Allelochemical stress causes inhibition of growth and oxidative damage in Lycopersicon esculentum Mill

Authors


Rocio Cruz-Ortega. Laboratorio de Alelopatía, Departamento de Ecología Funcional, Instituto de Ecologia, Universidad Nacional Autónoma de México, Circuito Exterior, Ciudad Universitaria, 04510 México; Fax: (52/55) 56161976; e-mail: rcruz@miranda.ecologia.unam.mx

ABSTRACT

The aim of this study was to analyse the effect of allelochemical stress on Lycopersicon esculentum growth. Our results showed that allelochemical stress caused by Sicyos deppei aqueous leachate inhibited root growth but not germination, and produced an imbalance in the oxidative status of cells in both ungerminated seeds and in primary roots. We observed changes in activity of catalase (CAT), ascorbate peroxidase (APX), superoxide dismutase (SOD), glutathione reductase (GR) and the plasma membrane NADPH oxidase, as well as in the levels of H2O2 and O2•− in seeds at 12 and 24 h, and in primary roots at 48 and 72 h of treatment, which could account for the oxidative imbalance. There were changes in levels of expression of the mentioned enzymes, but without a correlation with their respective activities. Higher levels of membrane lipid peroxidation were observed in primary roots at 48 and 72 h of treatment. No effect on the expression of metacaspase and the PR1 was observed as indicators of cell death or induction of plant defence. This paper contributes to the understanding of plant–plant interactions through the phytotoxic allelochemicals released in an aqueous leachate of the weed S. deppei, which cause a negative effect on other plants.

INTRODUCTION

Allelopathic interactions are mediated by secondary metabolites (allelochemicals) released from donor plants to the environment, and have an influence on growth and development in both natural and agro-ecosystems (Inderjit & Duke 2003). These allelochemicals belong to a diverse chemical group and have different sites and modes of biochemical action. In general, when the effect of these allelochemicals decreases growth on the receiver plant, it is considered as a biotic stress called ‘allelochemical stress’ (Cruz-Ortega, Ayala-Cordero & Anaya 2002; Reigosa et al. 2002; Romero-Romero, Anaya & Cruz-Ortega 2002). This environmental stress factor can act as a mechanism of interference and can influence the pattern of vegetation, weed growth and crop productivity (Dakshini, Foy & Inderjit 1999; Weir, Park & Vivanco 2004).

On the other hand, Sicyos deppei G. Don (Cucurbitaceae), locally known as atatana or chayotillo, is an endemic weed that grows in the temperate central part of Mexico (Lira et al. 1998; Lira, Villaseñor & Ortiz 2002). It grows extensively and aggressively climbs over other plants. This rapid growth allows S. deppei to quickly cover the soil and to eliminate other weeds almost completely. Sicyos deppei is also considered a very harmful weed in field crops, decreasing productivity (Villaseñor & Espinosa 1998). Previous studies in our laboratory have shown that the weed S. deppei has a strong allelopathic potential and a phytotoxic effect on other plants (Hernández-Bautista, Torres & Anaya 1996; Anaya 1999). Subsequent studies on the mode of action of the allelochemical stress produced by aqueous leachate of S. deppei caused inhibitory effects on H+-ATPase activity as well as oxidative damage, evidenced by membrane lipid peroxidation and an increase in catalase activity in addition to an enhanced reactive oxygen species (ROS) (Romero-Romero et al. 2005). Other studies also have shown that allelochemical stress can cause oxidative damage (Cruz-Ortega et al. 2002; Bais et al. 2003; Weir et al. 2004; Sánchez-Moreiras & Reigosa 2005; Abenavoli et al. 2006). Base on this evidence, we wanted to investigate more about the effects of S. deppei on the antioxidant system of tomato, and if an imbalance in early germination stages could be related with the root inhibition observed, as well as to answer if this stress induced either defence or cell death responses. For these reasons, the purpose of the present study was to analyse the effects of allelopathic stress caused by S. deppei aqueous leachate on Lycopersicon esculentum at the biochemical and molecular level, particularly on activities and expression of the antioxidant enzymes such as catalase (CAT), ascorbate peroxidase (APX), superoxide dismutase (SOD), glutathione reductase (GR) and membrane NADPH oxidase. We also examined levels of H2O2 and O2•−, and membrane damage as lipid peroxidation. To evaluate if allelochemical stress could induce cell death or induce expression of defence proteins, we analysed the expression of the genes for caspase LeMCA1 and for a pathogenesis-related protein, PR1. All these measurements were made in seeds treated for 12 and 24 h, and in primary roots from 48 and 72 h of stress treatment.

