SEARCH

SEARCH BY CITATION

Keywords:

  • amino acids;
  • ammonium;
  • ammonium transporter;
  • nitrate;
  • nitrate reductase;
  • nitrate transporter;
  • photorespiration;
  • salt stress

ABSTRACT

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIAL AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES
  9. Supporting Information

Salinity represents an increasing environmental problem in managed ecosystems. Populus spp. is widely used for wood production by short-rotation forestry in fertilized plantations and can be grown on saline soil. Because N fertilization plays an important role in salt tolerance, we analysed Grey poplar (Populus tremula × alba, syn. Populus canescens) grown with either 1 mM nitrate or ammonium subjected to moderate 75 mM NaCl. The impact of N nutrition on amelioration of salt tolerance was analysed on different levels of N metabolism such as N uptake, assimilation and N (total N, proteins and amino compounds) accumulation. Na concentration increased in all tissues over time of salt exposure. The N nutrition-dependent effects of salt exposure were more intensive in roots than in leaves. Application of salt reduced root increment as well as stem height increase and, at the same time, increased the concentration of total amino compounds more intensively in roots of ammonium-fed plants. In leaves, salt treatment increased concentrations of total N more intensively in nitrate-fed plants and concentrations of amino compounds independently of N nutrition. The major changes in N metabolism of Grey poplar exposed to moderate salt concentrations were detected in the significant increase of amino acid concentrations. The present results indicate that N metabolism of Grey poplar exposed to salt performed better when the plants were fed with nitrate instead of ammonium as sole N source. Therefore, nitrate fertilization of poplar plantations grown on saline soil should be preferred.


INTRODUCTION

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIAL AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES
  9. Supporting Information

Although soil salinity has existed long before humans have cultivated land for agriculture, this detrimental factor of plant growth and development has been aggravated by irrigation. According to the Land and Plant Nutrition Management Service, the total area of saline soils amounts to 397 million ha, c. 19.5% of irrigated land and 2.1% of dry land agriculture proceed on salt-affected soils (http://www.fao.org/ag/agl/agll/spush/topic2.htm). Thus, salt stress constitutes an agricultural and environmental problem worldwide, and salinity is expected to cause serious salinization problems for more than 50% of all arable lands until 2050 (Ashraf 1994).

Salinity is a major abiotic stress that is visible on the physiological, biochemical and molecular level (Hasegawa et al. 2000; Parida & Das 2005). Unlike many toxins and herbicides, excess NaCl has no single cellular target, and the deleterious effects of NaCl stress result from either osmotic inhibition of water uptake by roots, similar to drought stress, or by disarrangement of ion homeostasis (Garcia et al. 1997; Munns 2005). As a consequence of primary salt effects, secondary stresses, such as oxidative damage and the generation of reactive oxygen species (ROS), are often observed (Zhu 2001).

N fertilization plays an important role in the amelioration of salt stress tolerance. The impact of N nutrition on amelioration of salt tolerance has been analysed on different levels of N metabolism such as N uptake, assimilation and N (total N, proteins and amino acids) accumulation. It is thought that sufficient N supply helps to compensate and correct nutritional imbalances in salt-stressed plants (Gomez et al. 1996), because salt stress decreases the uptake of nutrients such as NO3- in many plant species (Aslam, Huffaker & Rains 1984; Botella et al. 1997). Nitrate and ammonium are actively absorbed into root cells via high-affinity transport systems (HATS) for NO3- and NH4+ (Glass et al. 2002). Gene expression analyses indicate that salt can stimulate the expression of nitrate transporters (Popova, Dietz & Golldack 2003). Nitrate reductase (NR)activity, the first enzyme in the NO3- reduction and assimilation pathway, has shown contradictory effects in different plant species in response to salt stress (Bourgeais-Chaillou, Perez-Alfocea & Guerrier 1992; Cramer & Lips 1995). The amino acid proline and other amino acids have been described as osmoprotectants or ‘compatible solutes’, molecules accumulating during water shortage, which do not inhibit normal metabolic reactions (Brown & Simpson 1972; Yancey et al. 1982), but protect cells from further damage. The osmotic potential of Na stored in vacuoles needs to be counterbalanced, for example, via compatible solutes increasing the osmotic potential in the cytosol, and apparently, osmotic adjustment is a key issue to tolerate salt stress. Whether plants with increased concentrations of proline display increased salt tolerance is still a matter of debate (Kishor et al. 1995; Blum et al. 1996). Secondary effects of salt stress are also counteracted by compatible solutes protecting membranes as well as proteins and metabolites scavenging ROS, which arise to higher amounts during stress.

Limited information is available on plant performance in dependence of different nitrogen sources, for example, nitrate or ammonium, during salt stress. Growth and yield of salt-stressed sweet pepper are enhanced by increased nitrate supply (Gomez et al. 1996). Lewis, Leidi & Lips (1989), analysing growth rates and gas exchange, suggested that ammonium-fed plants are more susceptible to salt. In different herbaceous species (Pisum sativum, Helianthus anuus, Glycine max), nitrate-supplied plants are less sensitive to salt stress compared with ammonium-supplied individuals with regard to mineral composition, growth and physiological parameters (Bourgeais-Chaillou et al. 1992; Ashraf & Sultana 2000; Frechilla et al. 2001). When ammonium is the only N source for pea plants under salt stress, root growth and belowground total N concentration are reduced, and amino acid concentration increases at the expense of protein contents (Speer, Brune & Kaiser 1994). Biomass, N uptake and N content of Populus tremula × alba saplings grown in aqueous solution are more severely reduced upon salt treatment when ammonium is fed (Dluzniewska et al. 2007).

Populus species can be grown on saline soil in order to prevent erosion and to possibly ameliorate soil (Singh 1998). Because Populus spp. is widely used for wood production by short-rotation forestry in fertilized plantations, the type of N supply may play an important role in tolerating salt stress. The aim of this study was to characterize the impact of different nitrogen nutrition (nitrate or ammonium) on plant growth and N metabolism during moderate long-term salt treatment on Grey poplar P. tremula × alba (Bolu & Polle 2004) grown as hydroponics on clay granules. Based on previous observations for non-woody species, we assume that the N metabolism of NH4+-grown poplars is more susceptible towards salt treatment as compared with NO3--fed plants. The analysis of N metabolism is focused on N uptake via molecular analyses of selected genes encoding nitrate and ammonium transporters, on N assimilation via expression and enzyme assays of the key enzyme NR and on the accumulation of the main N assimilation products, for example, amino acids and proteins. We intend to identify processes of N metabolism most affected by moderate salt treatment in dependence of N nutrition.

MATERIAL AND METHODS

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIAL AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES
  9. Supporting Information

Plant growth conditions and treatments

Grey poplar saplings [Populus tremula × alba syn. Populus × canescens, Institut National de la Recherche Agronomique (INRA) clone 717 1B4] about 5 cm tall were purchased from Picoplant Pflanzenvertrieb und – verkauf (Oldenburg, Germany) and cultivated as hydroponics on clay granules watered with Hoagland solution (Hoagland & Arnon 1950) in the greenhouse in Freiburg. Because plants might react differently when grown on different substrates, our experiments were performed on clay in order to work close to natural soil conditions. Four-week-old plants were transferred to Long Ashton solution (Hewitt 1966) with CaNO3 substituted with CaCl2, and N supply was provided by 0.5 mM KNO3 and 0.5 mM NH4Cl [0.5 mM KNO3, 0.5 mM NH4Cl, 0.9 mM CaCl2, 0.3 mM MgSO4, 0.6 mM KH2PO4, 42 µM K2HPO4, 10 µM Fe–ethylenediaminetetraacetic acid (EDTA), 2.0 µM MnSO4, 10.0 µM H3BO3, 7.0 µM Na2MoO4, 0.05 µM CoSO4, 0.2 µM ZnSO4, 0.2 µM CuSO4, pH 5.5]. After 2 weeks, the population of poplars was split in two groups, one supplied with 1 mM KNO3, while the other group was supplied with 1 mM NH4Cl 6 and 8 weeks prior experiment I and II, respectively. After another 4 (experiment I) and 6 weeks (experiment II), the plants were transported to Garmisch-Partenkirchen. They were cultivated for another week in the greenhouse before they were transferred to the solar domes at the Mt. Wank research station (for details of the solar domes, see Brüggemann & Schnitzler 2002).

