SEARCH

SEARCH BY CITATION

Keywords:

  • ammonium;
  • gene expression;
  • nitrate

ABSTRACT

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES

In this work, we investigated the effects of pH and nitrogen forms on iron homeostasis and the expression profiles of genes involved in iron uptake and metabolism using tomato cultivar T3238 and its iron-inefficient mutant T3238fer. We showed that high external pH led to increased expression of four iron uptake genes (LeIRT1, LeIRT2, LeFRO1, LeNRAMP1) regardless of the nitrogen sources. Interestingly, the transcript level of FER was decreased at high pH and increased at low pH. In iron-inefficient mutant T3238fer, the expression of LeFRO1, LeIRT1 and LeNRAMP1 was much less than wild type under the culture conditions with high pH and on the non-buffered agar medium with NO3- as the sole N source, demonstrating that FER protein is required for the increased expression of LeFRO1, LeIRT1 and LeNRAMP1 under culture conditions with high pH. Considering the paradoxical expression patterns of FER to LeFRO1, LeIRT1 and LeNRAMP1 in T3238, we speculate that FER is essential, but is not the limited factor for the transcriptional regulation of the three iron uptake genes. In conclusion, the alteration of rhizosphere pH by assimilating NO3- or NH4+ influenced Fe availability and consequently affected iron homeostasis in tomato. The enhanced expression of LeFRO1, LeIRT1 and LeNRAMP1 under the culture condition with high pH or on agar media with NO3- as the sole N source might be a consequence of reduced iron availability in the solution or agar medium at high pH.


INTRODUCTION

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES

Iron deficiency, one of the major abiotic stresses affecting plant growth and development, often occurs in calcareous soils as a result of the extremely low solubility of iron at aerobic environments and neutral or basic pH. The characteristic symptoms of iron deficiency are chlorosis in young leaves and growth depression, resulting in decreased yield and food quality. During the past decade, some progress has been made in understanding the molecular mechanisms of iron uptake and homeostasis in plants of so-called strategy I type (Marschner & Römheld 1994). Several genes involved in iron deficiency responses and homeostasis have been isolated and characterized, such as iron-regulated transporters (Eide et al. 1996; Eckhardt, Marques & Buckhout 2001; Vert et al. 2001, 2002; Connolly, Fett & Guerinot 2002), ferric chelate reductases (FCRs) (Robinson et al. 1999; Waters, Blevins & Eide 2002; Connolly et al. 2003; Li, Cheng & Ling 2004; Wu et al. 2005) and transcription factors (Ling et al. 2002; Colangelo & Guerinot 2004; Jakoby et al. 2004; Yuan et al. 2005).

Nitrate (NO3-) is a main N source for plant growth. However, utilization of nitrate in agriculture often induces chlorosis in some plants (Mengel & Geurtzen 1988; Kosegarten, Wilson & Esch 1998). The chlorosis was found to be caused by iron deficiency as it could be completely recovered by exposure of the plants to iron (López-Millán et al. 2001). There are two hypotheses to explain the NO3--induced iron deficiency. One is that the increased apoplastic pH by NO3- nutrition inactivates the physiological Fe in leaf apoplasts based on fact that Fe concentration is the same or even higher in chlorotic leaves than that in green ones in some cases (Hoffmann, Plänker & Mengel 1992; Mengel 1994; Kosegarten, Hoffmann & Mengel 1999, 2001; López-Millán et al. 2001). The other is that the increased pH at the root surface and in nutrient solution by assimilation of nitrate inhibits Fe acquisition and translocation (Nikolic & Römheld 1999, 2003). Plants take up NO3- ion together with H+ as co-transport (Crawford & Glass 1998) and release OH-, resulting in the alkalinity of the rhizosphere. Inversely, uptake of NH4+ associates release of H+ from roots, leading to the acidification of the rhizosphere. Taken all together, pH is an important factor that directly affects iron availability, uptake and homeostasis in plants, while N forms may influence iron homeostasis by altering the pH value of nutrient solution, root and leaf apoplasts. However, it is still unknown at molecular level how pH and N forms directly or indirectly affect iron uptake and homeostasis in plants.

As an economically important vegetable, tomato is a model plant for studying the molecular mechanisms of iron uptake and metabolism in strategy I plants (Hell & Stephan 2003). Seven genes (FER, CHLN, LeFRO1, LeIRT1, LeIRT2, LeNRAMP1 and LeNRAMP3) involved in ironhomeostasis have been isolated and characterized in tomato. FER, encoding a bHLH protein, is a central regulatory gene controlling the whole iron deficiency responses and iron uptake under iron-limited condition (Ling et al. 2002). Loss of FER function because of a spontaneous insertion mutation in T3238fer fails to turn on the iron deficiency responses. The mutant plants exhibit severe chlorosis and die at the early stage unless supplied with ferrous iron or grafted onto a wild-type rootstock (Brown, Chaney & Ambler 1971; Ling & Ganal 2000). CHLN encodes nicotianamine synthase responsible for the biosynthesis of nicotianamine in plants (Ling et al. 1999; Takahashi et al. 2003). Nicotianamine is a non-proteinous amino acid and functions in iron and other metal homeostasis. The FCR LeFRO1 is a major gene for the reduction of ferric to ferrous iron on root surfaces (Li et al. 2004). The other four genes (LeIRT1, LeIRT2, LeNRAMP1 and LeNRAMP3) encode metal transporters involved in iron acquisition in tomato (Eckhardt et al. 2001; Bereczky et al. 2003). In this work, we investigated the effects of nitrate or ammonium as sole N source at a low (5.0) and high (7.5) pH on iron homeostasis in tomato. The expression profiles of the genes involved in iron uptake and metabolism in the cultivar T3238 and its iron-inefficient mutant T3238fer of tomato were analysed.