MATERIALS AND METHODS

Plant material

Live aerial parts from the allelopathic weed S. deppei were collected in a crop field in the Mexico basin. Plant materials were air-dried (27–30 °C) as was previously established in the laboratory (Hernández-Bautista et al. 1996; Cruz-Ortega et al. 1998; Romero-Romero et al. 2002, 2005). This dry plant material was used to prepare an aqueous leachate.

Test plant

Seeds of tomato (L. esculentum, Mill. cv. Rio Grande, Solanaceae) were obtained from Sun Seeds, Parma, ID, USA.

Bioassays

Allelopathic aqueous leachate was prepared by soaking dried leaves of S. deppei (1 g/100 mL) in sterile-distilled water for 3 h. This leachate was filtered through Whatman paper (No. 4; Whatman International Ltd., Maidstone, England) and then through two sterile Millipore membranes (0.45 and 0.2 µm; Millipore Corporation, Bedford, MA, USA) to prevent any further contamination that could change the quality of the allelochemicals present in this aqueous leachate. The osmotic potential of the aqueous leachate of S. deppei was measured by using a freezing-point osmometer (Osmette A; Precision System Inc., Natick, MA, USA).

Bioassays were performed under sterile conditions in a laminar flow hood. Tomato seeds were germinated in Petri dishes (60 mm) containing aqueous leachate (1% w/v) of S. deppei with 1% of agar as substrate, for a final concentration of 0.5%. For controls, seeds were germinated in 1% agar. Twelve seeds were placed on each Petri dish and kept in the dark at 27 °C in a growth chamber. After 12 and 24 h of incubation, seeds, which at this time had not yet germinated, were collected for analysis. For 48 and 72 h treatments, primary roots were excised from germinated seeds, then frozen in liquid nitrogen and kept at −70 °C until use.

Enzyme assays

All spectrophotometric analyses were conducted with a Varian Spectrophotometer (Varian Australia Pty Ltd., Mulgrave, VIC, Australia). For enzyme activities, total protein was extracted from controls and treatments at 12, 24, 48 and 72 h under native conditions. Seeds from 12 and 24 h treatments, and primary roots from 48 and 72 h treatment, were homogenized in an extraction buffer containing 50 mM potassium phosphate, pH 7.0, 1 mM ethylenediaminetetraacetic acid (EDTA) and 1% of polyvinylpoly-pyrrolidone (PVP) at a ratio of 100 mg/mL, for CAT and GR; and with 1 mM ascorbate for APX activity. The homogenate was centrifuged at 3000 g for 10 min at 4 °C to remove cellular debris. Protein concentration was determined according to Bradford (1976).

CAT (EC 1.11.1.6)

CAT activity was determined by following the consumption of H2O2 (extinction coefficient 39.4 mM−1 cm−1) at 240 nm for 3 min (Aebi 1984). The reaction medium contained 50 mM potassium phosphate buffer (pH 7.0), 10 mM H2O2 and 50 µg of protein extract in a 1 mL volume.

APX (EC 1.11.1.11)

APX activity was determined by following the decrease in A290 (extinction coefficient 2.8 mM−1 cm−1) for 1 min in 1 mL of a reaction medium containing 50 mM potassium phosphate buffer (pH 7.0), 0.5 mM ascorbic acid (ASC), 0.1 mM H2O2, 50 µg protein extract (Jiang & Zhang 2002a). Correction was made for the low, non-enzymatic oxidation of ASC by H2O2.

GR (EC 1.6.4.2)

GR activity was determined by following the oxidation of NADPH at 340 nm (extinction coefficient 6.2 mM−1 cm−1) for 3 min in 1 mL reaction medium, containing 50 mM potassium phosphate buffer (pH 7.8), 2 mM EDTA, 0.15 mM NADPH, 0.5 mM GSSG and 50 µg of protein extract. The reaction was initiated by adding 0.15 mM NADPH. Corrections were made for the background absorbance at 340 nm without NADPH (Jiang & Zhang 2002a).