The experiments were performed in the solar domes under close-to-natural irradiation conditions. For each plant, 1.7 L pots were used, and the plants were arranged in groups of six in one large bowl. The nutrient solution was exchanged every second day in order to avoid nutrient depletion, and at the same time, the bowls were moved within the solar domes to avoid position effects. Experiment I was performed in August 2004, and the mean daily photosynthetical active radiation (PAR) averaged over the 2 weeks from 06.00 to 18.00 h was 360 µmol m−2 s−1 (lowest value at noon, 102 µmol m−2 s−1; highest value at noon, 1046 µmol m−2 s−1); the mean temperature during the day was 23 °C (minimum at noon, 14 °C; maximum at noon, 35 °C) and the mean relative humidity 58% (minimum at noon, 30%; maximum at noon, 77%). Experiment II was performed in September 2004, and the mean daily PAR averaged over the whole experimental period was 310 µmol m−2 s−1 (minimum at noon, 83 µmol m−2 s−1; maximum at noon, 1139 µmol m−2 s−1), the mean temperature 21 °C (minimum at noon, 16 °C; maximum at noon, 34 °C) and the mean relative humidity 54% (minimum at noon, 25%; maximum at noon, 76%). During experiments I and II, there were 12 and 9 d with mean PAR above 250 µmol m−2 s−1, respectively. Because of different climatic conditions, the data for experiments I and II were analysed separately.

Before the experiment started, the plants were acclimated to the solar domes up to 9 d. Salt treatment was applied by slowly increasing the NaCl concentration (25 mM NaCl on the first day, 50 mM on the third day and 75 mM on the fifth day). The nutrient solution was replaced every second day. For each time point and treatment (NO3-/NH4+, with and without salt), six plants were cultivated. The plants were harvested at 13.00 h Central European Time (CET) at three time points (time point 0 before salt application, 1 and 2 weeks after start of salt treatment) and plant tissues (leaves, roots and stems) were frozen in liquid nitrogen and stored at −80 °C until further analyses. The ratio of fresh weight (FW) to dry weight (DW) of coarse roots and selected leaves did not change because of different N nutrition and/or salt treatment (data not shown).

Determination of NR activity

Frozen plant material was ground to a fine powder in a small mortar with liquid nitrogen. NR activity was determined as described earlier (Scheible et al. 1997) using EDTA in the extraction and reaction buffers (Kaiser & Spill 1991). A volume of 400 µL extraction buffer [100 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES)–KOH, pH 7.5, 5 mM Mg-acetate, 5 mM dithiothreitol (DTT), 1 mM EDTA, 0.5 mM phenylmethanesulphonylfluoride (PMSF), 25 µM leupeptine (only for leaf material), 25 µM chymostatine (only for root material), 20 µM flavin adenin dinucleotide (FAD), 5 µM Na2MoO4, 10% (v/v) glycerin, 1% (w/v) polyvinyl polypyrrolidone (PVPP), 0.5% bovine serum albumin (BSA) and 0.1% (v/v) TritonX-100] was added to 100 mg tissue powder. NR activity was measured immediately in this crude extract without any centrifugation step by transferring 165 µL crude extract into a reaction tube filled with 825 µL reaction mixture. The reaction mixture consisted of 100 mM HEPES–KOH buffer (pH 7.5) supplemented with 6.0 mM KNO3, 6.0 mM EDTA, 0.6 mM NADH, 12 µM FAD, 6 µM Na2MoO4, 3 µM DTT and either 25 µM leupeptine (leaf material) or 25 µM chymostatine (root material). Assays were run at 25 °C. The reaction was terminated after 6, 12 and 18 min by mixing of 300 µL assay mixture with 25 µL 0.6 M Zn-acetate and 75 µL 0.25 mM phenazinemethosulfate. Nitrite formation was quantified by the addition of 1% sulfanilamide and 0.02% N-(1-naphtyl)-ethylene-diamine dihydrochloride (in 3.0 M HCl), and the A540 was measured. Absorption was converted into nitrite concentrations using an external standard.

Gene expression analysis

Gene expression analysis of nitrate and the ammonium transporters in fine roots were performed by real-time PCR. Root RNA was isolated by a CsCl gradient as described by Grunze, Willmann & Nehls (2004). Aliquots of 1 µg total RNA were treated with DNAse I (Invitrogen, Groningen, the Netherlands) and were used for first-strand cDNA synthesis in a total volume of 20 µL, containing 50 pmol oligo-d(T)18–primer (GE Healthcare Europe GmbH, Munich, Germany) and 200 U Superscript II RNase H reverse transcriptase (Invitrogen) according to the manufacturer's instructions. After synthesis, 30 µL of 5 mM 2-amino-2-(hydroxymethyl)propane-1,3-diol (Tris)/HCl, pH 8.0 were added, and aliquots were stored at −80 °C. Real-time PCR was performed using 10 µL Q-PCR-Mastermix (containing SYBR green and fluorescein; ABgene, Hamburg, Germany), 0.5 µL cDNA, and 10 pmol of each primer (PttNRT2.1: GAACAGCCGATCTGAAC and GCGTTGGCCATGCTTCTATAG; PttAMT1.2: see Selle et al. 2005) in a MyiQ real-time PCR system (Bio-Rad, Hercules, CA, USA). Specific primers for 18S rRNA (Selle et al. 2005), actin primers (Langer et al. 2004) and the constitutively expressed poplar gene PttJIP1 (Grunze et al. 2004) were used as references. PCR was performed in triplicate together with dilution series of the reference genes. Three different cDNA synthesis reactions of four different plants were used for analysis.

Expression analysis of root PcNR gene was performed via northern hybridization. Total RNA of roots was extracted from powdered plant material using the Plant RNeasy kit, according to the manufacturer's instruction (Qiagen, Hilden, Germany) with minor modifications. For one RNA extraction, three samples of 70 mg root tissue each were used. 900 µl RLT buffer (Qiagen), supplemented with 1% β-mercaptoethanol, 1% polyvinylpyrrolidone (PVP) and 7 mM ethylxanthogenate was added to 70 mg of homogenized leaf tissue and incubated for 10–30 min at 58 °C. After centrifugation, the samples were transferred on a QIAshredder spin column (Qiagen). The samples were centrifuged for 1 h at 4 °C at 14 000 × g and treated according to the manufacturer's instructions. After washing the first sample with 500 µL RPE buffer (Qiagen), the second sample was pipetted on the RNeasy mini column (Qiagen) and washed accordingly. Finally, the third sample was applied. The RNA was eluted with 50 µL RNAse-free water.

For northern blot analysis, 7 µg RNA per sample was separated on denaturing formaldehyde–agarose gels and was subsequently transferred overnight onto a Hybond-XL nylon membrane (GE Healthcare Europe GmbH). The DNA probe was synthesized from linearized partial NR cDNA (Gene bank accession number DQ855565, NR forward primer TCNWCNCCNTTYATGAACAC and NR reverse primer CCNCCRTTRGGRAAYTNGG) by 32P labelling, using the Strip-EZ DNA kit (Ambion, Austin, TX, USA), as described in the manufacturer's protocol. RNA was hybridized and washed according to standard protocols (Sambrook & Russel 2001). The membrane was exposed to a phosphorimage screen (Molecular Imager FX, Imaging Screen K; Bio-Rad, Munich, Germany) and analysed by PhosphorImager Molecular Imager FX (Bio-Rad).

Analysis of amino compounds and ammonium

Soluble N compounds were extracted and analysed as described previously (Gessler et al. 1998). Aliquots of 100 mg of homogenized tissues (fine roots, leaves) were transferred in a mixture of 1 mL methanol:chloroform (7:3, v/v) and 0.2 mL HEPES buffer [5 mM ethylene glycol tetraacetic acid (EGTA), 20 mM HEPES, 10 mM NaF, pH 7.0]. Homogenates were incubated on ice for 30 min. Water-soluble amino compounds were extracted twice with 0.6 mL distilled water. The aqueous phases were combined and freeze dried (Alpha 2-4; Christ, Osterode, Germany). The dried material was dissolved in 1 mL of 0.2 M lithium citrate buffer (pH 2.2) directly before analyses. Amino compounds were separated and detected by an automated amino acid analyser (Biochrom; Pharmacia LKB, Freiburg, Germany) as described by Gessler et al. (1998).

