, triosephosphate isomerase, probenazole inducible protein (PBZ1) and pathogenesis-related protein 10. Of these four genes, only the expression of PBZ1 was increased by exogenous GA3 application. Expression of this gene was also enhanced in shoots of the wild type by cold stress or by rice blast fungus infection. Under normal growth conditions, there was more PBZ1 protein in gid1 than in the wild type. In addition, gid1 showed increased tolerance to cold stress and resistance to blast fungus infection. The ent-copalyl diphosphate synthase (OsCPS) genes, which encode enzymes at the branch point between GA and phytoalexin biosynthesis, were expressed differentially in gid1 relative to the wild type. Specifically, OsCPS1, which encodes an enzyme in the GA biosynthesis pathway, was down-regulated and OsCPS2 and OsCPS4, which encode enzymes in phytoalexin biosynthesis, were up-regulated in gid1. These results suggest that the expression of PBZ1 is regulated by GA signalling and stress stimuli, and that gid1 is involved in tolerance to cold stress and resistance to blast fungus.

INTRODUCTION

The plant hormone gibberellin (GA) plays important roles in plant growth and is required for seed germination and for completion of anther, seed, flower and fruit development (Hooley 1994). The genes encoding most of the enzymes involved in GA biosynthesis and the initial steps of GA metabolism have been isolated and characterized. In rice, the GA biosynthetic and metabolic pathways have been elucidated in detail by screening for genes encoding GA metabolic enzymes in rice DNA databases and by analysing GA-deficient mutants that have a reduced ability to carry out one or more steps in the GA biosynthetic pathway (Sakamoto et al. 2004). In addition to extending our knowledge of GA biosynthesis and metabolism, these approaches have revealed some of the mechanisms underlying GA signalling in rice.

The DELLA subfamily of the GRAS family of putative transcription factors plays an important role in the negative control of GA signalling (Olszewski, Sun & Gubler 2002). A rice DELLA protein, SLR1, was localized in nuclei and was rapidly degraded in response to GA signals (Ikeda et al. 2001; Itoh et al. 2002). The slr1 mutant, a loss-of-function mutation of the SLR1 gene, shows a constitutive GA-response phenotype (Ikeda et al. 2001). The GA-dependent degradation of DELLA protein is essential for transducing the GA signal. Analysis of a rice GA-insensitive dwarf mutant, gid2, revealed that SLR1 degradation is mediated by SCF complexes (Sasaki et al. 2003). The gid2 gene encodes a putative F-box protein that associates with the SCF E3 complex through an interaction with a rice ASK homologue, OsSpk15 (Gomi et al. 2004). Through an interacting affinity with GID2, phosphorylated SLR1 is bound by the SCFGID2 complex, triggering the ubiquitin-mediated degradation of SLR1 (Gomi et al. 2004).

Although much is known about GA biosynthesis and signalling in rice, the biochemical and genetic events that are regulated downstream of GA signalling are still little known. A few studies on GA-regulated genes or proteins at various developmental stages in rice have been reported. During internodal elongation, two of the four xyloglucan endotransglycosylase-related genes in rice (OsXTR1 and OsXTR3), which encode a cell wall-loosening enzyme, were up-regulated by GA (Uozu et al. 2000). OsXTH8, a member of another gene family of xyloglucan endotransglucosylase/hydrolases (XTHs), was preferentially expressed in rice leaf sheath in response to GA3 and was up-regulated in the slr1 mutant, suggesting that the gene's expression is controlled by GA (Jan et al. 2004). Since GA promotes internodal elongation, the GA-responsiveness of these genes is expected to play a significant role in this stage of rice development. Treatment with auxin or GA caused accumulation of methylmalonate semi-aldehyde dehydrogenase (MMSDH) protein in suspension-cultured cells of wild-type rice, and the same protein accumulated in untreated suspension-cultured cells of the slr1 mutant (Oguchi et al. 2004).

Recently, a recessive GA-insensitive severe dwarf mutant of rice, gibberellin-insensitive dwarf1 (gid1), was found to exhibit phenotypes typically observed in GA-deficient plants despite having elevated levels of GA (Sasaki et al. 2003). The predicted GID1 protein has similarities with members of the serine hydrolase family (Ueguchi-Tanaka et al. 2001). Analysis of gid1slr1 double mutants suggests that GID1 acts upstream of SLR1 (Ueguchi-Tanaka et al. 2001, 2002). To further elucidate the function of gid1, we used a proteomic approach in identifying proteins regulated downstream of this gene.

MATERIALS AND METHODS

Plant materials

In this study, gid1, a GA-insensitive dwarf mutant of rice (Oryza sativa L. cv. Jinheung), and its wild type were used. The rice plants were grown under fluorescent white light (600 µm m−2 s−1, 12 h light period per day) at 25 °C and 70% relative humidity in a growth chamber (Sanyo, Osaka, Japan). Rice cultured suspension cells were cultured in N6 liquid medium (Murashige & Skoog 1962) supplemented with 1 mg L−1 2,4-dichlorophenoxyacetic acid and kept in an incubator with shaking at 22 °C. The cultures were subcultured using the same medium every 2 weeks.

Chemical treatments and fungal inoculation

For GA3, NaCl, mannitol and abscisic acid (ABA) treatments, 2-week-old seedlings grown in pots were transferred to plastic containers containing 10 µm GA3 (Wako Pure Chemical, Osaka, Japan), 150 mm NaCl, 300 mm mannitol and 50 µm ABA, respectively. For cold stress treatment, 2-week-old seedlings grown in pots were transferred to 5 °C in a growth chamber. For drought treatment, 2-week-old seedlings grown in pots were transferred on paper towels. Finally, for fungal inoculation, leaf blades of 3-week-old seedlings were cut and 10 µL conidial suspension (1 × 107 conidia mL−1) of Pyricularia grisea was spotted onto the leaves.