SOD (EC 1.15.1.1)

SOD activity was assayed by following the autoxidation of epinephrine (adenochrome) as described by Misra & Fridovich (1972), using the extinction coefficient of 4020 M−1 cm−1. Briefly, 250 mg of each tissue was homogenized with 1 mL of 100 mM potassium phosphate buffer (pH 7.8) and 0.1 mM EDTA, centrifuged at 6000 g for 10 min at 4 °C. Activity was measured in a final volume of 0.5 mL of the reaction medium containing 50 mM of sodium carbonate buffer (pH 10.2), 0.5 mM EDTA, 50 µL protein extraction and 0.5 mL of 10 mg/mL epinephrine (dissolved in 10 mM HCl, pH 2.0). Autoxidation of epinephrine was determined at 480 nm every 10 s for 3 min, considering only readings after lag phase (2–3 min). Activity is reported as µmol adenochrome/min/mg protein. Superoxide levels (O2•−) were determined using the slope of data previous to the lag phase and divided by the milligram of protein.

H2O2

H2O2 content was colorimetrically measured as described by Jana & Choudhuri (1981). H2O2 was extracted by homogenizing 50 mg of tissue with 0.75 mL of 50 mM phosphate buffer (pH 6.5). The homogenate was centrifuged at 6000 g for 25 min, and the 0.75 mL of extracted solution (supernatant) was mixed with 0.25 mL of 0.1% titanium sulfate in 20% (v/v) H2SO4. The mixture was then centrifuged at 6000 g for 15 min and the intensity of the yellow colour was measured at 410 nm. H2O2 level was calculated using the extinction coefficient 0.28 µmol−1 cm−1.

NADPH oxidase (EC 1.1.3.1) activity

Preparation of plasma membrane vesicles (PMs)

Samples were homogenized in four volumes of the extraction buffer containing 50 mM HEPES-KOH (pH 7.2), 0.25 M sucrose, 3 mM EDTA, 1 mM dithiotreitol (DTT), 0.6% PVP, 3.6 mM L-Cys, 0.1 mM MgCl2, 2 mM phenylmethylsulfonylfluoride (PMSF) and 10 µg/mL each of protease inhibitors aprotinine, leupeptine and pepstatine. Then the homogenate was filtered through two layers of cheesecloth and the resulting filtrate centrifuged at 10 000 g for 45 min. Microsomal membranes were pelleted from the supernatant by centrifugation at 203 000 g for 60 min. The pellet was homogenized in 0.33 M sucrose, 3 mM KCl, 5 mM potassium phosphate (pH 7.8) and 10 µg/mL each of the protease inhibitors. The plasma membrane vesicles from seeds and primary roots were isolated using the two-phase aqueous polymer partition system according to Larsson, Widell & Kjellbom (1987). Phase separations were carried out in a series of 7.7 g phase system with a final composition of 6.2% (w/w) dextran T500 (Sigma Chemical Co., St. Louis, MD, USA), 6.2% (w/w) PEG 3350, 0.33 M sucrose, 5 mM potassium phosphate (pH 7.8), 3 mM KCl and 10 µg/mL protease inhibitors. Three successive rounds of partitioning yielded the final upper phase (U3). The combined upper phase was enriched in plasma membrane vesicles, and it was diluted fivefold in ice-cold 10 mM Tris-HCl dilution buffer (pH 7.4) containing 0.25 M sucrose, 3 mM EDTA, 1 mM DTT, 3.6 mM L-Cys, 0.1 mM MgCl2 and 10 µg/mL protease inhibitors. The fractions were centrifuged at 203 000 g for 60 min, and pellets were resuspended in a small volume of 10 mM Tris-HCl (pH 7.4) dilution buffer and used immediately for further analysis. All procedures were carried out at 4 °C.