MATERIALS AND METHODS

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES

In vitro culture

The iron-inefficient mutant T3238fer and its wild type T3238 (Brown et al. 1971) of tomato (Lycopersicon esculentum Mill) were used in this study. Seeds were surface-sterilized for 10 min with 1% NaClO and washed four times in sterile water. Subsequently, seeds were placed onto agar medium B5 (Gamborg, Miller & Ojima 1968) and germinated in a growth chamber with a 16 h photoperiod at 25 °C for 15 d. The seedlings of T3238fer and T3238 were then transferred onto B5 agar media containing 0, 1.0, 5.0 or 10 mM (NH4)2SO4 in 10-cm-high glass culture vessels (one plant per vessel with about 40 mL agar medium) and cultured in the growth chamber. The pH value of the media was adjusted to 6.0 before autoclaving. Unless otherwise stated, 100 µM Fe (III)-ethylenediaminetetraacetic acid (EDTA) was supplied in the media.

After 15 d, plants were carefully pulled out from the culture vessels. Roots were washed with double-distilled water to remove the agar and iron ions adhering to the root surfaces. Leaves and roots were separately harvested for further chemical and molecular analyses. The pH values of the agar media were measured.

Hydroponic culture

Seeds of T3238 and T3238fer were germinated in filter papers soaked with water. The 7-day-old seedlings were then cultured in quartz sands saturated with half-strength Hoagland solution (Becker, Fritz & Manteuffel 1995) for 15 d. Subsequently, seedlings (three plants per 1.2 L plastic pot) were transferred to hydroponics with moderately aerated culture solution, containing 0.7 mM K2SO4, 0.1 mM KH2PO4, 0.1 mM KCl, 0.5 mM MgSO4, 10 µM H3BO3, 0.5 µM MnSO4, 0.2 µM CuSO4, 0.1 µM ZnSO4, 0.01 µM (NH4)6Mo7O24, and 10 µM Fe(III)-EDTA. For the treatment of NO3- as sole nitrogen source, 2 mM Ca(NO3)2 was applied in the solution. For the treatment of NH4+ as the sole N source, 2 mM (NH4)2SO4 and 2 mM CaCl2 were added. For both N-form treatments, nutrient solutions were buffered either with 5 mM 2-(N-morpholino)ethanesulfonic acid (MES) at pH 5.0 or 5 mM N-(2-hydroxyethyl)-piperazine-N′-2-ethanesulfonic acid (HEPES) at pH 7.5 to stabilize the pH, and the culture solutions were renewed every 2 d. The leaves and roots of plants after 15 d of growth were harvested for further analysis.

Gene expression analysis

To study the expression profiles of the genes involved in iron homeostasis by semi-quantitative RT-PCR, total RNA from leaves and roots was extracted with Trizol reagent (Invitrogen, Carlsbad, CA, USA) and reverse-transcripted into cDNAs following the methods described by Li et al. (2004). The tomato elongation factor gene LeEF-1A was used as an internal control with 25 cycles. PCR amplification was conducted as follows: 94 °C for 3 min, 30 cycles of 94 °C for 50 s, 55 °C for 50 s, 72 °C for 60 s and 72 °C for 5 min final extension. The gene-specific primers used in this study were designed according to the description of Li et al. (2004). The oligonucleotide sequences of these primers and their expected product sizes are shown in Table 1.

Table 1.  Sequences of primers used for the RT-PCR analysis and the fragment length amplified from cDNA
GenesForward primer sequenceReverse primer sequenceFragment length (bp)
CHLNAAAACCCCCTTCAACATCTTCACAACACATAGGCACCCAATCCATCAA412
FERGAGAGTGGTAATGCATCAATGGAATCCATTGAGAGACTCAAG740
LeIRT1TGGCTGTGGCTGGAAATCATGTTCAGAATTTTTTTGCAACTCCCAATAGGT645
LeIRT2AATCCAGAAACTGGTGGTGCTGGAAAAGTATACACGATTACAATTTTGC664
LeFRO1GGAGCCAGAGAAAATCAGTGCGAAGCCATAGGAGTTGC750
LeNRAMP1GCTTTGTCCTGAGGCTAATAATGGTTTCGCGTTGTTTGTGTCC205
LeEF-1ACCTCTTGGGCTCGTTAATCTGGCTCTGGTGGTTTTGAAGCTGGTATCT325

Chlorophyll determination

The chlorophyll contents of leaves were determined using a portable Chlorophyll Meter SPAD-502 device (Minolta Camera Co., Osaka, Japan).

Fe content determination

To analyse the iron content, samples of leaves and roots were separately harvested from plants which were treated in the corresponding nutrient solutions for 15 d. After drying at 80 °C for 72 h, dry weights (DWs) were determined. Then, about 200 mg of leaves or roots were digested with 6 mL 65% HNO3 (Suprapur grade) and 2 mL 30% H2O2 in a microwave oven at 180 °C for 15 min. Iron contents were measured by inductively coupled plasma (ICP) optic emission spectrometer Optima 2000 (Perkin Elmer, Wellesley, MA, USA).