Protein extraction and two-dimensional polyacrylamide gel electrophoresis (2D-PAGE)

Two hundred micrograms of cultured suspension cells were homogenized with 400 µL of a lysis buffer (O’Farrell 1975) containing 8 m urea, 2% Nonidet P-40 (NP-40), 0.8% Ampholine (pH 3.5–10 and pH 5–8, Amersham Biosciences, Piscataway, NJ, USA), 5% 2-mercaptoethanol and 5% polyvinyl pyrrolidone-40 using a glass mortar and pestle on ice. Each of the homogenates was centrifuged twice at 15 000 g for 5 min. Fifty microlitres of the supernatants were separated by 2D-PAGE in the first dimension by isoelectric focusing (IEF) tube gel for low pI range (pI 3.5–8.0) and immobilized pH gradient (IPG) tube gel (Daiichi Kagaku, Tokyo, Japan) for high pI range (pI 6.0–10.0), and in the second dimension by SDS–PAGE. An IEF tube gel 11 cm in length and 3 mm in diameter was prepared. IEF gel solution consisted of 8 m urea, 3.5% acrylamide, 2% NP-40 and 2% Ampholine (pH 3.5–10 and pH 5–8). Electrophoresis was carried out at 200 V for 30 min, followed by 400 V for 16 h and 600 V for 1 h. For IPG electrophoresis, samples were applied to the acidic side of gels. Electrophoresis using IPG tube gels (pH 6.0–10.0) of 11 cm length and 3 mm diameter was carried out at 400 V for 1 h, followed by 1000 V for 16 h and 2000 V for 1 h. After IEF or IPG, SDS–PAGE in the second dimension was performed using 15% polyacrylamide gel with 5% stacking gel. The gels were stained with Coomassie Brilliant Blue (CBB), and image analysis was performed.

Gel Image analysis

2D-PAGE images were synthesized, and the position of individual proteins on gels was evaluated automatically with Image Master 2D Elite software (version 2.0, Amersham Biosciences). The pI and molecular mass of each protein was determined using 2D-PAGE marker (Bio-Rad, Richmond, CA, USA). The amount of a protein spot was estimated using the Image Master 2D Elite software. The amount of a protein spot was expressed as the volume of that spot, which was defined as the sum of the intensities of all the pixels that make up the spot. In order to correct the variability due to CBB staining and to reflect the quantitative variations in the intensity of protein spots, the spot volumes were normalized as a percentage of the total volume in all of the spots present in the gel.

Cleveland peptide mapping

Following separation by 2D-PAGE, gel pieces containing protein spots were removed and the protein was electroeluted from the gel pieces using an electrophoretic concentrator (Nippon-Eido, Tokyo, Japan) at constant power of 2 W for 2 h. After electroelution, the protein solution was dialysed against deionized water for 2 d and lyophilized. The protein was dissolved in 20 µL of SDS sample buffer containing 0.5 m Tris-HCl (pH 6.8), 10% glycerol, 2.5% SDS and 5% 2-mercaptoethanol, and was applied to a sample well in an SDS–PAGE gel. The sample solution was overlaid with 20 µL of a solution containing 10 µL of Staphylococcus aureus V8 protease (0.1 µµL−1; Pierce, Rockford, IL, USA) and 10 µL of the SDS sample buffer. Electrophoresis was performed until the sample and protease were stacked in the stacking gel. Electrophoresis was then interrupted for 30 min to digest the protein (Cleveland et al. 1977), after which it was continued.

N-terminal and internal amino acid sequence analyses

To analyse N-terminal and internal amino acid sequences following separation using 2D-PAGE or Cleveland peptide mapping, the proteins were electroblotted onto a polyvinylidene difluoride (PVDF) membrane (Pall, Port Washington, NY, USA) and detected by CBB staining. The stained protein spots were excised from the PVDF membrane and directly subjected to Edman degradation on a gas-phase protein sequencer (Procise 494, Applied Biosystems, Foster City, CA, USA).

Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS)

The CBB-stained protein spots were excised from gels, washed with 25% methanol and 7% acetic acid for 12 h at room temperature and destained with 50 mm NH4HCO3 in 50% methanol for 1 h at 40 °C. After drying in vacuum, the gel spots were incubated in 50 µL of a reduction solution containing 10 mm EDTA, 10 mm DTT and 100 mm NH4HCO3 at 60 °C for 1 h. The gel spots were dried in vacuum and incubated in 50 µL of an alkylation solution containing 10 mm EDTA, 10 mm iodoacetamide and 100 mm NH4HCO3 at room temperature for 30 min in the dark. After washing with water, the gel spots were minced and dried in vacuum. The gel pieces were digested in 50 µL of 10 mm Tris-HCl (pH 8.0) containing 1 pm trypsin (Sigma, St. Louis, MO, USA) at 37 °C for 10 h. Acetonitrile (100 µL) containing 0.1% trifluoroacetic acid was added to each gel piece and was sonicated. Purification of the generated peptides was achieved using Zip-Tips (Millipore, Bedford, MA, USA). The purified peptides (2 µL) were added directly to the matrix, which was 10 mg mL−1α-cyano-4-hydroxycinnamic acid, 0.3% trifluoroacetic acid and 50% acetonitrile, and were air-dried onto a plate for analysis using MALDI-TOF MS (Voyager-DE RP, Applied Biosystems). Matching of experimental results measured peptide mass values with theoretical digests, and sequence information obtained from database was performed using Mascot software (Matrix Science, London, UK).