Elemental analysis

For elemental analysis, the plant material was completely dried at 65 °C for 10 d and digested with HNO3 (100 mg tissue + 1 mL of 65% HNO3 suprapur for 10 h at 160–170 °C, 10 bar) in a pressure ashing device (Seif, Unterschleißheim, Germany). Samples (10 mL), diluted with ultrapure H2O, were analysed by inductively coupled plasma-optical emission spectroscopy (ICP-OES; JY 70 Plus, Devision d'Instruments S.A., J1obin Yvon, France). Quantification was performed by external standards. Nitrogen in the plant tissue was determined by oxidative combustion of 5–10 mg of homogenized, pulverized dry samples in a CHN-analyser (CHN-O-RAPID, Elementar, Hanau, Germany). Because of the origin of a common experiment, element data of Fig. 1 are presented and discussed in another context (Ache, personal communication).

image

Figure 1. Na contents in different organs of poplar trees upon salt treatment. Presented are the amounts of Na in roots, stems and leaves of experiment I and II. White boxes indicate nitrate with salt; grey boxes indicate nitrate only; striped boxes indicate ammonium with salt, and black boxes indicate feeding with ammonium only. Columns represent means of independent measurements of 6 individual plants per treatment and SD. Significant differences are indicated by * (P ≤ 0.05), ** (P ≤ 0.01) and *** (P ≤ 0.001). 1 indicates that the significance identified with the general linear model (GLM) was recalculated because of heterogeneous variances and could not be re-identified. 2 indicates that the significance identified with the GLM was recalculated because of heterogeneous variances and could be re-identified only in the salt-treated group, but not in the non-salt-treated group. −, not significant; N, N nutrition; S, salt treatment; N*S, interaction of N nutrition and salt treatment; DW, dry weight.

Download figure to PowerPoint

Extraction and detection of water-soluble protein (WSP)

For protein analysis, 50 mg of plant tissue homogenized in liquid nitrogen was extracted in four volumes of extraction buffer (120 mM HEPES pH 7.5, 6 mM Mg-acetate, 1.2 mM EDTA and 3 µM Na2MoO4) by two strokes (5 s each) sonification (Sonopuls HD60; Bandelin, Berlin, Germany) on ice. The samples were centrifuged for 10 min at 4 °C and 17 500 × g in a Beckman-Microfuge R (Beckman Instruments, Palto Alto, CA, USA). Five microliters of the protein extract was incubated with 995 µL protein-assay solution (Bio-Rad) according to the manufacturer's instructions, and the absorbance was measured at 595 nm. BSA was used as standard.

Statistical analyses

Data derived from experiments I and II were analysed separately. For each time point, the impact of N nutrition, salt stress and the interaction of N nutrition and salt stress were analysed by a general linear model (GLM) (SPSS version 13.0, SPSS GmbH Software, Munich, Germany). In case of heterogeneous variances, P-values were evaluated by the Tamhane-T2 test for non-equal variances (SPSS version 13.0) wherever possible. P-values with P ≤ 0.05 were considered as significant differences.

RESULTS

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIAL AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES
  9. Supporting Information

Na accumulation in fine roots, stems and leaves

Young Grey poplar plants were fed either nitrate or ammonium while the plants were subjected to moderate salt concentrations in the hydroponic solution up to 75 mM NaCl. The focus was on the long-term effects on N metabolism of salt-adapted poplars so that time points analysed were after 1 and 2 weeks of salt exposure. The microclimatic conditions varied in two independent experiments with respect to air temperature and irradiation (see Materials and Methods). Because this affected transpiration (data not shown) and thus probably transport of mineral elements with the xylem sap, the results of both experiments were analysed separately.

In order to evaluate the actual in vivo impact of the moderate salt exposure of 75 mM NaCl on poplar fed with different N sources, the distribution of Na was analysed in roots, stems and leaves. The concentration of Na increased significantly in roots, stem and leaves after 1 and 2 weeks of salt application (Fig. 1). In roots, the Na concentration was already very high after the first week of salt application and reached almost 10 mg g−1 DW after the second week. In stems and leaves, the Na concentration increased more slowly over the 2 weeks of salt exposure. In leaves, Na concentrations increased from the first to the second week more than fourfold in experiment I and 9.5- to 20.0-fold in experiment II with nitrate and ammonium fertilization, respectively. The accumulation of Na was slowest in leaves, but after 2 weeks of salt exposure, similar concentrations as in stems had accumulated (up to 8.1 mg Na g−1 DW−1). This indicates that Na was taken up by, and distributed within the entire plant, thereby causing salt exposure to all plant organs. The N nutrition had no consistent impact on the Na accumulation.

Growth analysis

Economical interest on poplar in plantations is focused on high yields. Because N fertilization has, in general, a substantial impact on growth, we analysed growth in salt-treated poplar saplings in dependence of N nutrition. Root dry mass of plants fed nitrate was significantly higher than of plants grown with ammonium before exposure to salt treatment (Fig. 2). Root biomass was significantly reduced by the salt treatment at the end of both experiments, but there was no N nutrition-related effect. Root growth rates were also affected by salt as the diameter increment was significantly reduced when calculated over the whole experimental period (from T0 until T2 in Table 1). This reduction was more strongly affected by the salt treatment in ammonium-fed plants than in nitrate-fed plants (Table 1). Similarly, the stemheight growth was more reduced because of salt in ammonium-fed plants after 2 weeks (experiment I). Leaf growth was not significantly affected by salt exposure.

image

Figure 2. Dry weight (DW) of roots and leaves upon salt treatment. White boxes indicate nitrate with salt; grey boxes indicate nitrate only; striped boxes indicate ammonium with salt, and black boxes indicate feeding with ammonium only. Columns represent means of independent measurements of 6 individual plants per treatment and SD. Significant differences are indicated by ** (P ≤ 0.01) and *** (P ≤ 0.001). 1 indicates significant difference only in ammonium-fed plants. −, not significant; N, N nutrition; S, salt treatment; N*S, interaction of N nutrition and salt treatment.

Download figure to PowerPoint

Table 1.  Growth rates of different tissues after 2 weeks of salt treatment
Treatment from T0 until T2Root diameter increment (mm week−1)SignificanceStem height growth (mm week−1)SignificanceLeaf growth (numbers week−1)Significance
  1. Presented are means and SD (n = 6). Significant differences are indicated by * (P ≤ 0.05), ** (P ≤ 0.01) and *** (P ≤ 0.001). + indicates that P-values were recalculated because of heterologous variances, and significant differences due to salt were detected only in plants fed with ammonium. N, N nutrition; S, salt stress; N*S, interaction of N nutrition and salt treatment; ns, not significant.

Experiment I
NO3-with salt0.3 ± 0.0Nns48.8 ± 9.7Nns1.8 ± 0.3N*
without salt0.4 ± 0.3S***+55.8 ± 6.3S***1.9 ± 0.2Sns
NH4+with salt0.2 ± 0.2N*Sns46.7 ± 10.2N*Sns2.0 ± 0.4N*Sns
without salt0.7 ± 0.1  68.8 ± 10.7  2.3 ± 0.3  
Experiment II
NO3-with salt0.4 ± 0.1Nns29.2 ± 8.3Nns1.3 ± 0.6Nns
without salt0.5 ± 0.1S***+54.2 ± 9.4S***2.3 ± 0.5S**
NH4+with salt0.2 ± 0.2N*S**35.0 ± 11.5N*Sns1.7 ± 0.6N*Sns
without salt0.6 ± 0.1  53.3 ± 9.2  1.9 ± 0.2  