Determination of NADPH oxidase activity of PMs

The NADPH-dependent O2•− generating activity was determined by a modified assay based on the reduction of XTT by O2•− (Able, Guest & Sutherland 1998; Sagi & Fluhr 2001). The assay mixture of 250 µL contained 50 mM Tris-HCl buffer (pH 7.5), 0.5 mM sodium, 3′[1-[phenylaminocarbonyl]-3,4-tetrazolium]-bis(4-methoxy-b-nitro) benzenesulphonic acid hydrate (XTT), 100 µM NADPH and 10 µg of membrane proteins. The reaction was initiated with the addition of NADPH, and XTT reduction was determined at 470 nm in an ELISA plate reader (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Corrections were made for background production in the presence of 50U of Cu-Zn-SOD. Rates of O2•− generation were calculated using the extinction coefficient 2.16 × 104 M−1 cm−1.

Membrane lipid peroxidation

To determine if free radicals caused oxidative damage, the presence of conjugated dienes as a product of membrane lipid peroxidation was measured by their absorption in the ultraviolet range (233 nm), according to the method of Recknagel & Glende (1984). Briefly, 0.5 mg of protein from each treatment was dissolved in 1 mL of H2O and 4 mL of a mixture of chloroform–methanol (2:1 v/v). This mixture was placed in ice for 30 min and then centrifuged at 260 g for 5 min. The chloroform layer was removed and transferred to a clean tube and placed in a water bath at 60 °C to remove the chloroform. The extracted chloroform-free lipids were dissolved in 1.6 mL cyclohexane and optical density was recorded at 233 nm.

Total RNA extraction and semi-quantitative reverse transcriptase polymerase chain reaction (RT-PCR)

Total RNA was isolated from all treatments using RNeasy plant minikit (Qiagen Inc., Valencia, CA, USA) according to the supplier’s protocol. Synthesis of cDNA and PCR was performed from 1 µg of total RNA, utilizing One-Step kit (Invitrogen Life Technologies, Carlsbad, CA, USA). PCR reactions were performed with specific primers (Table 1). The RT-PCR mix contained 2 µL of the template, 0.2 mM dNTPs, 0.5 mM primers (forward and reverse), 1.5 units of RT, 1.5 units of Taq polymerase (Invitrogen) and 1 × PCR buffer (supplied from Invitrogen with RT and Taq polymerase) in a final volume of 50 µL. RT-PCR was carried out in a programmable Primus Thermal Cycler (Hybaid Limited, Ashford, Middlesex, UK) with an annealing temperature of 55 °C. For semi-quantitative RT-PCR, the cycle number in the linear range was empirically determined. RT-PCR conditions were 50 °C for 30 min and 94 °C for 2 min, then, 94 °C for 15 s, 55 °C for 30 s and 70 °C for 1 min for 35 cycles, and final extension 72 °C for 10 min. The products of PCR amplification produced a single band at the predicted sizes of 454 bp for APX, 419 bp for Cu-Zn-SOD, 419 bp for CAT2, 469 bp for NADPH oxidase, 479 bp for GR, 408 bp for LeMCA1 and 447 bp for PR1. All these products were cloned with pGEM-Teasy Vector System 1 (Promega, Madison, WI, USA) and sequenced to confirm that products corresponded to the sequence of each clone. PCR products were analysed on 1.5% (w/w) agarose gel containing 0.5 µg mL−1 ethidium bromide. Gels were scanned and photographed for analysis in a multiImager fluor-S (Bio-Rad). PCR amplifications were carried out at least three times in a separate way.

Table 1.  Set of PCR primers used to amplify gene-specific regions in the semi-quantitative reverse transcriptase polymerase chain reaction (RT-PCR) experiments
cDNAPrimer sequence (5′ → 3′)LocationSize (bp)Accession no.
ActinSenseTCATGCGTCTGACTGTGGAT579–599402U60482
AntisenseCAGCTTCCATTCCGATCATT961–981
Superoxide dismutaseSenseTTGAATTGTGGGTGTTTGAGA54–75419AW032265
AntisenseTCGCCAATAGCCTTTAGCTC452–473
Ascorbate peroxideSenseAAGGCCACATTCTGTCATCC256–276454AF413573
AntisenseCAGGTCTTGATCTCCCCAAA690–710
CAT2SenseTGCTCCAAAGTGTGCTCATC1120–1140419AF112368
AntisenseTTGCATCCTCCTCTGAAACC1519–1539
Gluthathione reductaseSenseAGAAGCTCGCGACATTTGAT79–99479AW03337
AntisenseGTAAACGCCAAAACCTTCCA538–558
NADPH oxidaseSenseCAGAGCTGACGAAAACACCA259–279469AF109150
AntisenseCACTCATGTCCGAGTTTCCA708–728
PR1SenseTCTTGTGAGGCCCAAAATTC56–86447AW034882
AntisenseAGCAACATGTCAGAAATAGACGA480–503
LeMCA1SenseTGGGAAACTTAGGCCAACAC714–734408AW034667
AntisenseTTGGTGACTGGACCATCTGA1102–1122