RNA isolation and RNA gel blot analysis

Total RNA was isolated from samples according to the method described by Chomczynski & Sacchi (1987). Total RNA was electrophoresed on a 1.2% agarose-formaldehyde gel and then transferred to a Hybond N+ membrane (Amersham Biosciences). Hybridization was performed at 42 °C in UltraHyb buffer (Ambion, Austin, TX, USA). Osmotin, triosephosphate isomerase, probenazole-inducible protein (PBZ1) and PR-10 gene-specific probes were amplified from EST clones (DNA bank of National Institute of Agrobiological Sciences) of rice and labelled with [α-32P]dCTP (Amersham Biosciences). After hybridization, filters were washed twice with 2 × SSC and 0.1% SDS at 42 °C for 5 min, and once with 0.1 × SSC and 0.1% SDS at 42 °C for 20 min. The hybridization signals were detected and analysed with Typhoon 8600k variable imager (Amersham Biosciences).

Protein extraction and immunoblot analysis

Proteins were extracted from rice tissues by grinding in SDS sample buffer (Laemmli 1974). The lysates were centrifuged twice at 15 000 g at 4 °C for 5 min each. The supernatants were subjected to SDS–PAGE. For immunoblot analysis, protein samples were separated on a 15% SDS–PAGE and transferred on to PVDF membrane. Anti-PBZ1 antibody was used as first antibody, and anti-rabbit IgG horse radish peroxidase-linked antibody (Amersham Biosciences) was used as secondary antibody. Immunoblot was detected using ECL Plus Western blotting detection kit (Amersham Biosciences).

Gene expression analysis

RT-PCR was performed with total RNAs separately prepared from shoots of rice by using the ProSTARTM First-Strand RT-PCR kit (Stratagene, La Jolla, CA, USA). The PCR cycles, in which PCR products were in exponential increase, were determined essentially as described by the supplier. The primers used for OsCPK genes were described previously (Asano et al. 2005). The primer sequences used for Os cPK genes were: OsCPS1-F (ACGAATTGAGGAGGCAGCATCTATG) and OsCPS1-R (GAGCAAGTTCTTGCATACCCAACTC); OsCPS2-F (GTTCATCGTCCAGGACCGGCTCATCA AC) and OsCPS2-R (AAGGTGGTCGGCCTAGCA TGCAGTGCTT); and OsCPS4-F (ATCTTCGAG GCAAACCGAGCAGCGGAAC) and OsCPS4-R (TTTGCCCGGTCAAAACATGCCGTCCTCC).

Analysis of ABA concentration

Crude ABA extracts from shoots were prepared with a homogenization buffer. Competitive Enzyme-Linked Immunosorbent Assay (ELISA) was carried out using a Phytodetek ABA kit (Agdia, Elkhart, IN, USA) according to the manufacturer's instructions.

RESULTS

Osmotin, triosephosphate isomerase, PBZ1 and pathogen-related protein 10 (PR-10) are over-accumulated in gid1

To identify proteins regulated by the GA signalling pathway in rice, proteins from suspension-cultured cells of the gid1 mutant were analysed by 2D-PAGE. Because GA signalling is not functional in the mutant, GA-regulated proteins should be differentially accumulated in the mutant and the wild type. In extracts from rice suspension-cultured cells, 962 protein spots were detected on 2D-PAGE gels with CBB staining (Tanaka et al. 2004). Among these protein spots, 16 were increased and 14 were decreased in gid1 compared with its wild type (Fig. 1). These differentially accumulated proteins were identified by mass spectrometry or protein sequencing (Tables 1 & 2). Several of these proteins were identified as stress response proteins, including osmotin (No. 697), PBZ1 (No. 858) and PR-10 (No. 864), which were increased, and three putative ascorbate peroxidases (Nos. 792, 796, and 837), which were decreased relative to wild type (Tables 1 & 2). The other differentially expressed proteins had functions in central metabolism, e.g. glycolysis (2,3-bisphosphoglycerate-independent phosphoglycerate mutase, No. 189; glyceraldehyde-3-phosphate dehydrogenase, No. 485; triosephosphate isomerase, No. 862), photosynthesis (OEE2, No. 345; chlorophyll a/b binding protein, No. 622) and energy generation (membrane calcium ATPase protein, No. 194; F1F0-ATPase inhibitor protein, No. 314; pyrazinamidase/nicotinamidase, No. 608; cytochrome c oxidase, No. 852). Some of the differentially accumulated proteins could not be assigned a clear function.

Figure 1.

2D-polyacrylamide gel electrophoresis (PAGE) patterns of proteins from suspension-cultured cells of gid1 and its wild type. Proteins were extracted from suspension-cultured cells of gid1 and its wild type, separated by 2D-PAGE and stained with Coomassie Brilliant Blue (CBB). For the first dimension, isoelectric focusing (IEF; low pI range) and immobilized pH gradient (IPG; high pI range) were used and overlapped at around pI 5.8. The pI and relative molecular weight of each protein were determined using 2D-PAGE Marker. Arrows show proteins that were increased or decreased in gid1 relative to the wild type. The number of protein spots from suspension-cultured cells was determined previously (Tanaka et al. 2004).