FCR activity assay

To determine ferric chelate reduction, the whole roots of each plant were collected after treatments, rinsed in distilled water for three times and submerged in 0.2 mM CaSO4. Roots were then placed into 8 mL assay solution containing 0.2 mM CaSO4, 5 mM MES at pH 5.5, 0.1 mM Fe(III)-EDTA and 0.2 mM bathophenanthrolinedisulphonate (BPDS). After 1 h, an aliquot of the assay solution was removed and the FCR activity was determined as described by Waters et al. (2002).

RESULTS

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES

Effects of N forms on pH value and iron homeostasis in vitro culture

The Fe-inefficient mutant T3238fer of tomato was a lethal mutant under normal cultural conditions (Brown et al. 1971; Ling et al. 1996). Interestingly, T3238fer showed normal growth as the wild type on MS agar medium. Stepwise elimination of components of the MS medium revealed that NH4+ was an essential factor to rescue the mutant in vitro (data not shown). To find out why NH4+ can rescue the Fe-inefficient mutant under in vitro culture condition, T3238fer and its wild type T3238 were cultured on B5 agar media supplied with different concentrations of NH4+ (0, 2, 10 and 20 mM). Seven days later, young leaves of T3238fer and T3238 showed slight chlorosis on medium with 0 mM NH4+ and became severe with extended culture time although 100 µM Fe(III)-EDTA was present in the medium. The chlorotic phenotype was not observed in both the mutant and the wild type growing on media containing NH4+ (Fig. 1a,b). Moreover, the chlorophyll contents were more than three times higher in the plants grown on the media containing NH4+ than without NH4+ (Fig. 2a). In addition, the pH value of the medium without NH4+ shifted from 5.3 (pH value of agar medium after autoclave) to > 6.5 after 15 d while the pH value of the media with NH4+ decreased to around 4.0 (Fig. 2b). Considering that the chlorosis of plants grown on the medium without NH4+ might be caused by iron deficiency, we measured the iron contents in leaves and roots (Fig. 2c,d). The results showed that the iron contents in leaves of T3238fer and T3238 grown on the medium with NO3- as sole N source were approximately 50 µg g−1DW, which was significantly lower than those (> 100 µg g−1) grown on the media with NH4+ (Fig. 2c). Similarly, the iron contents in roots of plants grown on the medium with NO3- was about one-tenth of that with NH4+ (Fig. 2d). These results indicate that the chlorotic phenotype on the medium with NO3- as the sole N source is caused by a decrease of iron contents in the leaves and roots.

image

Figure 1. Phenotypes of T3238 (a) and T3238fer (b) growing on agar media with different concentrations of NH4+. The pictures were taken on the 15th day of the treatment.

Download figure to PowerPoint

image

Figure 2. The chlorophyll contents of young leaves (a), and the pH values of the agar media (b) after culture for 15 d. Fe contents of leaves (c) and roots (d) of plants growing on agar media supplied with different concentrations of NH4+ for 15 d. Values shown represent the means of 18 plants from three independent experiments. ck, pH value of medium without plant growth. SPAD, spectral plant analysis diagnostic units.

Download figure to PowerPoint

To study the effects of different NH4+ concentrations in vitro culture on the expression patterns of genes involved in iron homeostasis in tomato, the leaves and roots were separately harvested after treating the plants for 15 d. Their total RNAs were extracted and analysed by RT-PCR. As shown in Fig. 3, the expressions of LeFRO1, LeIRT1 and LeITR2, as well as LeNRAMP1 were induced in roots of T3238 fed with NO3- as the N source, whereas the expression of FER was significantly decreased. CHLN showed a constitutive expression in all treatments and the transcription abundance was not affected by N forms as well as NH4+ concentrations used in the agar media. In the leaves, no differences of expression patterns were observed among the genes investigated at all the treatments of NH4+ concentrations.

image

Figure 3. The expression patterns of genes involved in Fe uptake and metabolism in the leaves and roots of T3238 and T3238fer grown on agar media supplied with different concentrations of NH4+ after treatment for 15 d. The tomato elongation factor gene LeEF-1A was used as an internal control. a, b, c and d indicate NH4+ concentration at 0, 2, 10 or 20 mM in the media, respectively.

Download figure to PowerPoint

In comparison with the wild type, the mutant T3238fer displayed altered expression profiles for LeFRO1, LeIRT1 and LeNRAMP1 as a result of the defect of FER (Fig. 3). The expression of these genes was very weak in roots on the medium with NO3- as the sole N source. Moreover, the transcript level of LeIRT2 was strongly enhanced in the roots and leaves when grown on the medium without NH4+. Similar to the wild type, the message level of CHLN in leaves or roots was not affected by different concentrations of NH4+ in the agar media (Fig. 3).