Gene expression analysis of nitrate and ammonium transporters in fine roots

Growth was affected as a result of salt treatment, especially when the plants were fed with ammonium. The different N source obviously had an impact on plant performance. We analysed stepwise the N metabolism beginning with N uptake via gene expression analysis of nitrate and ammonium transporters in fine roots after both 1 and 2 weeks of salt application. Two high-affinity transporters were selected for the analysis, namely, the high-affinity nitrate transporter NRT2.1 and the high-affinity ammonium transporter AMT1.2. Both transporters belong to gene families, but only the chosen isoforms were specifically root expressed and were thus presumably the most important N transporters (Selle, unpublished results; Selle et al. 2005). The transcript levels of both transporters were higher in nitrate-fed plants than in ammonium-fed plants independent of the salt treatment during the 2 weeks of analysis in each experiment (Fig. 3, except AMT1 at T = 0 in both experiments).

image

Figure 3. Impact of nitrogen nutrition and salt treatment on the expression of genes encoding nitrate (NRT2) and ammonium (AMT1) transporters. Total RNA was isolated from fine roots of Populus tremula × alba plants grown with either nitrate or ammonium in the presence or absence of 75 mM NaCl at time point 0, after 1 and 2 weeks. Quantification was performed by real-time PCR. White boxes indicate nitrate with salt; grey boxes indicate nitrate only; striped boxes indicate ammonium with salt, and black boxes indicate feeding with ammonium only. Columns represent means of independent measurements of 4 individual plants per treatment and SD. Signal intensities were calibrated according to a constitutively expressed poplar actin gene (Langer et al. 2004) and 18S rRNA. Significant differences are indicated by * (P ≤ 0.05), ** (P ≤ 0.01) and *** (P ≤ 0.001). P-values marked with 1 indicate that the significance identified with the general linear model (GLM) was recalculated because of heterogeneous variances and could not be re-identified. −, not significant; N, N nutrition; S, salt treatment; N*S, interaction of N nutrition and salt treatment.

Download figure to PowerPoint

In nitrate-supplied plants, NRT2.1 transcripts accumulated more under salt exposure compared with controls not exposed to salt after 1 week, but after 2 weeks, transcript accumulation was less in the presence of salt compared to controls. NRT2.1 transcript levels did not change as a result of salt treatment when ammonium was supplied as N source.

In nitrate-fed plants, AMT1.2 transcripts accumulated during the 2 weeks of experiment in both salt-treated and control plants. However, this accumulation was significantly lower in salt-treated poplar. In ammonium-fed plants, the AMT1.2 transcript level did not change as a consequence of salt treatment. Thus, the response of the AMT1.2 transcript level differed significantly depending on both N nutrition and salt-stress treatment (P-values for N*S 0.011 and 0.044 for experiments I and II, respectively).

N uptake of poplar was measured in experiments performed under comparable meteorological conditions (light, temperature, salinity levels) as described in this study, but with plants in aerated aqueous solution (Dluzniewska et al. 2007) and not on clay granulate. N uptake was significantly reduced because of salt exposure only in ammonium-fed plants, whereas in nitrate-fed plants, N net uptake was not affected by salt. This was consistent with our results indicating that plants fed with nitrate were less affected by salt treatment than plants fed with ammonium.

NR gene expression and NR enzyme activity in roots and leaves

Subsequent to its uptake, nitrate has to be reduced before being further assimilated. This key step in N assimilation is catalysed by the NR producing nitrite, which is further reduced to ammonium. Both NR gene expression and NR enzyme activity were analysed, because nitrate reduction is highly regulated by environmental and internal factors on the transcriptional level as well as on the post-transcriptional level for fine tuning (Kaiser & Huber 1994). Substantially higher NR transcript levels were detected in roots of plants fed with nitrate than in roots of plants fed with ammonium (Fig. 4). Application of salt stress resulted only in a minor decrease of NR transcript levels in both nitrate- and ammonium-fed plants (Fig. 4).

image

Figure 4. Nitrate reductase (NR) transcript accumulation in root tissue of poplar upon salt treatment. Northern hybridizations were performed using NR probe. The relative expression level was calculated by normalization with 18S hybridization signals.

Download figure to PowerPoint

Accordingly, a significant higher NR activity was detected in roots of nitrate-fed plants than in roots of plants fed with ammonium at all time points analysed (Fig. 5). The average NR activity in control roots amounted to 1.5 ± 0.7 µmol h−1 mg−1 (experiment I) and 0.7 ±0.4 µmol h−1 mg−1 (experiment II) for nitrate-fed plants, and to 1.0 ± 1.0 µmol h−1 mg−1 (experiment I) and 0.3 ±0.2 µmol h−1 mg−1 (experiment II) for ammonium-fed plants. Salt treatment had no clear-cut impact on NR activity observed in roots (Fig. 5). The average NR activity in leaves was 0.286 ± 0.122 µmol h−1 mg−1 and consistent differences in NR activity as a result of different nitrogen sources (NO3- versus NH4+) or salt stress were not observed (Fig. 5). The specific root-to-shoot ratio of NR activity under NO3- supply amounted to 3:1 on an FW basis, while it was slightly lower upon NH4+ supply.

image

Figure 5. Nitrate reductase activity (NRA) in roots and leaves of poplar in response to salt treatment. NRA is expressed as micromole nitrite per hour and milligram protein, in leaves and roots of poplar plants after 0, 1 and 2 weeks exposure in two independent experiments (I and II). White boxes indicate nitrate with salt; grey boxes indicate nitrate only; striped boxes indicate ammonium with salt, and black boxes indicate feeding with ammonium only. Columns represent means of independent measurements of 6 individual plants per treatment and SD. Significant differences are indicated by * (P ≤ 0.05), ** (P ≤ 0.01) and *** (P ≤ 0.001). 1 indicates that the significance identified with the general linear model (GLM) was recalculated because of heterogeneous variances and could not be re-identified. −, not significant; N, N nutrition; S, salt treatment; N*S, interaction of N nutrition and salt treatment.

Download figure to PowerPoint

Total N concentration in roots and leaves

According to our results, plants reacted differently to salt treatment depending on N nutrition. Upon analysing N transporters and N assimilation, total N concentrations were determined in roots and leaves. At the beginning of the salt stress treatment (T = 0), the total N concentration was significantly higher in roots and leaves of ammonium-fed plants (Table 2). Salt treatment resulted in a significant increase of total N concentration in both roots and leaves especially after 2 weeks of salt application. In roots, the salt response was not dependent on N nutrition. In leaves, however, the increase in total N concentration due to salt exposure was 1.3-fold in nitrate-fed plants and 1.0- to 1.1-fold in ammonium-fed plants, and was therefore significantly dependent on N nutrition (N*S: P = 0.006 and 0.025 for experiments I and II, respectively). In contrast to total N concentration, there were no changes in total N content in the whole leaf biomass of a plant as a result of salt exposure. Changes in total N content of roots upon salt treatment did not consistently depend on N nutrition.

Table 2.  Total N concentrations and absolute contents in poplar leaves and roots as affected by different N nutritions and salt treatment
TreatmentLeaves (g N g−1 DW)Sig.(g N)Sig.Roots (g N g−1 DW)Sig.(g N)Sig.
  1. Presented are means and SD (n = 6). Significant differences (Sig.) are indicated by * (P ≤ 0.05), ** (P ≤ 0.01) and *** (P ≤ 0.001). ns, not significant; N, N nutrition; S, salt stress; N*S, interaction of N nutrition and salt treatment; DW, dry weight.