Statistical analysis

Enzyme activity data were analysed by a one-way analysis of variance, and then a comparison by Tukey test was carried out to check the significant differences at P < 0.05. Statistical analysis was conducted using the STATISTICA software package v 6.0 (Statsoft, Inc., Tulsa, OK, USA).

RESULTS AND DISCUSSION

Effects of allelochemical stress on antioxidant enzymes activities

We have reported earlier that the aqueous leachate of S. deppei caused a strong allelochemical stress on L. esculentum growth (Romero-Romero et al. 2005). In this study we analysed the effect of this aqueous leachate at the early germination stages (12 and 72 h), and after germination in primary roots at 48 and 24 h of treatment. Figure 1 shows that radicle growth of L. esculentum was significantly inhibited at 48 and 72 h by S. deppei allelochemicals, but did not affect the germination rate. To determine if this phytotoxic effect occurs through oxidative stress, we analysed the activity of some antioxidant enzymes involved in the detoxification and balance of ROS, levels of O2•− and H2O2, as well as membrane damage by means of lipid peroxidation (Fig. 2a–h). CAT activity significantly decreased at 12 and 24 h (32 and 60%, respectively), but increased in primary roots at 48 and 72 h (29 and 52%, respectively) (Fig. 2a). An increase in CAT activity has also been observed in other studies on allelochemical modes of action, that is, ferulic acid increased CAT activity in maize seedlings (Devi & Prasad 1996), and benzoic acid in cucumber cotyledons (Maffei et al. 1999). On the other hand, activity of APX in both seeds at 24 h and in primary roots at 72 h significantly decreased (44 and 57%, respectively) (Fig. 2b). Activity of CAT and APX might be correlated with the levels of H2O2 measured; both of these enzymes consume hydrogen peroxide; however, they showed inversely correlated activities. Seeds at 12 h of treatment showed low levels of H2O2 (50% less than control), followed by a significant increase up to 77% at 24 h; however, in primary roots, levels were lower in both 48 and 72 h (Fig. 2c). The higher levels of H2O2 at 24 h could be due to the low activity of CAT and APX observed at this time (Fig. 2a & b). Simultaneously, increased H2O2 could have triggered the increase of CAT observed at 48 and 72 h, at which times H2O2 levels were low. However, APX activity was similar to the control at 48 h, but its activity decreased at 72 h. CATs are distinguished by very high turnover number but low affinity to H2O2, thus providing a very efficient tool for the gross removal and control of high H2O2 concentrations, but they are less suited for a fine-tuning of sensitive redox balances with low H2O2 concentrations, which may be important for a regulatory mechanism. In contrast, APX plays an important role to control the steady state level of H2O2 use for cellular signalling and has a high affinity for H2O2, yet its activity depends on the concentration of ascorbate as a reductant (Mittler & Poulos 2005).

Figure 1.

Effect of the aqueous leachate of S. deppei (S) on L. esculentum growth. 12 h (a); 24 h (b); 48 h (c); 72 h (d). Control (C); Sicyos deppei (S). Radicle growth is significantly inhibited (70%) at 48 and 72 h of treatment.

Figure 2.

Activity of (a) catalase, (b) ascorbate peroxidase, (c) levels of H2O2, (d) glutathione reductase, (e) superoxide dismutase, (f) O2•−, (g) NADPH oxidase, and (h) lipid peroxidation of seeds and roots of Lycopersicon esculentum treated with Sicyos deppei aqueous leachate (*P < 0.05). FW, fresh weight.

GR is another enzyme that is involved, along with APX, in H2O2 scavenging in plant cell, and both have been well established in the ascorbate–glutathione or Asada–Halliwell–Foyer pathway (Polle 2001). Our results show that GR activity in treated seeds at 12 and 24 h, and primary roots at 48 h had lower activity than controls (by 21, 70 and 33%, respectively), at 72 h activity was recovered to the control level (Fig. 2d). This decrease in GR activity would result in an imbalance of the cycle ascorbate–glutathione, thus affecting APX activity at the same time, so it would be interesting to measure pools of ascorbate and glutathione under S. deppei allelochemical stress.