Effects of N forms and pH value on iron acquisition in hydroponics

pH is an important factor affecting iron availability and homeostasis in plants. As described earlier, the pH value of the medium increased when nitrate was used as the unique nitrogen source. As the growth condition of plants on the agar medium is much different from the natural growth conditions, a hydroponic culture system was used to clarify whether nitrogen form or high pH value caused by the utilization of NO3- is the main reason for the NO3--induced iron deficiency. Fifteen-day-old seedlings of T3238 and T3238fer were grown in hydroponics supplying 10 µM Fe-EDTA with NO3- or NH4+ as the N source and buffered at pH 5.0 and 7.5 by MES and HEPES. As showed in Fig. 4, T3238 showed normal growth and no chlorotic symptom was observed in solutions fed with either NO3- or NH4+ and buffered at both low (5.0) and high (7.5) pH (Fig. 4a). For the mutant T3238fer, seedlings displayed slight chlorosis during the sand culture prior to the hydroponics, but the chlorotic leaves soon became green when grown in the culture solution buffered at pH 5.0 irrespective of the N forms. In contrast, the chlorosis became more severe when cultured in the solutions buffered at pH 7.5 (Fig. 4b). Moreover, the plants of T3238fer developed more severe chlorosis and stronger growth depression in the solution with NH4+ as the N source than that with NO3- at pH 7.5 (Fig. 4b). Consistent with the phenotypes, T3238fer displayed markedly decreased chlorophyll contents when grown in the solution buffered at pH 7.5, especially in the solution with NH4+, while no significant difference was found in the solutions buffered at pH 5.0 (Table 2). The greater growth inhibition at pH 7.5 in the presence of ammonium than nitrate might be because of the presence of ammonia produced from NH4+ at high pH.

image

Figure 4. Phenotypes of T3238 and T3238fer growing in culture solutions supplied with NO3- or NH4+ as the N source and buffered at pH 5.0 and 7.5 in the presence or absence of iron. (a) T3238 exhibited normal growth in the hydroponic culture system irrespective of the N forms and high or low pH in the presence of 10 µM Fe-ethylenediaminetetraacetic acid (EDTA). (b) Seedlings of T3238fer displayed chlorosis growing in culture solutions buffered at pH 7.5 irrespective of the N forms, and remained green when cultured in the solutions buffered at pH 5.0 in the presence of 10 µM Fe-EDTA. (c) In the absence of iron, T3238 displayed normal growth (no chlorotic phenotype in young leaves) at pH 5.0, whereas they showed chlorosis in young leaves at pH 7.5 regardless of the N forms used in the solutions. (d) Young leaves of T3238 plants from (c). The young leaves of plants growing in the solutions buffered at pH 5.0 remained green (NO3-5.0 and NH4+5.0), whereas chlorosis and necrotic spots exhibited in young leaves at pH 7.5 (NO3-7.5, NH4+7.5). (e) Roots of T3238 plants from (c). Root growth was strongly restricted at pH 7.5 (NO3-7.5), especially in the solution with NH4+ as the N form (NH4+7.5).

Download figure to PowerPoint

Table 2.  Phenotype, chlorophyll contents and biomass of plants of T3238 and T3238fer growing in solutions supplied with NO3- or NH4+ as the N source and buffered at high (7.5) and low (5.0) pH in the presence of 10 µM Fe-ethylenediaminetetraacetic acid (EDTA) for 15 d
GenotypeTreatmentsPhenotypeChlorophyll (SPAD)Biomass (mg plant−1)
  1. Values shown represent the means of three independent experiments. Different letters indicate significant differences (P < 0.05) between treatments.

T3238NO3-, pH 5.0Green29.55 ± 1.46a205.2 ± 25.2a
NO3-, pH 7.5Green28.75 ± 2.35a184.33 ± 40.5a
NH4+, pH 5.0Green29.36 ± 1.89a199.5 ± 52.3a
NH4+, pH 7.5Green29.31 ± 1.64a109.7 ± 9.3b
T3238ferNO3-, pH 5.0Green26.5 ± 2.03a111.6 ± 6.9a
NO3-, pH 7.5Chlorotic10.13 ± 4.12b49.0 ± 7.3b
NH4+, pH 5.0Green27.57 ± 3.50a100.2 ± 32.2a
NH4+, pH 7.5Chlorotic9.14 ± 4.58b26.3 ± 5.1c

The leaves and roots were separately harvested and their iron contents were determined. As shown in Fig. 5, no significant difference in iron contents was found among the four treatments in leaves of the wild type and the mutant (Fig. 5a). In the roots, the Fe contents were strongly associated with the pH values of the culture solution. At pH 5.0, the iron contents were more than twofold higher than that at pH 7.5 regardless of the N forms (Fig. 5b). Moreover, the iron contents in roots were higher when cultured in the solution with NO3- than with NH4+ at pH 5.0 (Fig. 5b). Such difference was not observed at pH 7.5 in both of the genotypes. Consistent with iron contents in roots, plants acquired more than twice amount of iron when grown in the solutions buffered at pH 5.0 (> 100 µg) than that (< 50 µg) at pH 7.5 irrespective of the genotypes (Fig. 5c). Taken together, these results revealed that iron uptake of plants was strongly dependent on the pH value of the culture solutions but less on the N forms in hydroponics under the culture conditions with 10 µM of iron.

image

Figure 5. Fe contents of leaves and roots as well as total amount of Fe per plant grown in the solutions with NO3- or NH4+ as the N source, buffered at high (7.5) and low (5.0) pH values supplied with 10 µM Fe for 15 d. Values shown represent the means of 18 plants from three independent experiments. Different letters indicate significant differences (P < 0.05) between the treatments.