Experiment I
Time point 0
NO3-without salt1.8 ± 0.1N***5.7 ± 1.3Nns0.8 ± 0.1N***1.6 ± 0.3Nns
NH4+without salt2.2 ± 0.2  6.1 ± 0.9  1.0 ± 0.1  1.5 ± 0.1  
After 1 week
NO3-with salt2.0 ± 0.2N***5.4 ± 1.1N*0.9 ± 0.1Nns2.4 ± 0.5Nns
without salt1.7 ± 0.1S***5.5 ± 1.0Sns0.9 ± 0.1Sns2.9 ± 0.6S*
NH4+with salt2.2 ± 0.1N*Sns6.5 ± 1.0N*Sns0.9 ± 0.1N*Sns2.3 ± 0.3N*Sns
without salt2.0 ± 0.1  6.3 ± 1.0  0.9 ± 0.1  2.8 ± 0.7  
After 2 weeks
NO3-with salt2.1 ± 0.1N***5.7 ± 1.1N***0.9 ± 0.1Nns2.6 ± 0.6Nns
without salt1.6 ± 0.1S***4.7 ± 0.7Sns0.8 ± 0.1S*2.9 ± 0.4S*
NH4+with salt2.4 ± 0.3N*S**6.6 ± 0.9N*Sns1.0 ± 0.1N*Sns2.8 ± 0.4N*Sns
without salt2.4 ± 0.2  6.9 ± 1.3  0.9 ± 0.1  3.4 ± 0.2  
Experiment II
Time point 0
NO3-without salt1.7 ± 0.1N***5.4 ± 0.9N*0.7 ± 0.1N**2.7 ± 0.3N*
NH4+without salt2.0 ± 0.1  6.5 ± 1.3  0.8 ± 0.1  2.3 ± 0.5  
After 1 week
NO3-with salt1.9 ± 0.2Nns4.9 ± 0.6Nns0.9 ± 0.1Nns3.1 ± 0.5Nns
without salt1.9 ± 0.3Sns6.0 ± 1.3Sns0.9 ± 0.1Sns3.3 ± 0.7Sns
NH4+with salt1.9 ± 0.1N*Sns6.8 ± 1.0N*S**0.9 ± 0.1N*Sns3.5 ± 0.2N*S*
without salt1.9 ± 0.1  5.6 ± 0.4  0.8 ± 0.1  2.7 ± 0.4  
After 2 weeks
NO3-with salt2.3 ± 0.1N**5.9 ± 1.7Nns0.9 ± 0.0Nns2.6 ± 0.4Nns
without salt1.7 ± 0.2S***5.3 ± 1.3Sns0.8 ± 0.1S**3.7 ± 0.6S*
NH4+with salt2.3 ± 0.2N*S*6.7 ± 0.6N*Sns0.9 ± 0.1N*Sns3.2 ± 0.7N*S*
without salt2.1 ± 0.1  6.3 ± 1.1  0.8 ± 0.1  3.2 ± 0.3  

Analysis of amino compounds and proteins in fine roots and leaves

Total N concentrations increased upon salt stress in both leaves and roots, and in leaves, the amplitude of this effect was dependent on the N nutrition. N taken up by plants is assimilated and incorporated in amino acids, units of proteins, and in purine and pyrimidine bases, units of nucleic acids. Proteins and amino acids are frequently turned over and interconverted depending on external and internal stimuli. Because of changes in total N concentrations, the concentration and composition of amino compounds, as well as proteins soluble in the aqueous phase, were determined in fine roots and leaves. Consistent with our findings on transporters and NR, protein concentrations were significantly higher in nitrate than in ammonium-fed roots during the entire time of analyses (except in experiment II, T = 2 weeks) (Fig. 6). The concentration of WSPs detected in roots was not consistently affected by salt treatment. In leaves, protein concentrations were different from the results found in roots, significantly higher in ammonium-fed plants than in nitrate-fed plants – an effect which was detectable only before the onset of salt treatment. The protein concentration in leaves was not affected by the salt treatment.

image

Figure 6. Water-soluble protein (WSP) contents of poplar leaves and roots as affected by salt treatment. Protein contents were analysed in leaves and roots in experiment I and II. White boxes indicate nitrate with salt; grey boxes indicate nitrate only; striped boxes indicate ammonium with salt, and black boxes indicate feeding with ammonium only. Columns represent means of independent measurements of 6 individual plants per treatment and SD. Significant differences are indicated by * (P ≤ 0.05) and *** (P ≤ 0.001); −: not significant. N, N nutrition; S, salt treatment; N*S, interaction of N nutrition and salt treatment. FW, fresh weight.

Download figure to PowerPoint

Control plants had generally higher concentrations of amino compounds in roots of ammonium-fed plants than in roots of nitrate-fed plants at all time points (except experiment II, T = 0) (Table 3). Two weeks of salt treatment resulted in a significant increase of amino compound concentrations but only in roots of ammonium-fed plants, which indicates a significant effect of N nutrition on the salt stress response in roots (N*S with P -values between 0.001 and 0.005). The same significant effect was detected in total contents of amino compounds in the whole root biomass of a plant (N*S with P-values between 0.000 and 0.039).

Table 3.  Concentration and total contents of amino acid compounds in leaves and roots of salt-treated poplar
TreatmentLeaves (µmol N g−1 FW)Sig.(µmol N)Sig.Roots (µmol N g−1 FW)Sig.(µmol N)Sig.
  1. Presented are means and SD (n = 6). Significant differences (Sig.) are indicated by * (P ≤ 0.05), ** (P ≤ 0.01) and *** (P ≤ 0.001). 1 indicates that the significance identified with the general linear model (GLM) was recalculated because of heterogeneous variances and could not be re-identified. 2 indicates that P-values were recalculated because of heterologous variances, and significant differences were only found in nitrate-fed plants. N, N nutrition; S, salt stress; N*S, interaction of N nutrition and salt treatment; ns, not significant; FW, fresh weight.

Experiment I
Time point 0
NO3-without salt2.60 ± 0.33N***26.5 ± 5.5Nns5.60 ± 0.86N***50.5 ± 9.5Nns
NH4+without salt3.41 ± 0.55  31.5 ± 7.4  7.92 ± 1.93  55.6 ± 15.5  
After 1 week
NO3-with salt6.42 ± 0.73N*52.1 ± 12.3N*15.66 ± 1.24Nns71.8 ± 21.1Nns
without salt3.29 ± 0.42S***29.5 ± 2.4S***4.28 ± 1.21Sns66.7 ± 21.8Sns
NH4+with salt7.97 ± 1.36N*Sns75.1 ± 22.1N*Sns5.35 ± 2.25N*Sns67.1 ± 31.7N*Sns
without salt3.66 ± 0.53  36.2 ± 8.0  4.74 ± 0.71  70.0 ± 17.6  
After 2 weeks
NO3-with salt9.18 ± 1.43Nns76.0 ± 10.8Nns4.15 ± 0.82Nns51.5 ± 13.9N*
without salt4.26 ± 1.58S***34.4 ± 13.1S***4.10 ± 0.53S***58.5 ± 8.7Sns
NH4+with salt10.70 ± 2.56N*Sns93.5 ± 23.8N*Sns5.89 ± 0.55N*S***73.3 ± 10.9N*S*
without salt3.19 ± 0.32  29.4 ± 5.9  3.51 ± 0.93  59.2 ± 12.5  
Experiment II
Time point 0
NO3-without salt2.49 ± 0.80N*24.0 ± 9.6Nns5.39 ± 2.48Nns79.7 ± 34.7Nns
NH4+without salt3.15 ± 0.64  31.6 ± 9.9  4.68 ± 2.33  56.9 ± 32.6  
After 1 week
NO3-with salt6.29 ± 5.31Nns45.9 ± 37.2Nns4.90 ± 1.38Nns65.8 ± 13.9Nns
without salt2.40 ± 0.56S*122.5 ± 4.7S*12.75 ± 1.23S*43.5 ± 15.0S**
NH4+with salt3.87 ± 3.31N*Sns35.1 ± 20.3N*Sns4.40 ± 1.87N*Sns70.7 ± 21.0N*Sns
without salt1.85 ± 0.10  15.0 ± 2.4  3.80 ± 0.76  54.7 ± 10.4  
After 2 weeks
NO3-with salt11.47 ± 7.61Nns82.9 ± 74.1Nns4.88 ± 2.16Nns56.4 ± 20.4Nns
without salt2.89 ± 0.53S***122.5 ± 4.7S**16.50 ± 0.76Sns111.7 ± 25.1Sns2
NH4+with salt9.29 ± 5.25N*Sns80.3 ± 49.6N*Sns11.15 ± 6.18N*S**155.0 ± 73.9N*S***
without salt3.12 ± 0.55  25.4 ± 2.4  4.12 ± 1.14  69.7 ± 17.6  

In leaves, the concentration of amino compounds was significantly higher in ammonium-fed plants than in nitrate-fed plants at the beginning of the experiment (T = 0) (Table 3) similar to protein concentrations. In contrast to protein contents, treatment with 75 mM NaCl resulted in a continuous increase of total amino N concentrations in leaves of both nitrate and ammonium-fed plants during the 2 weeks of salt exposure. The same increase was detected in the content of total amino compounds in whole leaf biomass of both nitrate and ammonium-fed plants after 1 and 2 weeks of salt treatment (Table 3).