Within a cell, the SODs are considered the first line of defence against ROS, as well as key enzymes in the regulation of intracellular concentration of O2•−, and in the oxidative balance of the cell. In this study, Cu-Zn-SOD activity showed a significant increase at 24 h (58%), and then in primary roots at 72 h the activity decreased (25%) (Fig. 2e). In addition, levels of superoxide (O2•−) were low in primary roots at 48 and 72 h of treatment (24 and 15%, respectively) (Fig. 2f). These results agree with other studies that have described SOD activity under allelochemical stress. It has been reported that secalonic acid F, isolated from Aspergillus japonicus, significantly reduced SOD and POD activity in seeds of rape, cucumber, corn and sorghum (Zeng et al. 2001). Likewise, aqueous extracts from rice blocked SOD activity in barnyard grass (Lin, Kim & Sgub 2000). Recently, Sánchez-Moreiras & Reigosa (2005) have shown that 2(3H)-Benzoxazolinone (BOA) severely inhibited SOD activity (50%) of treated lettuce leaves and roots.

It is well known that NAD(P)H-oxidoreductases are responsible for ROS production in the regulation of defence strategies upon infection with pathogens (Mehdy et al. 1996). Here, we determined if the plasma membrane NADPH oxidase could be involved in the production of ROS during allelochemical stress. Interestingly, in seeds at 24 h, NADPH oxidase activity increased significantly by 36%, but in primary roots at 48 h, NADPH oxidase activity began to diminish and was down by 67% at 72 h (Fig. 2g). This inhibition of membrane NADPH oxidase may be associated with membrane damage caused by both the generation of ROS at 24 h and by a direct interaction of S. deppei components to the membrane. Figure 2h shows that levels of lipid peroxidation increase in primary roots at 48 and 72 h (21- and 16-fold). Previously, we have observed that S. deppei aqueous leachate causes plasmolysis in bean and bottle guard roots (Cruz-Ortega et al. 1998), and inhibition of the H+-ATPase of plasma membrane and tonoplast of tomato roots (Romero-Romero et al. 2005).

On the other hand, there are studies that show that NADPH oxidase activity controls root development and growth by generating ROS, which regulate cell expansion through the activation of Ca2+ and K+ channel in plasma membrane of root cells (Demidchik et al. 2003; Foreman et al. 2003). Thus, the inhibition of tomato root elongation caused by S. deppei allelochemicals might be due in part to the inhibition of NADPH oxidase, and the subsequent reduction in root ROS (i.e. lower levels of H2O2 and superoxide, Fig. 2c & f). Liszkay, van der Zalm & Schopfer (2004) mentioned that inhibition of NADPH oxidase activity suppresses elongation of maize roots. Evidently, further studies are needed to clarify the role of this enzyme, ROS and Ca2+levels in root growth during the allelochemical stress.

Expression of the antioxidant enzymes by semi-quantitative RT-PCR

Gene expression in response to environmental stress is usually studied at the level of steady-state mRNA abundance but this often does not correlate with the level of enzyme activity, because of post-transcriptional regulation. Thus, in order to investigate if expression of antioxidant enzymes were regulated during allelochemical stress, we performed semi-quantitative RT-PCR in tomato seeds after 12 and 24 h, and in primary roots at 48 and 72 h of treatment (Fig. 3). Levels of cCAT expression of both control and treatment showed no difference between them; only a slight increase was observed at 12 h and in primary roots at 48 h treatment. cAPX expression levels in treated seeds at 12 h were lower, and in primary roots at 72 h treatment, a considerable increase was observed. Furthermore, levels of cSOD were higher at 72 h with no difference between control and treatment. Levels of cGR in 12- and 72-h-treated seeds were higher than in control ones. Finally, we observed an increase in NADPH oxidase at 12, 24 and 48 h (Fig. 3). As it is observed in Figs 2 and 3, neither of the expression of the enzymes is correlated with enzyme activity, suggesting that changes in activity must occur through post-transcriptional control. Various studies have focused on the changes in activities and expression of these antioxidant enzymes in plants subjected to abiotic and biotic stresses (high light, sulphur dioxide, drought, ozone, temperature, salt, pathogens) (Madamanchi et al. 1994; Mittler & Zilinskas 1994; Broadben et al. 1995; Jiang & Zhang 2002b; Goel, Goel & Sheoran 2003); but unfortunately similar studies in plants under allelochemical stress have only been focused in enzyme activity.