Download figure to PowerPoint

To further characterize the effect of pH on iron homeostasis, T3238 and T3238fer were cultured in the solutions without a supply of Fe(III)-EDTA. As expected, the Fe-inefficient mutant T3238fer displayed strong chlorosis and growth depression in all the four treatments (data not shown). Interestingly, T3238 plants displayed normal growth (no chlorotic phenotype in young leaves) at pH 5.0 but showed chlorosis and necrotic spots in young leaves at pH 7.5 (Fig. 4c,d). The chlorophyll content in solutions buffered at pH 5.0 was significantly higher than that at pH 7.5 (Table 3). Similar to shoots, the root growth was strongly restricted at pH 7.5, especially in the solution with NH4+ as the N form (Fig. 4e). The normal growth of T3238 under the culture condition with no iron supplement at pH 5.0 might be because of a trace amount of iron contamination from impure chemicals, water and/or vessels. Iron content of the culture solution was measured to contain 3 µg L−1 of iron (equal 50 nM). To test whether T3238 could acquire more iron from the solution containing a trace amount of iron (50 nM) at pH 5.0 than pH 7.5, plants were allowed to grow for 15 d and harvested. The dry biomass and iron concentration of each plant were measured. The results showed that plants grown in the solution buffered at pH 5.0 produced significantly higher level of dry biomass and acquired more iron than at pH 7.5 (Table 3). Moreover, markedly higher iron concentration was found in plants fed with NH4+ than that with NO3- at pH 5.0 (174.50 versus 144.83 µg g−1), suggesting that NH4+ is more favourable than NO3- for the acquisition and assimilation of Fe under the trace iron condition. When T3238 plants grew in completely Fe-deprived conditions by addition of Ferrozine (an iron chelate) to the culture solution, they all exhibited Fe-deficiency chlorosis and showed no difference of chlorophyll contents and iron amounts per plant among the four treatments (data not shown).

Table 3.  Phenotypes, chlorophyll content, dry weight and total iron concentration of T3238 plants grown in solutions supplied with NO3- or NH4+ as the N source and buffered at high (7.5) and low (5.0) pH without iron supply for 15 d
TreatmentsPhenotypeChlorophyll (SPAD)Biomass(mg plant−1)Fe concentration(mg kg−1)Fe amount/plant (µg)
  1. Values shown represent the means of three independent experiments. Different letters are used for indicating the significant differences (P < 0.05) between treatments.

NO3-, pH 5.0Green24.34 ± 2.33a177.83 ± 29.45a144.83 ± 9.39b25.10 ± 2.85a
NO3-, pH 7.5Chlorotic16.86 ± 7.98b62.45 ± 20.25b132.90 ± 1.84b8.28 ± 2.58b
NH4+, pH 5.0Green29.34 ± 1.80a197.54 ± 42.86a174.50 ± 6.22a34.60 ± 8.71a
NH4+, pH 7.5Chlorotic15.11 ± 6.54b48.10 ± 6.13b140.30 ± 4.38b6.73 ± 0.65b

To study the effect of pH on the expression of genes involved in iron homeostasis, T3238 and T3238fer were treated with NO3- or NH4+ as the N source at high (7.5) or low (5.0) pH for 15 d (see Materials and Methods). Leaves and roots were separately harvested and their total RNAs were extracted. As shown in Fig. 6, the expression of FER was clearly regulated by pH regardless of the N forms, and its transcript level at pH 7.5 was much lower than that at pH 5.0. However, the expression levels of LeIRT1, LeIRT2, LeFRO1 and LeNRAMP1 were significantly enhanced in the roots at pH 7.5 compared with those at pH 5.0. No difference in the expression of CHLN was found at both pH values (Fig. 6, left panel). In the Fe-inefficient mutant T3238fer, LeFRO1 and LeIRT1 only showed a weak increase of transcript intensity at pH 7.5 in comparison with T3238 (Fig. 6, right panel).

image

Figure 6. The expression profiles of genes involved in Fe uptake and metabolism in the leaves and roots of T3238 and T3238fer grown in solutions supplied with NO3- or NH4+ as the sole N source and buffered at high (7.5) and low (5.0) pH under sufficient (10 µM) Fe supply for 15 d. l and h indicate low (5.0) and high (7.5) pH, respectively.

Download figure to PowerPoint

In Arabidopsis, the iron uptake genes AtFRO2 (a major FCR) and AtIRT1 (an essential Fe2+ transporter) are regulated at both transcriptional and post-transcriptional levels (Connolly et al. 2002, 2003). To test whether the elevated transcript level of LeFRO1 in roots under the culture conditions with high pH is correlated with increased ferric chelate reduction, whole roots of the treated T3238 plants were collected and their FCR activity was determined. As shown in Fig. 7, the FCR activity in roots was clearly correlated with the transcript level of LeFRO1. The plants grown in the solution with high pH revealed significantly higher FCR activity than that with low pH (Figs 6 & 7), suggesting that the elevated expression of LeFRO1 induced by high pH was possibly not regulated at the post-transcriptional level.

image

Figure 7. Fe(III)-chelate reductase (FCR) activity in roots of plants that were cultured in solutions supplied with NO3- or NH4+ as the sole N source and buffered at high (7.5) and low (5.0) pH under sufficient (10 µM) Fe supply for 15 d. Ferric chelate reduction was measured with excised whole roots of each individual plant following the protocol described by Waters et al. (2002). Values are the means of four to six individual plants. Different letters indicate significant differences (< 0.05) between the treatments.