Table 1.  Proteins increased in gid1 suspension cultured cells
Spot No.apIbkDabHomologous proteinAccession No.cSequence determineddInduction ratioe
  • a

    Spot numbers as given in Fig. 1.

  • b

    Molecular mass and pI are from the gel in Fig. 1.

  • c

    Accession number in NCBI database.

  • d

    Methods of protein identification: N-terminal amino acid sequences as determined by Edman degradation.

  • e

    Ratios of the amount of protein in gid1 to that of wild type.

6977.833.0OsmotinAP003231N-DYAPMTLTIV5.19
8625.528.0Triosephosphate isomeraseP12863N-GRKFFVGGNW3.27
8585.023.8Probenazole-inducible proteinD38170N-APVSISDERA3.27
8645.022.7PR-10AF274851N-APASISDERA3.18
5088.143.0Protein-export membrane proteinP57460N-QPGKGV2.40
976.674.7Endogenous double-stranded RNA encoding polyproteinD32136(MALDI-TOF MS)2.21
8546.524.3GrpEO66745(MALDI-TOF MS)2.18
4858.144.2Glyceraldehyde-3-phosphate dehydrogenaseP26520N-AKIKIGINGF2.05
2216.361.6Zinc-induced proteinAF323612(MALDI-TOF MS)1.97
4125.848.0Adenylate kinaseAB041773(MALDI-TOF MS)1.93
2826.156.5No hitN-MKEKG1.62
3105.954.8No hitN-QTAAVXE1.60
8074.527.8FerredoxinD30763(MALDI-TOF MS)1.52
3725.850.7Tat binding proteinD17788(MALDI-TOF MS)1.51
6225.236.8Chlorophyll a/b binding proteinAF022738N-PGERGFDE1.27
3147.754.5F1F0-ATPase inhibitor proteinAB029059(MALDI-TOF MS)1.31
Table 2.  Proteins decreased in gid1 suspension cultured cells
Spot No.apIbkDabHomologous proteinAccession No.cSequence determineddRepression ratioe
  • a

    Spot numbers as given in Fig. 1.

  • b

    Molecular mass and pI are from the gel in Fig. 1.

  • c

    Accession number in NCBI database.

  • d

    Methods of protein identification: N-terminal (N-) and internal (I-) amino acid sequences as determined by Edman degradation.

  • e

    Ratios of the amount of protein in wild type to that of gid1.

8606.323.420S proteasome β2 subunitAB026564(MALDI-TOF MS)7.69
8526.324.5Cytochrome c oxidaseP03945(MALDI-TOF MS)3.38
7965.328.2Putative ascorbate peroxidaseAA017000N-ALIAEKS2.34
3456.652.5OEE2D49713N-ISTGFXE2.30
4846.544.2No hitN-LALTES2.30
6086.637.4Pyrazinamidase/nicotinamidaseP21369N-DLQEDFVGGA2.11
3066.654.9Ribosomal protein S12X06612(MALDI-TOF MS)2.06
5767.139.2Septurn site-determining proteinQ9X213(MALDI-TOF MS)1.98
8374.925.5Putative ascorbate peroxidaseAA017000N-LAWHLAGTF1.56
6776.833.9Hypothetical proteinP40470(MALDI-TOF MS)1.55
3074.854.8β-tubulinS52008N-MREILHIQGG1.20
1945.363.4Membrane calcium ATPase proteinAC025724N-ANMTV1.17
7925.628.3Putative ascorbate peroxidaseAA017000N-AKNYPVVSAE1.11
1895.263.72,3-bisphosphoglycerate phosphoglycerate mutaseBAB64833I-GHNALGAGR1.01

Four proteins that accumulated to at least threefold higher levels in gid1 compared to wild type were selected for further study. These proteins were osmotin (No. 697), triosephosphate isomerase (No. 862), PBZ1 (No. 858) and PR-10 (No. 864) (Table 1). Osmotin is known as a member of the PR-5 family that accumulates in salt- (NaCl) and desiccation-adapted tobacco cells (Singh et al. 1987). Triosephosphate isomerase is an enzyme involved in glycolysis and gluconeogenesis, and converts glyceraldehyde-3-phosphate to dihydroxyacetone phosphate. PBZ1 is induced by probenazole (Oryzemate, 3-allyloxy-1,2-benzisothiazole-1,1-dioxide), an effective fungicide against rice blast disease, and has an important function in disease resistance in rice (Midoh & Iwata 1996). PR-10 is a PR protein induced by viral infection (Bol, Linthorst & Cornelissen 1990).

PBZ1 gene expression is increased by GA, cold stress and blast fungus infection

Northern blot analysis was used to examine the expression pattern of osmotin, triosephosphate isomerase, PBZ1 and PR-10 mRNA in wild-type and gid1 suspension-cultured cells. The expression levels of osmotin, triosephosphate isomerase, PBZ1 and PR-10 in gid1 suspension-cultured cells were 20, 2, 10 and 10 times higher, respectively, than in the wild type (Fig. 2a).

Figure 2.

Expression of osmotin, triosephosphate isomerase, PBZ1 and PR-10 genes. (a) Total RNA was extracted from suspension-cultured suspension cells of gid1 or its wild type. (b) Expression of osmotin, triosephosphate isomerase, PBZ1 and PR-10 genes in response to GA in wild-type seedlings. Two-week-old wild-type seedlings were treated with 10 µm GA3 for 24 h. Total RNA was extracted from the roots and shoots of the GA3-treated seedlings. Total RNA samples (10 µg per lane) were separated by agarose-formaldehyde gel electrophoresis and blotted onto nylon membrane. Gene-specific probes were amplified by PCR from full-length EST clones for osmotin, triosephosphate isomerase, PBZ1 and PR-10 (obtained from the DNA bank of the National Institute of Agrobiological Sciences). The blots were hybridized with the gene-specific probes.