Figure 3.

Effect of allelochemical stress (Sicyos deppei aqueous leachate) on expression of genes encoding antioxidant enzymes, and membrane NADPH oxidase of seeds and primary roots of Lycopersicon esculentum. Semi-quantitative reverse transcriptase polymerase chain reactions (RT-PCRs) were performed using total RNA extracted from control and treated seeds and excised roots at 12, 24, 48 and 72 h. Specific primers for actin were used as internal control of RT-PCR. Control (C); treatment-S. deppei (S). Numbers at the right site indicate product size in bp. CAT, catalase; APX, ascorbate peroxidase; SOD, superoxide dismutase; GR, gluthathione reductase.

With regard to NADPH oxidase transcript levels, our results showed an increase in treated seeds at 12 and 24 h, which correlates with a higher activity of the enzyme; however, no changes in expression were observed in primary roots at 48 and 72 h, and activity was significantly inhibited at these times.

Effect of allelochemical stress on caspase LeMCA1 and PR1 expression

Given that S. deppei significantly inhibited radicle growth in tomato (70% at 48 and 72 h; Romero-Romero et al. 2005), we wanted to see if allelochemical stress could be inducing either cell death through programmed cell death (PCD) or defence responses, as it is in response to pathogens and other abiotic stresses (Greenberg 1996). For this, we evaluated the expression of the genes for caspase LeMCA1 (AW034882) and for a PR protein, PR1 (AW034667). Figure 4 shows the expression pattern of caspase and PR1 genes. The metacaspase gene (LeMCA1), which is up-regulated during PCD in Botrytis cinerea-infected leaves (Hoebericht, ten Have & Woltering 2003), was not induced; its expression remained constant within time and within treatments. On the other hand, we did not observe DNA laddering neither in seeds nor in primary roots in the different times of treatment (data not shown). In contrast, PR1 expression showed two patterns: interestingly at 12 and 24 h, PR1 is constitutively expressed in both control and treated seeds being in the latter higher. In primary roots at 48 and 72 h, PR1 expression was greatly reduced relative to seeds, and was not substantially altered by the allelochemical stress. PR genes are induced by pathogens in a variety of plants; however PR1 has been found in tobacco stamens, suggesting a role not directly related to disease resistance (Lotan, Ori & Fluhr 1989). Cooper et al. (2003) bring up that a rice homologue to PR1 was induced by rice blast and that interacted with several different seed and pollen prolamins and glutelin; they suggest that the interaction of PR1 with seed storage proteins portends a chaperone activity or an ability to provide osmotic stability under stress conditions.

Figure 4.

Effects of allelochemical stress caused by Sicyos deppei on caspase (CAS) and PR1 expression in Lycopersicon esculentum seeds at 12 and 24 h, and in primary roots at 48 and 72 h of treatment. Numbers at the right site indicate product size in bp.

Finally, we considered important to understand more about the modes of action of the allelochemical effect of this aggressive weed, using an aqueous leachate (water soluble fraction) because in nature, what the plants have to face is a mixture of these compounds. In the fields, S. deppei leaves and stems get dry on the soil, and whenever it rains, the phytotoxic allelochemicals are released, thus affecting the growth and development of other plants. We are currently performing a biodirected fractionation of S. deppei to isolate and characterize the main compounds responsible for the phytotoxic effect of this weed on plant growth. Thus, this study contributes to the understanding of plant–plant interactions through the effects of the allelochemicals released to the environment and causing a negative effect on target plants.

ACKNOWLEDGMENTS

This work was supported by grants from the Dirección General de Asuntos del Personal Académico (PAPIIT IX 201904 and IN 205705) from the Universidad Nacional Autónoma de México, UNAM. We also acknowledge comments and English revision of Dr James D. Ownby from Oklahoma State University.

Ancillary