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES

The NO3--induced Fe-deficiency chlorosis has been studied for decades. Different hypotheses were proposed to explain this phenomenon (Mengel, Plänker & Hoffmann 1994; Kosegarten et al. 1999; Römheld 2000; Nikolic & Römheld 2003). Among these hypotheses, one common point is that NO3- nutrition increases the pH in culture solution, which is the primary cause of Fe deficiency induced by NO3- nutrition. To further clarify this, we used T3238 (an iron-efficient cultivar) and its mutant T3238fer of tomato to investigate the effects of pH and N forms on the expression patterns of iron-related genes and iron homeostasis. Our data strongly indicated that external pH was an important factor affecting gene expression, iron uptake and homeostasis in tomato. In some cases, NH4+ seems to be more favourable to stimulate Fe uptake in a trace iron solution while NO3- facilitates Fe absorption in sufficient Fe solution at low pH. The tomato FCR LeFRO1 and the metal transporters LeIRT1 and LeNRAMP1 were reported to be induced by iron deficiency (Eckhardt et al. 2001; Bereczky et al. 2003; Li et al. 2004). Our results showed that these three genes were strongly enhanced in the culture solutions buffered at pH 7.5 but decreased in the solutions buffered at pH 5.0 regardless of the N forms used. The increased transcript abundance of LeFRO1, LeIRT1 and LeNRAMP1 at pH 7.5 may result from low iron availability in the high pH solution. Likewise, on the agar medium, the transcripts of LeFRO1, LeIRT1 and LeNRAMP1 were also induced by NO3- in the roots of T3238 (Fig. 3). Such an increase of expression is likely to be caused by increased pH (from 5.3 to > 6.5) resulting from NO3- assimilation, which decreases Fe availability in the medium.

FER expression was shown at a similar level in response to low (0.1 µM FeNaEDTA) and sufficient (10 µM FeNaEDTA) iron supply (Ling et al. 2002). Recently, a down-regulation of FER transcription was observed at generous (100 µM FeNaEDTA) iron supply in the medium (Brumbarova & Bauer 2005). These results suggest that the expression of FER is partially regulated by the iron status of plants. FIT1, a functional ortholog of tomato FER in Arabidopsis (Yuan et al. 2005), also showed enhanced levels of expression in iron-deficient roots than in iron-sufficient roots (Colangelo & Guerinot 2004). Here we demonstrated that the transcript intensity of FER was clearly dependent on the pH value of the solution as it decreased at high pH and increased at low pH (Fig. 6). This information will be useful for further characterization of the biological functions of FER.

FER, encoding a bHLH protein, is required to control the expression of the FCR LeFRO1 and the iron transporters LeIRT1 and LeNRAMP1 in tomato roots under iron-limiting conditions (Ling et al. 2002; Bereczky et al. 2003; Li et al. 2004). The transcription of FER was clearly regulated by the pH value of the solution; decreased at high pH and increased at low pH (Figs 6 & 7). Paradoxically, the transcript abundance of LeFRO1 and LeIRT1 as well as LeNRAMP1 was clearly increased at pH 7.5 and decreased at pH 5.0 (Fig. 6). Compared with the wild type, the greatly increased expression of LeFRO1, LeIRT1 and LeNRAMP1 at pH 7.5 was not observed in the mutant T3238fer (Fig. 6). From these results, it could be concluded that FER is required to control the expression of LeFRO1, LeIRT1 and LeNRAMP1, but it might not be the limiting factor because the transcript abundance of FER was not correlated with the expression of the three genes under the culture condition with high pH. Other unknown factor(s) may function together with FER to control the expression of these three genes. Anyway, it will be interesting to find out why the FER transcript is enhanced by low pH and depressed by high pH, and its possible biological functions.

LeIRT2, which can complement the growth defect of an iron uptake-deficient yeast mutant, is a putative iron transporter in tomato. The transcript of LeIRT2 was detected only in the roots of tomato and its expression were unaffected by the iron status of the plant (Eckhardt et al. 2001). Here we found that the expression of LeIRT2 was clearly controlled by pH in the roots of T3238. High pH significantly enhanced its transcript level, whereas low pH suppressed its expression (Figs 3 & 6). The expression of LeIRT2 in tomato roots was previously reported to be not regulated by FER (Li et al. 2004). Surprisingly, the transcript of LeIRT2 was detected in both roots and leaves of the mutant T3238fer grown on the agar medium with NO3- nutrition and in the culture solution buffered at 7.5 (Figs 3 & 6). Therefore, FER is likely a repressor directly or indirectly controlling the LeIRT2 expression in leaves at high pH.

T3238fer is a lethal mutant under normal culture conditions because of the defect of FER, which is a regulator controlling iron-deficiency responses and iron uptake in tomato. Interestingly, T3238fer grew normally as wild type on the agar media with NH4+ and in the low-pH nutrient solution (5.0), indicating that FER is not essential for iron uptake under such culture conditions. FER encodes a bHLH protein controlling FCR LeFRO1 and the Fe2+-transporter LeIRT1 and LeNRAMP1 at transcriptional level under iron deficiency conditions (Ling et al. 2002; Bereczky et al. 2003; Li et al. 2004). LeFRO1, LeIRT1 and LeNRAMP1 were induced under iron-limiting condition, suggesting that the three genes are involved in high-affinity iron acquisition in tomato. It appears that tomato may possess another acquisition system, by which T3238fer acquires enough iron for growth from the culture solution with low pH and media with NH4+. It might be the low-affinity iron uptake system, considering that T3238fer showed normal growth only under the culture condition with low pH and a high concentration of available iron.