We then determined whether the expression of these genes was regulated by GA by analysing their mRNA levels after exogenous GA application. No changes in osmotin or triosephosphate isomerase transcript levels were detected in shoots or roots by Northern analysis, and there was only a small increase in PR-10 gene expression after GA3 application (Fig. 2b). In contrast, PBZ1 gene expression in shoots was significantly increased by exogenous GA3 treatment. In roots, PBZ1 transcripts were barely detectable and did not respond to GA3 treatment (Fig. 2b).

Of the four highly accumulated proteins in gid1 suspension-cultured cells, three (osmotin, PBZ1 and PR-10; Table 1) are stress-inducible, indicating that the gid1 mutant might be in a stressed condition. To further characterize the stress-responsiveness of the four selected genes, we analysed their expression after various stress treatments. Wild-type seedlings were subjected to five different abiotic stresses (5 °C cold stress, 150 mm NaCl, 300 mm mannitol, 50 µm ABA and drought) and one biotic stress (infection with rice blast fungus, P. grisea). Osmotin gene expression was increased by NaCl treatment (Fig. 3a), indicating that the gene is induced by salt stress, but did not show any change with the other treatments. No changes in triosephosphate isomerase or PR-10 gene expression were observed under the stress treatments used in this study (Fig. 3a). In contrast, PBZ1 gene expression was enhanced by cold stress and by blast fungus infection (Fig. 3a).

Figure 3.

Expression of osmotin, triosephosphate isomerase, PBZ1 and PR-10 genes in response to stress treatments. (a) Two-week-old wild-type seedlings were subjected to with 5 °C cold stress, 150 mm NaCl, 300 mm mannitol, 50 µm abscisic acid (ABA) and drought for 6 h (left). Leaf blades of 3-week-old wild type were cut and infected with blast fungus (Pyricularia grisea) for 24 h (right). Total RNA was extracted from either the shoots of stress-treated seedlings or from the leaf blades. (b) Combined effect of GA3 and cold stress on PBZ1 expression. Two-week-old wild-type seedlings were treated with or without 10 µm GA3 for 24 h and then transferred to 5 °C for 6 h. Total RNA was extracted from the shoots. (c) Combined effect of GA3 and blast fungus infection on PBZ1 expression. Leaf blades of 3-week-old wild-type seedlings were cut and treated with or without 10 µm GA3 for 24 h and then inoculated with or without P. grisea for 24 h. Total RNA was extracted from the leaf blades. Total RNA samples (10 µg per lane) were separated by agarose-formaldehyde gel electrophoresis, and blotted onto nylon membrane. The blot was hybridized with the PBZ1-specific probe.

Because only PBZ1 gene expression was increased by GA3, cold stress and blast fungus infection in shoots of the wild type (Figs 2b & 3a), these responses were analysed in more detail. First, we investigated whether PBZ1 gene expression was controlled by both GA and cold stress signal transduction pathways. PBZ1 gene expression was increased by exogenous 10 µm GA3 or cold treatment applied independently, but transcript levels were significantly higher when cold stress was combined with GA3 application (Fig. 3b). Similarly, the effect of 10 µm GA3 and blast fungus infection on PBZ1 gene expression in leaf blades was greatly enhanced when these treatments were combined (Fig. 3c).

PBZ1 protein is induced to a high level in gid1 by cold stress

To assess the effect of increased PBZ1 expression under cold stress, the cold tolerance of gid1 and its wild type was analysed. After 5 d of cold stress at 5 °C, wild-type seedlings were wilted, but gid1 seedlings were not (data not shown). Seven days after being transferred back to normal growth conditions (25 °C), the cold-treated gid1 seedlings remained green and alive, while those of the wild type were dead (Fig. 4a). PBZ1 protein expression in the cold-stressed gid1 and wild-type seedlings was examined. PBZ1 accumulation was higher in gid1 than in the wild type, even under normal growth conditions, but was not increased by cold stress (Fig. 4b). In the wild type, on the other hand, the accumulation of PBZ1 was enhanced by cold treatment (Fig. 4b).

Figure 4.

Cold tolerance of gid1 and its wild type. (a) Two-week-old rice seedlings were treated at 5 °C for 5 d, and the plants were transferred back to non-stress conditions. Photograph shows the seedlings 7 d after transfer from the cold stress. (b) Accumulation of PBZ1 in gid1 and its wild type. Two-week-old seedlings were subjected to 5 °C for 24 h. Cytosolic protein (20 µg per lane) extracted from shoots was separated by SDS–PAGE and transferred onto a polyvinylidene difluoride (PVDF) membrane. The protein on the PVDF membrane was cross-reacted with anti-PBZ1 antibody (lower panel) and stained with Coomassie Brilliant Blue (CBB; upper panel).