The total amino N concentrations changed in response to salt exposure, and also, the composition of amino compounds changed, depending on the N source (detailed table of individual amino acid compounds in Supplementary Table S1). Amino acids were sorted into groups of biosynthetic origin (Coruzzi & Last 2000). Different N nutritions at the beginning of the experiment did not change the total and relative contents of biosynthetic groups of amino compounds in leaves, and there were only minor differences in roots between different N sources (data not shown). Non-proteinogenic amino compounds, summarized as ‘others’[γ-aminobutric acid (GABA), NH4+, ornithine, ethanolamine, DL-allohydroxyllysin] were present in higher proportions in roots of NH4+-fed (20–23%) than NO3--fed plants (13–15%). The main components of this group were GABA and NH4+. Amino acids synthesized via aspartate showed lower proportions in roots of NH4+-fed (16–21%) than in NO3--fed plants (22–27%).

In roots of salt-stressed plants grown with NH4+, the increase in the total amount of amino compounds was mainly due to an increase in aspartate- and glutamate-derived amino compounds (Fig. 7a). The main component of the aspartate group was asparagine, and the main component of the glutamate group was glutamine. The amount of amino acids originating from the shikimate pathway, that is, tryptophan, tyrosine and phenylalanine, was more than doubled upon salt stress with tryptophan being the major component. Changes in the proportional distribution of groups of amino compounds were different from changes of the absolute amounts of amino compound groups. The proportion of the aspartate group increased substantially under salt stress (from 18 to 34% and from 20 to 41% in experiments I and II, respectively), but the proportion of the glutamate group (variation between 32 and 35% in both experiments) and of the shikimate amino acids (variation between 5 and 8%) did not change. The proportional increase of the aspartate group was compensated by a proportional decrease of non-protein amino compounds.

image

Figure 7. Amino compounds in roots (a) and leaves (b) of poplar plants treated with salt for 2 weeks at nitrate or ammonium nutrition. Amino acids are grouped together deriving from the same pathway. Presented are the percentual distributions of these biosynthetic groups, and mean values of sums of amino compounds of each group of six plants and SD. Black: cysteine, serine, glycine; black-dotted: proline, glutamate, glutamine, histidine, arginine; light grey: tryptophane, tyrosine, phenylalanine; dark grey: alanine, leucine, valine; white: GABA, ammonium, ornithine, ethnolamine, DL-allohydroxyllysin; white-dotted: asparagine, aspartate, lysine, methionine, isoleucine, threonine. FW, fresh weight.

Download figure to PowerPoint

In leaves of salt-stressed plants, the effect of salt treatment on the pattern of amino compounds was completely different from the pattern observed in roots (Fig. 7b). All groups of amino compounds increased upon salt stress independent of the N source. Amino acids derived from serine increased most in NO3- (between three- and sixfold increase in experiments I and II, respectively) as well as in NH4+ fed plants (fivefold in both experiments), also resulting in an increased contribution to total amino compounds (relative increase between 12 and 16%). The most abundant amino acid of this group was serine. In addition, amino acids derived from glutamate increased two- to threefolds as a result of salt independent of the N source. The relative proportion of this group of amino compounds did not change when the plants were fed with NO3-, but decreased in NH4+-fed plants upon salt stress (44–27% and 45–32% in experiments I and II, respectively). Glutamate was the most abundant amino compound in this group. Its relative amount did not change in NO3--fed plants, but decreased in NH4+-fed plants because of salt stress from 33 to 13% and from 34 to 18% in experiments I and II, respectively. The absolute amount of proline, also belonging to the glutamate group, increased more than threefold upon salt stress; however, its proportion within its biosynthetic group did not change. Amino compounds of the aspartate group increased in total amounts in response to salt, but this increase did not exceed the general increase in amino compounds.

DISCUSSION

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIAL AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES
  9. Supporting Information

The major long-term effects of grey poplar exposed to moderate salt concentrations on N metabolism were significantly increased amino acid concentrations in leaves and roots dependent on N nutrition. In leaves, salt treatment resulted in significant higher amino acid concentrations quantitatively independent of N nutrition, but with qualitative differences, whereas in roots, amino acid concentration increased more intensively in ammonium-fed plants. Growth and N metabolism analysed via NR and N transporter transcript accumulation, NR activity, and protein concentration were in general more affected by salt exposure in roots than in leaves. Application of salt reduced root diameter increment as well as stem height more intensively in ammonium-fed plants. This indicates that plants perform better under salt exposure when fed nitrate. These N nutrition-dependent effects on N metabolism of salt-exposed plants were more intensive in roots than in leaves.

N nutrition-dependent long-term response to salt exposure

The different N nutritions had impact on control plants not exposed to salt. Parameters of N metabolism (transcript level of NRT2.1 and NR, NR activity, protein concentration) and root diameter increment analysed in roots were consistently higher in nitrate than in ammonium-fed control plants. However, total N and amino acid concentrations were higher in roots and leaves of ammonium-fed plants. In leaves, protein concentration was also higher upon feeding control plants with ammonium.

Because N nutrition ameliorates tolerance towards salt, the impact of nitrogen versus ammonium on the N metabolism has been analysed in detail with regard to N uptake via transporters, N assimilation and total N accumulation including proteins and amino acids. Poplar plants were exposed to 75 mM NaCl, a concentration that was comparably low in order to study long-term effects and avoid early lethal damages. Na was taken up and distributed within the entire plant, therefore exposing all plant tissues to salt. A more detailed study on ion contents showed that also Cl ions were taken up by the plant, transported and accumulated because of salt treatment in leaves of both nitrate and ammonium-fed plants (Ache, personal communication). Photosynthetic gas exchange of Grey poplar leaves was highly affected by the salt stress and dropped up to 93%, and transpiration rates were reduced to the same extent (data not shown).

Because many studies on the physiological effects of salt stress have been performed in hydroponic solutions, we also preferred to perform our studies in hydroponic solutions. Although differences due to the choice of substrate may occur (Volkov et al. 2004; Kant et al. 2006), similar trends in overall reactions can be expected. Salt stress experiments with other poplar species grown in sand cultures present similar results than we observed with respect to growth rates (Sixto et al. 2005; Chang et al. 2006). For comparison of different data sets, not only the substrate but also the variability between clones of the same species has to be considered (Sixto et al. 2005).

As an indicator for the N uptake, transcript levels of nitrate and ammonium transporters have been analysed. The NO3- and NH4+ transporters analysed in this study as well as NR were mainly induced by NO3-. Mineral N nutrition is strongly dependent on water availability (Gessler et al. 2005), and because salinity reduces osmotic water potential and therefore the water availability, we suggest that nitrogen uptake via NO3- and NH4+ transporters is affected by salt stress. However, mRNA levels of both transporters of NH4+ supplied plants were not affected by salt treatment at all. This was consistent with the NH4+ concentration in roots, which was also not affected by the salt treatment (Supplementary Table S1). Although in nitrate-fed plants NO3- and NH4+ transporter transcripts were lower in the presence of salt than in controls, levels of transporter transcripts were still higher than in ammonium-fed plants (with or without salt). It may be possible that other members of the nitrate or ammonium transporter gene families respond more pronouncedly. However, compared to the two further genes of the NRT2 gene family, only NRT2.1 is root specific and expressed at least at a tenfold higher level than any other members of the NRT2 gene family (Selle, unpublished results), and is thus presumably the most important nitrate importer in fine roots. Furthermore, among three members of the AMT1 gene family that are expressed in fine roots to a comparable extent, AMT1.2 is the only root specifically expressed gene (Selle et al. 2005) and was thus chosen for analysis.

Upon N uptake, nitrate was subjected to reduction. Providing NO3- as the sole nitrogen source resulted in substantially higher NR transcript accumulation and NR activity in roots. Salt had only minor impact on NR transcript accumulation and NR activity. NR is the key enzyme in N assimilation and is therefore highly regulated in its transcriptional and post-transcriptional regulation. From the present experiment, it seems that moderate salt exposure does not negatively affect NR transcript accumulation and NR activity on the long term, and the plants were already adapted after 1 week of salt treatment. Effects of salinity on NR activity in other species are reported contradictory. NR activity was slightly inhibited by salt in tomato roots (Cramer & Lips 1995), in maize leaves (Abd el Baki et al. 2000) and in leaves of Bruguira parviflora (Parida & Das 2004), whereas in soybean, NR activity was stimulated (Bourgeais-Chaillou et al. 1992).