When NO3- was the sole N source in the culture condition, T3238 showed different phenotypes, chlorotic on the agar medium (Fig. 1) and normal growth in the culture solution with high pH (7.5) and only one-tenth (10 µM F(III)-EDTA) of the iron concentration of the agar medium (Fig. 4). Fe(III)-EDTA as the sole iron source in the agar medium is known to be photosensitive. When exposed to light, iron catalyses the breakdown of EDTA and forms insoluble iron phosphate resulting in quickly reducing the soluble iron concentration in the medium (Dalton, Iqbal & Turner 1983; Papathanasiou, Selby & Harvey 1996). In hydroponics, the culture solution was not exposed to light and renewed every 2 d. Most iron in the solution should be still present in soluble form as Fe(III)-EDTA. In addition, the NO3- assimilation by plants on the agar medium led to the increase of the pH value from 5.3 to > 6.5, further decreasing iron availability of the medium. These apparently are the main reasons why T3238 displayed chlorosis on the agar medium with NO3- as the N source supplying with 100 µM F(III)-EDTA, while it grew normally in hydroponics with NO3- as the N source and buffered at high pH.

In the hydroponics experiments, no significant difference of Fe concentration was found in leaves of plants growing in solutions buffered at pH 5.0 and 7.5 regardless of N forms and genotypes, while the Fe contents in roots of both genotypes grown in solutions buffered at low pH 5.0 were much higher than those at pH 7.5 in either NO3- or NH4+ treatment. Iron uptake was strongly restricted in the solution buffered at pH 7.5 irrespective of the N forms, leading to a remarkable decrease of the total Fe amount compared with that buffered at pH 5.0. However, under a trace amount of Fe concentration (about 50 nM), T3238 showed better growth and acquired more iron from the solution with NH4+ as the N source than from that with NO3- at pH 5.0 (Fig. 4), indicating that NH4+ should be more favourable for growth and iron uptake under such stress condition of iron deficiency. This is consistent with the results previously reported by Zou & Zhang (2003) that ammonium supply ameliorated Fe nutrition of plants grown in the solution without Fe supply in sunflower. It is well known that NO3- has to be reduced to NH4+ by nitrate and nitrite reductases in plant cells before assimilation to amino acids. In the process of NO3- reduction, iron-containing proteins, such as ferredoxin, are required. Therefore, it is reasonable to assume that under iron deficiency stress, NH4+ nutrition will be more beneficial to the N nutrition of the plant than NO3- nutrition. The increased iron and chlorophyll contents in young leaves by NH4+ nutrition might be a secondary effect of the better N nutrition for plants.

ACKNOWLEDGMENTS

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES

The authors thank Dr. Li Li (US Plant, Soil and Nutrition Laboratory, Cornell University, Ithaca, NY) for the critical reading of the manuscript. This work was supported by the National Natural Science Foundation of China (Grant nos. 30225029, 30521001) and by the Chinese Ministry of Science and Technology (Grant no. 2005cb20904).