Rice Ca2+-dependent protein kinase (CDPK) genes are regulated by cold stress

In some cases, abiotic stress signalling involves a transient increase in cytosolic Ca2+ (Xiong, Schumaker & Zhu 2002), which is then perceived by various Ca2+ binding proteins. CDPKs are major players in coupling this general inorganic signal to specific protein phosphorylation cascades. To clarify whether CDPKs are involved in cold tolerance, rice CDPK gene expression was analysed. The rice genome contains 29 CDPK genes (OsCPK1OsCPK29) and 8 closely related kinase genes (Asano et al. 2005). Among the 29 OsCPK genes, OsCPK7 and OsCPK23 were regulated by jasmonic acid (JA) treatment (Akimoto-Tomiyama et al. 2003), OsCPK9 was regulated by blast fungus (Asano et al. 2005) and OsCPK13, OsCPK15, OsCPK20 and OsCPK24 were regulated by elicitor treatment (Akimoto-Tomiyama et al. 2003). OsCPK1, OsCPK3, OsCPK9, OsCPK10, OsCPK17, OsCPK20 and OsCPK24 were detected in basal parts and/or leaf blade, and OsCPK21 was detected in immature seed (Asano et al. 2005).

Expression of these CDPK genes under cold stress was analysed by RT-PCR (Fig. 5a). OsCPK15, OsCPK20, OsCPK10 and OsCPK17 were expressed at the same levels in the wild type and gid1, and did not respond to the cold treatment. Expression of OsCPK7 decreased in the wild type and increased slightly in gid1 in response to cold stress. OsCPK23 and OsCPK24 both showed decreased expression in the wild type after cold treatment; in gid1, OsCPK24 transcript levels did not change and OsCPK23 was not expressed at all. OsCPK1 expression was slightly increased by cold stress in the wild type but not in gid1. Expression of OsCPK3 was completely abolished by cold stress in the wild type, whereas the transcript levels in gid1 were lower than in the wild type and were unaffected by cold stress. OsCPK9 and OsCPK21 were not detected in either genotype under these experimental conditions.

Figure 5.

Effect of cold stress on rice CDPK gene expression and endogenous abscisic acid (ABA) concentration. (a) Expression levels of OsCPK genes of 2-week-old seedlings of gid1 and its wild type following 5 °C cold treatment for 6 h. The transcript levels were determined by RT-PCR. The PCR cycle number is shown at the right. Actin was used as control. (b) Changes in endogenous ABA concentration. After 5 °C cold treatment for 24 h, shoots from gid1 and wild-type seedlings were collected, and competitive ELISA was performed using an ABA immunoassay detection kit. The values are averages of three experiments.

Gid1 has wild-type levels of endogenous ABA

It has been reported that exogenous application of ABA can harden plants against frost damage and that ABA concentration increases in plant tissues under various stress conditions such as dehydration, high salt concentration and low temperature (Ni & Bradford 1993). The endogenous ABA concentrations in shoots of gid1 and the wild type in relation to cold stress were analysed. After treatment at 5 °C for 24 h, the ABA concentrations were increased in both gid1 and the wild type, but the differences were not great (Fig. 5b).

Gid1 is involved in resistance to blast fungus

Because increased PBZ1 gene expression was also observed after blast fungus infection (Fig. 3a), the effect of PBZ1 accumulation on resistance to the fungus was analysed. Lesion sizes were measured 6 d after leaf blades of gid1 and the wild type were inoculated with blast fungus. Lesions were formed on both genotypes. On the wild type they were widespread while on gid1 they were more localized. In addition, the lesions on gid1 were smaller than those on the wild type (Fig. 6a). PBZ1 protein expression was examined in gid1 and wild-type leaf blades that had been inoculated with blast fungus. After mock infection, PBZ1 accumulation was higher in gid1 than in wild type. Both genotypes had much higher levels of the protein after blast fungus infection (Fig. 6b).

Figure 6.

Effect of blast fungus infection on gid1 and its wild type. (a) Lesions that formed on leaves infected with rice blast fungus (Pyricularia grisea). Leaf blades from 3-week-old seedlings of gid1 and its wild type were cut and inoculated with P. grisea. Photograph shows the inoculated leaves 6 d post-inoculation. The size of the lesions developed after inoculation with P. grisea is shown. The values are averages of 10 individual lesions. (b) Accumulation of PBZ1 in gid1 and its wild type. Leaf blades of 3-week-old seedlings were used. Cytosolic protein (20 µg per lane) extracted from leaf blades 6 d after being inoculated with P. grisea or after being mock-inoculated were separated by SDS–PAGE and transferred onto a polyvinylidene (PVDF) membrane. The protein on the PVDF membrane was cross-reacted with anti-PBZ1 antibody (lower panel) and stained with Coomassie Brilliant Blue (CBB; upper panel).

As described above, typical symptoms of blast fungus infection developed at the inoculation site in the wild type and they were surrounded by yellowish areas, whereas a resistant reaction consisting of brown necrosis appeared in the mutant (Fig. 6). The reaction of the host tissues was examined histologically. In the wild type, germination of conidia occurred on the surface of rice leaves inoculated with spore suspension. Appresoria were formed from the germination tube, and penetration was observed at the site of appresorium formation. After penetration, thick mycelia were formed and spread from the point of penetration through the motor cells. At later stages of infection, mycelial growth was observed in the lumina of xylem vessels. Slow cell death (necrosis) occurred around the areas of mycelial growth. In such tissues, mesophyll cells were stained dark blue. In gid1, appresoria also formed on the surface of the rice leaf after germination of conidia. Penetration was observed mainly in motor cells. After penetration, the mycelia grew among the motor cells to some extent. In gid1, however, a rapid necrotic response (hypersensitive reaction) occurred around the site of the fungal growth. Lignification was also observed around the site of infection. In addition, reaction materials that stained yellow were produced in the lumen of xylem vessels in vascular bundles at and around the site of infection. The walls of these xylem vessels became lignified. In the late stages of infection, the browned area of motor cells was collapsed (Fig. 7).