The total N concentration and the amino acid concentration increased in roots and leaves because of salt. In roots, the increase of total N concentration was independent of the N source, whereas the increase of amino acids occurred only in ammonium-fed roots. In leaves, the increase of total N was favoured in nitrate-supplied plants, while the total concentration of amino compounds increased significantly in leaves of both nitrate- and ammonium-fed plants. This suggests that changes in total N concentrations due to salt are only partially reflected by changes in amino acid concentrations. Accumulation of free amino acids under water stress has been shown in many plant species with different amino acids increasing in different species (summarized by Rai 2002). In addition, poplars grown in aerated aqueous solutions increased the concentration of amino compounds in leaves independent of N nutrition (Dluzniewska et al. 2007). Accumulation of free amino acids in stressed plants could be a consequence of several processes (Mansour 2000), for example, protein degradation (Becker & Fock 1986) and/or growth inhibition (Davies & van Volkenburgh 1983). In the present experiment, the increase of amino compounds was not due to degradation of WSP in leaves or roots (Fig. 6). However, non-soluble proteins could be decomposed and could account for the increase in amino acids (Dluzniewska et al. 2007). There was no growth inhibition of leaves (Table 1 & Fig. 2), but root DW and root diameter increment was smaller upon salt exposure when the plants were fed with ammonium. In parallel, the increase in the concentration of amino compounds in roots only occurred in ammonium-fed plants. It might be possible that the increase of amino compounds correlates with inhibited growth in roots. Other explanations for the accumulation of free amino compounds such as inhibition of protein synthesis (Dhindsa & Cleland 1975) and/or decreases in amino acid export (Tully, Hanson & Nelson 1979) were not investigated in this study. In addition, mobilization of storage proteins in bark and wood (Cooke & Weih 2005) and transport of the constituent amino compounds to the leaves and/or roots cannot be excluded from the present results.

Accumulation of amino compounds in roots and leaves in response to salt stress is thought to be connected to the compensation of salt stress by compatible solutes (Mansour 2000). Proline is 300 times more soluble in water than other amino acids and thus can act as a non-toxic osmoprotectant (Palfi et al. 1974). It is accumulating because of salt stress in many plants (Lee & Liu 1999; Khatkar & Kuhad 2000; Muthukumarasamy, Gupta & Panneerselvam 2000; Singh et al. 2000; Jain et al. 2001; Popova et al. 2003). In this study, proline was not detected in Grey poplar roots, but in leaves, proline increased more than three to four times (experiments I and II, respectively) upon salt stress. However, this increase was not specific, because a general increase of the soluble amino acid content was observed in the same order of magnitude, and other amino compounds, such as serine, increased more than 10-fold. In Populus euphratica, proline also appears to play only a minor role in cell pressure adjustment because its overall concentration is too small to compensate salt stress considerably (Ottow et al. 2005).

When amino compounds are sorted into groups of biosynthetic origin, proline belongs to the glutamate group. The major components of the glutamate biosynthetic group are glutamate and glutamine. Although proline and glutamate accumulated in response to salt stress, the relative abundance of the glutamate biosynthetic group decreased. Accumulation of glutamine upon salt stress was also detected in other plant species (Amonkar & Karmarkar 1995). Both the primary route of NH4+ assimilation as well as reassimilation of photorespiratory NH4+ produce glutamine. Changes in photorespiration may have caused the increase of glutamine in the present study, because other products of photorespiration, that is, serine, also increased substantially as a result of salt treatment independent of the N source. Serine is the precursor for cysteine. Cysteine, glutamate and glycine are important for synthesis of glutathione (GSH), which has been significantly increased because of moderate salt treatment analysed after 1 and 2 weeks (Herschbach, personnal communication). GSH synthesis is linked to photorespiration, probably because photorespiratory glycine is required for GSH synthesis (Noctor et al. 1999). In further experiments, photorespiration needs to be analysed in order to evaluate its actual impact.

In roots, the relative and absolute amounts of amino compounds changed differently upon salt treatment compared to leaves. There were no major effects of salt treatment on total amino compounds in NO3--fed roots. In NH4+-fed roots, amino acids synthesized from aspartate, with asparagine being the main component, were increased because of salt. Asparagine, synthesized via amidation of aspartate, represents an inert amino acid used as storage and/or transport of N from source to sink tissue. In parallel, amino acids of the glutamate group increased as a result of salt stress with glutamine being the major component. Glutamine is also used for long-distance N transport and may indicate more intensive allocation of amino N from the roots to the shoots.

The accumulation of specific amino acids indicates an active process of adaptation and protection in response to salinity, such as the production of osmoprotectants and compounds reactive against oxidative stress, as well as the mobilization and transformation into transport forms. However, there may be more than one function for one particular osmoprotectant, and different osmoprotectants can have different functions (Hasegawa et al. 2000).

ACKNOWLEDGMENTS

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIAL AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES
  9. Supporting Information

We gratefully acknowledge M. Kay and T. Meyer for technical assistance, as well as U. Neef and M. Brinker for providing RNA for the present analysis. This study was financially supported by the Deutsche Forschungsgemeinschaft (DFG) under the contracts Hänsch HA3107/32, Rennenberg RE515/20, Schnitzler SCHN653/4, Nehls, NE332/9-1 and Polle PO362/13.