REFERENCES

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES
  • Becker R., Fritz E. & Manteuffel R. (1995) Subcellular localization and characterization of excessive iron in the nicotianamineless tomato mutant chloronerva. Plant Physiology 108, 269275.
  • Bereczky Z., Wang H.Y., Schubert V., Ganal M. & Bauer P. (2003) Differential regulation of nramp and irt metal transporter genes in wild type and iron uptake mutants of tomato. Journal of Biological Chemistry 278, 2469724740.
  • Brown J.C., Chaney R.L. & Ambler J.E. (1971) A new tomato mutant inefficient in the transport of iron. Physiologia Plantarum 24, 4853.
  • Brumbarova T. & Bauer P. (2005) Iron-mediated control of the basic Helix-Loop-Helix protein FER, a regulator of iron uptake in tomato. Plant Physiology 137, 10181026.
  • Colangelo E.P. & Guerinot M.L. (2004) The essential basic helix-loop-helix protein FIT1 is required for the iron deficiency response. The Plant Cell 16, 34003412.
  • Connolly E.L., Fett J.P. & Guerinot M.L. (2002) Expression of the IRT1 metal transporter is controlled by metals at the levels of transcript and protein accumulation. The Plant Cell 14, 13471357.
  • Connolly E.L., Campbell N.H., Grotz N., Prichard C.L. & Guerinot M.L. (2003) Overexpression of the FRO2 ferric chelate reductase confers tolerance to growth on low iron and uncovers posttranscriptional control. Plant Physiology 133, 11021110.
  • Crawford N.M. & Glass A.D.M. (1998) Molecular and physiological aspects of nitrate uptake in plants. Trends in Plant Science 3, 389395.
  • Dalton C.C., Iqbal K. & Turner D.A. (1983) Iron phosphate precipitation in Murashige and Skoog media. Physiologia Plantarum 57, 472476.
  • Eckhardt U., Marques A.M. & Buckhout T.J. (2001) Two iron-regulated cation transporters from tomato complement metal uptake-deficient yeast mutants. Plant Molecular Biology 45, 437448.
  • Eide D., Broderius M., Fett J. & Guerinot M.L. (1996) A novel iron-regulated metal transporter from plants identified by functional expression in yeast. Proceedings of the National Academy of Sciences USA 93, 56245628.
  • Gamborg O.L., Miller R.A. & Ojima K. (1968) Nutrient requirements of suspension cultures of soybean root cells. Experimental Cell Research 50, 151158.
  • Hell R. & Stephan U.W. (2003) Iron uptake, trafficking and homeostasis in plants. Planta 216, 541551.
  • Hoffmann B., Plänker R. & Mengel K. (1992) Measurements of pH in the apoplast of sunflower leaves by means of fluorescence. Physiologia Plantarum 84, 146153.
  • Jakoby M., Wang H.Y., Reidtb W., Weisshaar B. & Bauerb P. (2004) FRU (BHLH029) is required for induction of iron mobilization genes in Arabidopsis thaliana. FEBS Letters 577, 528534.
  • Kosegarten H., Wilson G.H. & Esch A. (1998) The effect of nitrate nutrition on Fe chlorosis and leaf growth in sunflower (Helianthus annuus L). European Journal of Agronomy 3-4, 283292.
  • Kosegarten H., Hoffmann B. & Mengel K. (2001) The paramount influence of nitrate in increasing apoplastic pH of young sunflower leaf to induce Fe deficiency chlorosis, and the re-greening effect brought about acid foliar sprays. Journal of Plant Nutrition and Soil Science 164, 155163.
  • Kosegarten H.U., Hoffmann B. & Mengel K. (1999) Apoplastic pH and Fe3+ reduction in intact sunflower leaves. Plant Physiology 121, 10691079.
  • Li L.H., Cheng X.D. & Ling H.Q. (2004) Isolation and characterization of Fe (III)-chelate reductase gene LeFRO1 in tomato. Plant Molecular Biology 54, 125136.
  • Ling H.Q. & Ganal M.W. (2000) Towards map-based cloning of two genes involved in iron uptake of tomato. Journal of Plant Nutrition 23, 19531967.
  • Ling H.Q., Pich A., Scholz G. & Ganal M.W. (1996) Genetic analysis of two tomato mutants affected in the regulation of iron metabolism. Molecular and General Genetics 252, 8792.
  • Ling H.Q., Koch G., Bäumlein H. & Ganal M.W. (1999) Map-based cloning of chloronerva, a gene involved in iron uptake of higher plants encoding nicotinamine synthase. Proceedings of the National Academy of Sciences USA 96, 70987103.
  • Ling H.Q., Bauer P., Bereczky Z., Keller B. & Ganal M. (2002) The tomato fer gene encoding a bHLH protein controls iron-uptake responses in roots. Proceedings of the National Academy of Sciences USA 99, 1393813943.
  • López-Millán A.F., Morales F., Abadía A. & Abadía J. (2001) Iron deficiency-associated changes in the composition of the leaf apoplastic fluid from field-grown pear (Pyrus communis L.) trees. Journal of Experimental Botany 52, 14891498.
  • Marschner H. & Römheld V. (1994) Strategies of plants for acquisition of iron. Plant and Soil 165, 275283.
  • Mengel K. (1994) Iron availability in plant tissues: iron chlorosis on calcareous soils. Plant and Soil 165, 275283.
  • Mengel K. & Geurtzen G. (1988) Relationship between Fe chlorosis and alkalinity in Zea mays. Physiologia Plantarum 72, 460465.
  • Mengel K., Plänker R. & Hoffmann B. (1994) Relationship between leaf apoplast pH and iron chlorosis of sunflower (Helianthus annuus L). Journal of Plant Nutrition 17, 10531065.
  • Nikolic M. & Römheld V. (1999) Mechanism of Fe uptake by the leaf symplast: is Fe inactivation in leaf a cause of Fe deficiency chlorosis? Plant Soil 215, 229237.
  • Nikolic M. & Römheld V. (2003) Nitrate does not result in iron inactivation in the apoplast of sunflower leaves. Plant Physiology 132, 13031314.
  • Papathanasiou F., Selby C. & Harvey B.M.R. (1996) Soluble iron lost from MS medium pre-exposed to light but growth of potato plantlets is not inhibited. Plant Cell, Tissue and Organ Culture 46, 117121.
  • Robinson N.J., Proctor C.M., Connolly E.L. & Guerinot M.L. (1999) A ferric chelate reductase for iron uptake from soils. Nature 397, 694697.
  • Römheld V. (2000) The chlorosis paradox: Fe inactivation as a secondary event in chlorotic leaves of grapevine. Journal of Plant Nutrition 23, 16291643.
  • Takahashi M., Terada Y., Nakai I., Nakanishi H., Yoshimura E., Mori S. & Nishizawa N.K. (2003) Role of nicotianamine in the intracellular delivery of metals and plant reproductive development. The Plant Cell 15, 12631280.
  • Vert G., Briat J.F. & Curie C. (2001) Arabidopsis IRT2 gene encodes a root-periphery iron transporter. Plant Journal 26, 181189.
  • Vert G., Grotz N., Dedaldechamp F., Gaymard F., Guerinot M.L. & Briat J-F Curie C (2002) IRT1, an Arabidopsis transporter essential for iron uptake from the soil and plant growth. The Plant Cell 14, 12231233.
  • Waters B.M., Blevins D.G. & Eide D.J. (2002) Characterization of FRO1, a pea ferric-chelate reductase involved in root iron acquisition. Plant Physiology 129, 8594.
  • Wu H., Li L., Du J., Yuan Y., Cheng X. & Ling H.Q. (2005) Molecular and biochemical characterization of the Fe(III) chelate reductase gene family in Arabidopsis thaliana. Plant and Cell Physiology 46, 15051514.
  • Yuan Y., Zhang J., Wang D.W. & Ling H.Q. (2005) AtbHLH29 of Arabidopsis thaliana is a functional ortholog of tomato FER involved in controlling iron acquisition in strategy I plants. Cell Research 15, 613621.
  • Zou C.Q. & Zhang F.S. (2003) Ammonium improves iron nutrition by decreasing leaf apoplastic pH of sunflower plants (Helianthus annuus L. cv. Frankasol). Chinese Science Bulletin 48, 22152220.