Figure 7.

Histological observation of a leaf blade of wild type and gid1 infected with Pyricularia grisea (Strain Kyu 89–246). Leaf blades from 3-week-old seedlings of gid1 and its wild type were cut and inoculated with P. grisea (Strain Kyu 89–246). (a) Cross section of a leaf blade of wild type showing necrotic tissues (dark blue area) caused by the infection. (b) Cross section of infected large vascular bundle. Filamentous hyphae are observed in the lumina of xylem vessels as well as in vascular bundle sheath and mestome sheath. (c) Longitudinal section of a leaf blade showing mycelial growth in the space of motor cells. (d) Cross section of a leaf blade of gid1showing hypersensitive cell death at the infection sites (arrows). (e) Cross section of necrotic area of hypersensitive cell death (arrow). Motor cells were shrunken after infection, and mycelia appear to be localized by the necrotic cell death. (f) Cross section showing reaction materials stained orange plugging lumina of large vascular bundle.

Copalyl diphosphate (CDP) synthase genes are expressed differentially in gid1 and its wild type

Rice produces ent-CDP and syn-CDP as precursors for GAs and several types of phytoalexins. Four rice CDP synthase (OsCPS) genes (OsCPS1, 2, 3 and 4) were identified in the rice genome, including one pseudogene (OsCPS3) (Sakamoto et al. 2004). OsCPS1 is involved in GA biosynthesis because the corresponding mutant showed severe dwarfing that was rescued by exogenous application of GA3 (Sakamoto et al. 2004). The expression of OsCPS2 and OsCPS4 was increased by UV irradiation and by elicitor treatment (Sakamoto et al. 2004). Otomo et al. (2004) and Prisic et al. (2004) reported independently that there were two ent-CDP synthase isoforms – one that participated in the biosynthesis of GAs and another that was involved in the biosynthesis of phytoalexins – and one syn-CDP synthase involved in the biosynthesis of phytoalexins. The genes corresponding to OsCPS2 and OsCPS4 were named OsCyc2 and OsCyc1 by Otomo et al. (2004), and OsCPS2ent and OsCPSsyn by Prisic et al. (2004).

In gid1, the level of endogenous GA was higher than that in the wild type. To determine whether this difference in GA levels was accompanied by changes in the expression of genes involved in ent-CDP and syn-CDP synthesis, OsCPS1, OsCPS2 and OsCPS4 transcript levels were measured. Semiquantitative reverse transcription (RT)-PCR analysis was performed for OsCPS1, OsCPS2 and OsCPS4 expression in shoots of the wild type treated with or without GA3 and of gid1 and Akibare-waisei (d18-AD), a mutant of the GA biosynthesis gene OsGA3ox2 (Sakamoto et al. 2004). In gid1, OsCPS1 expression was slightly lower while OsCPS4 expression was higher than in the wild type or the GA biosynthesis mutant (Fig. 8). OsCPS1 expression in Akibare-waisei was at the same level as in the wild type. Expression of OsCPS4 was lower in the wild type treated with GA3 and in Akibare-waisei than in the wild type without GA3 treatment (Fig. 8). Expression of OsCPS2 in gid1 was higher than in the wild type or the GA biosynthesis mutant. This expression level was higher than that of OsCPS4 (Fig. 8).

Figure 8.

Expression of rice CPS genes. Total RNA was isolated from shoots of wild type without GA3 treatment (Wild − GA), wild type with GA3 treatment for 24 h (Wild + GA), gid1 and Akibare-waisei (d18-AD). RT-PCR was conducted as described in Materials and methods, with 25, 28, 30 and 32 cycles of PCR. Actin was used as control.

DISCUSSION

One strategy for identifying GA-regulated proteins has been to analyse suspension-cultured cells of a GA response mutant by differential display of proteins using 2D-PAGE (Oguchi et al. 2004; Tanaka et al. 2004). In the present study, this strategy was used to survey the GA-regulated proteins in rice by analysing proteins from the GA insensitive mutant gid1. This analysis revealed 30 proteins that were accumulated differentially in gid1 compared with the wild type (Fig. 1). These proteins are involved in several functions, including stress responses, glycolysis, photosynthesis and energy generation (Tables 1 & 2) (Bevan et al. 1998). In rice, a few GA-regulated genes have been identified using microarrays. These are xyloglucan endotransglucosylase/hydrolase (XTR/XTH) (Uozu et al. 2000; Jan et al. 2004), β-tubulin and replication protein A1. Using a proteomic approach and gid1, we have obtained further information about the GA-regulated proteins in rice.

Among the GA-regulated proteins in gid1, there were several involved in stress responses (osmotin, PBZ1 and PR-10) and one involved in glycolysis/gluconeogenesis (triosephosphate isomerase). The transcript levels for these genes were higher in suspension-cultured cells of gid1 than in suspension-cultured cells of the wild type (Fig. 2a), showing that the accumulation of these proteins is regulated at the transcription level. Among the hyper-accumulated proteins in gid1, only PBZ1 gene expression was enhanced by GA3 treatment of the wild type, and this response was seen only in the shoots (Fig. 2b). Therefore, under these experimental conditions, the PBZ1 gene is expressed mainly in shoots and is controlled by GA concentration. PBZ1 is a protein that is induced by probenazole (Midoh & Iwata 1996; Komatsu et al. 2004). Since probenazole is known to induce non-race specific resistance in rice against rice blast fungus, PBZ1 behaves like a PR protein. Komatsu et al. (2004) reported that the Gα protein plays a role in the induction of PBZ1 and protein kinases by probenazole and Xoo, and suggested that the MAPK may be involved in a signalling pathway for resistance to bacterial infection. However, the function of PBZ1 is still unclear.

The expression of PBZ1 was enhanced by blast fungus infection (Fig. 3a), suggesting that at least some mechanisms of resistance to blast fungus are controlled by GA. In the defence of plants against pathogens, salicylic acid (SA), ethylene and JA are known to act as signal molecules (Contrath, Pieterse & Mauch-Mani 2002). Midoh & Iwata (1996) reported that PBZ1 gene was not induced after treatment with ethephon, an ethylene releasing agent, or NAA, which is induced by ethylene production. In addition, PBZ1 transcripts did not accumulate after treatment with sodium salicylate. In this study, PBZ1 gene expression was induced after treatment with GA3 (Fig. 2b), suggesting that PBZ1 is regulated by another mechanism for PR protein expression.

PBZ1 gene expression was enhanced by GA3 application, cold stress and blast fungus infection, and it was further enhanced by combined exposure to GA and stress (Fig. 3b & c). Furthermore, protein accumulation provided cold tolerance in gid1 (Fig. 4). These results suggest that in the regulation of PBZ1 gene expression, there is cross-talk between GA signalling and cold stress or defence signalling. In low temperature signal transduction, the transcription factor CBF/DREB1 controls the expression of genes responding to cold stress (Shinozaki & Yamaguchi-Shinozaki 2000). However, the promoter region of PBZ1 gene contains no DRE (A/GCCGACNN) sequences, suggesting that PBZ1 is controlled by a different cold-responsive regulation system.

Cold stress has been shown to induce transient Ca2+ influx into the cell cytoplasm (Xiong et al. 2002). The transient increases in cytosolic Ca2+ are perceived by various Ca2+ binding proteins. CDPKs couple this universal inorganic signal to specific protein phosphorylation cascades (Xiong et al. 2002). In rice plants, a membrane-associated CDPK was activated by cold treatment (Martin & Busconi 2001). In addition, overexpression of OsCDPK7 resulted in increased cold and osmotic stress tolerance in rice (Saijo et al. 2000). Furthermore, OsCDPK13 was induced by GA treatment and by cold stress (Abbasi et al. 2004). Thus, CDPKs may play roles in the development of stress tolerance and the GA response. In this study, some rice CDPK genes were regulated by cold stress (Fig. 5a), but none had clearly increased expression. This result suggests that increased CDPK gene expression is not required for PBZ1 expression under cold stress. However, the effect of cold stress on rice CDPK activities remains to be analysed.

The ABA concentration in gid1 was the same as in the wild type, suggesting that the PBZ1 accumulation in gid1 was not mediated by ABA signal transduction. Many abiotic stress-inducible genes are controlled by both ABA-dependent and ABA-independent regulatory systems (Shinozaki & Yamaguchi-Shinozaki 2000). These genes contain potential ABA-responsive elements (ABREs; PyACGTGGC) in their promoter regions (Shinozaki & Yamaguchi-Shinozaki 2000). No ABREs were found in the promoter region of PBZ1. While gid1 had the same level of endogenous ABA as the wild type under unstressed conditions, the mutant had more PBZ1 protein (Fig. 4b). This result suggests that cold-induced PBZ1 expression in rice is not regulated by ABA or CDPK-transduced signals. The highly regulated PBZ1 gene provides a good starting point for further research into possible interactions among the components of stress signalling pathways.

Resistance of the gid1 mutant to rice blast fungus (Figs 6a & 7) and the hyper-accumulation of PBZ1 in the mutant (Fig. 6b) suggest that the resistance to rice blast is caused by the accumulation of PBZ1. Plant cells undergoing pathogen attack induce PR proteins and accumulate phytoalexins (Bol et al. 1990). PBZ1 protein was found as multiple spots and was induced to high levels by blast fungus infection in suspension-cultured cells of rice (O. sativa) (Kim et al. 2003). This suggests that PBZ1 accumulation in rice plays an important role in resistance to rice blast.

The OsCPS genes encode enzymes at the branch point between GA and phytoalexin biosynthesis. In previous studies, OsCPS2 (OsCPS2ent, OsCyc2) and OsCPS4 (OsCPSsyn, OsCyc1) were found to be induced by UV irradiation, MeJA treatment and elicitor treatment (Otomo et al. 2004; Prisic et al. 2004; Sakamoto et al. 2004). The increased endogenous GA and PBZ1 protein in gid1 suggests that these branch point genes might be regulated differentially in the mutant as compared to the wild type. In gid1, OsCPS1 was expressed at a slightly lower level and OsCPS4 was expressed at a higher level than in the wild type (Fig. 8). This result indicates that there is feedback regulation of GA biosynthesis at this step and that biosynthesis of the phytoalexins momilactones A-B and oryzalexin S is increased by the elevated endogenous GA level in gid1. In the wild type treated with GA3, OsCPS4 was expressed at a lower level indicating that this gene is negatively regulated downstream of the GA signal. These results suggest that the expression of PBZ1 is regulated by GA signalling and stress stimuli, and that gid1 is involved in tolerance to cold stress and resistance to blast fungus.

ACKNOWLEDGMENTS

We thank the DNA bank of National Institute of Agrobiological Sciences for providing EST clones and Dr K. Umemura in Meiji Seika for providing anti-PBZ1 antibody. This work was supported by the Program for Promotion of Basic Research Activities for Innovative Biosciences.

Ancillary