REFERENCES

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIAL AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES
  9. Supporting Information
  • Abd el Baki G.K., Siefritz F., Man H.M., Welner H., Kaldenhoff R. & Kaiser W.M. (2000) Nitrate reductase in Zea mays L. under salinity. Plant, Cell & Environment 23, 515521.
  • Amonkar D.V. & Karmarkar S.M. (1995) Nitrogen uptake and assimilation in halophytes. In Nitrogen Nutrition in Higher Plants (eds H.S.Srivastava & R.P.Singh), pp. 431445. Associated Publisher Co., New Delhi, India.
  • Ashraf M. (1994) Breeding for salinity tolerance in plants. Critical reviews in Plant Science 13, 1742.
  • Ashraf M. & Sultana R. (2000) Combination effect of NaCl salinity and nitrogen form on mineral composition of sunflower plants. Biologia Plantarum 43, 615619.
  • Aslam M., Huffaker R.C. & Rains D.W. (1984) Early effects of salinity on nitrate assimilation in barley seedlings. Plant Physiology 76, 321325.
  • Becker T.W. & Fock H.P. (1986) The activity of nitrate reductase and the pool size of some amino acids and some sugars in water-stressed maize leaves. Photosynthesis Research 8, 267274.
  • Blum A., Munns R., Passioura J.B., Turner N.C., Sharp R.E., Boyer J.S., Nguyen H.T., Hsiao T.C., Verma D.P.S. & Hong Z. (1996) Genetically engineered plants resistant to soil drying and salt stress: how to interpret osmotic relations? Plant Physiology 110, 10511053.
  • Bolu W.H. & Polle A. (2004) Growth and stress reactions in roots and shoots of a salt-sensitive poplar species (Populus × canescens). Tropical Ecology 45, 161171.
  • Botella M.A., Martinez V., Nieves M. & Cerdá A. (1997) Effect of salinity on the growth and nitrogen uptake by wheat seedlings. Journal of Plant Nutrition 20, 793804.
  • Bourgeais-Chaillou P., Perez-Alfocea F. & Guerrier G. (1992) Comparative effect of N sources on growth and physiological responses of soybean exposed to NaCl-stress. Journal of Experimental Botany 43, 12251233.
  • Brown A.D. & Simpson J.R. (1972) Water relations of sugar-tolerant yeast: the role of intracellular polyols. Journal of Genetical Microbiology 72, 589591.
  • Brüggemann N. & Schnitzler J.P. (2002) Comparison of isoprene emission, intercellular isoprene concentration and photosynthetic performance in water-limited oak (Quercus pubescens Willd. and Quercus robur L.) saplings. Plant Biology 4, 456463.
  • Chang Y., Chen S.-L., Yin W.-L., Wang R.-G., Liu Y.-F., Shi Y., Shen Y.-Y., Li Y., Jiang J. & Liu Y. (2006) Growth, gas exchange, abscisic acid, and calmodulin response to salt stress in three poplars. Journal of Integrative Plant Biology 48, 286293.
  • Cooke J.E.K. & Weih M. (2005) Nitrogen storage and seasonal nitrogen cycling in Populus: bridging molecular physiology and ecophysiology. New Phytologist 167, 1930.
  • Coruzzi G. & Last R. (2000) Amino acids. In Biochemistry and Molecular Biology of Plants. (eds B.B.Buchanan, W.Gruissem & R.L.Jones), pp. 358410. American Society of Plant Physiologists, Rockville, MD, USA.
  • Cramer M.D. & Lips S.H. (1995) Enriched rhizosphere CO2 concentration can ameliorate the influence of salinity on hydroponically grown tomato plants. Physiologia Plantarum 94, 425433.
  • Davies W.J. & Van Volkenburgh E. (1983) The influence of water deficit on the factors controlling the daily pattern of growth of Phaseolus trifoliates. Journal of Experimental Botany 34, 987999.
  • Dhindsa R.S. & Cleland R.B. (1975) Water stress and protein synthesis. Plant Physiology 55, 781788.
  • Dluzniewska P., Gessler A., Dietrich H., Schnitzler J.-P., Teuber M. & Rennenberg H. (2007) N uptake and its metabolism in Populus canescens upon salinity. New Phytologist 173, 279293.
  • Frechilla S., Lasa B., Ibarretxe L., Lamsfus C. & Aparicio-Tejo P. (2001) Pea responses to saline stress is affected by the source of nitrogen nutrition (ammonium or nitrate). Plant Growth Regulation 35, 171179.
  • Garcia A.B., Engler J.D.A., Iyer S., Gerats T., Van Montagu M. & Caplan A.B. (1997) Effects of osmoprotectants upon NaCl stress in rice. Plant Physiology 115, 159169.
  • Gessler A., Schneider S., Weber P., Hanemann U. & Rennenberg H. (1998) Soluble N compounds in trees exposed to high loads of N: a comparison between the roots of Norway spruce (Picea abies) and beech (Fagus sylvatica) trees grown under field conditions. New Phytologist 138, 385399.
  • Gessler A., Jung K., Gasche R., Papen H., Heidenfelder A., Metzler B.B.M., Augustin S., Hildebrand E. & Rennenberg H. (2005) Climate and forest management influence nitrogen balance of European beech forests: microbial N transformations and inorganic N net uptake capacity of mycorrhizal roots. European Journal of Forest Research 124, 95111.
  • Glass A.D.M., Britto D.T., Kaiser B.N., et al. (2002) The regulation of nitrate and ammonium transport systems in plants. Journal of Experimental Botany 53, 855864.
  • Gomez I., Pedreno J.N., Moral R., Iborra M.R., Palacios G. & Mataix J. (1996) Salinity and nitrogen fertilization affecting the macronutrient content and yield of sweet pepper plants. Journal of Plant Nutrition 19, 353359.
  • Grunze N., Willmann M. & Nehls U. (2004) The impact of ectomycorrhiza formation on monosaccharide transporter gene expression in poplar roots. New Phytologist 164, 147155.
  • Hasegawa P.M., Bressan R.A., Zhu J.K. & Bohnert H.J. (2000) Plant cellular and molecular responses to high salinity. Annual Review of Plant Physiology and Plant Molecular Biology 51, 463499.
  • Hewitt E.J. (1966) Sand and water culture methods used in the study of plant nutrition. In: 2nd Revised Edition, Commonwealth Bureau of Horticulture and Plantation Crops, East Malling, Technical Communication No. 22, pp. 430439. Commonwealth Agriculture Bureau, Farnham Royal, England.
  • Hoagland D.R. & Arnon D.I. (1950) The water-culture method for growing plants without soil. California Agricultural Experiment Station Circular 347, 132.
  • Jain M., Mathur G., Koul S. & Sarin N.B. (2001) Ameliorative effects of proline on salt stress-induced lipid peroxidation in cell lines of groundnut (Arachis hypogaea L.). Plant Cell Reporter 20, 463468.
  • Kaiser W.M. & Spill D. (1991) Rapid modulation of spinach leaf nitrate reductase by photosynthesis. 2. In vitro modulation by ATP and AMP. Plant Physiology 96, 368375.
  • Kaiser W.M. & Huber S.C. (1994) Posttranscriptional regulation of nitrate reductase in higher plants. Plant Physiology 106, 817821.
  • Kant S., Kant P., Raveh E. & Barak S. (2006) Evidence that differential gene expression between the halophyte, Thellungiella halophila, and Arabidopsis thaliana is responsible for higher levels of the compatible osmolyte proline and tight control of Na+ uptake in T. halophila. Plant, Cell & Environment 29, 12201234.
  • Khatkar D. & Kuhad M.S. (2000) Short-term salinity induced changes in two wheat cultivars at different growth stages. Biologia Plantarum 43, 629632.
  • Kishor P.B.K., Hong Z., Miao G.H., Hu C.A.A. & Verma D.P.S. (1995) Overexpression of D-pyrroline-5-carboxylate synthetase increases proline production and confers osmotolerance in transgenic plants. Plant Physiology 108, 13871394.
  • Langer K., Levchenko V., Fromm J., Geiger D., Steinmeyer R., Lautner S., Ache P. & Hedrich R. (2004) The poplar K+ channel KPT1 is associated with K+ uptake during stomatal opening and bud development. Plant Journal 37, 828838.
  • Lee T. & Liu C. (1999) Correlation of decreases in calcium contents with proline accumulation in the marine green macroalga Ulva fasciata exposed to elevated NaCl contents in seawater. Journal of Experimental Botany 50, 18551862.
  • Lewis O.A.M., Leidi E.O. & Lips S.H. (1989) Effect of nitrogen source on growth response to salinity stress in maize and wheat. New Phytologist 111, 155160.
  • Mansour M.M.F. (2000) Nitrogen containing compounds and adaptation of plants to salinity stress. Biologia Plantarum 43, 491500.
  • Munns R. (2005) Genes and salt tolerance: bringing them together. New Phytologist 167, 645663.
  • Muthukumarasamy M., Gupta S.D. & Panneerselvam R. (2000) Enhancement of peroxidase, polyphenol oxidase and superoxide dismutase activities by triadimefon in NaCl stressed Raphanus sativus L. Biologia Plantarum 43, 317320.
  • Noctor G., Arisi A., Jouanin L. & Foyer C. (1999) Photorespiratory glycine enhances glutathione accumulation in both the chloroplastic and cytosolic compartments. Journal of Experimental Botany 50, 11571167.
  • Ottow E.A., Brinker M., Teichmann T., Fritz E., Kaiser W., Brosché M., Kangasjärvi J., Jiang X. & Polle A. (2005) Populus euphratica displays apoplastic sodium accumulation, osmotic adjustment by decreases in calcium and soluble carbohydrates, and develops leaf succulence under salt stress. Plant Physiology 139, 17621772.
  • Palfi G., Koves F., Bito M. & Sebestyen R. (1974) The role of amino acids during water stress in species accumulating proline. Phyton 32, 121127.
  • Parida A.K. & Das A.B. (2004) Effects of NaCl stress on nitrogen and phosphorous metabolism in a true mangrove Bruguiera parviflora grown under hydroponic culture. Journal of Plant Physiology 161, 921928.
  • Parida A.K. & Das A.B. (2005) Salt tolerance and salinity effects on plants: a review. Ecotoxicology and Environmental Safety 60, 324349.
  • Popova O.V., Dietz K.J. & Golldack D. (2003) Salt-dependent expression of a nitrate transporter and two amino acid transporter genes in Mesembryanthemum crystallinum. Plant Molecular Biology 52, 569578.
  • Rai V.K. (2002) Role of amino acids in plant response to stresses. Biologia Plantarum 45, 481487.
  • Sambrook J. & Russel D.W. (2001) Molecular cloning: a laboratory manual, 3rd edn, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA.
  • Scheible W.R., Gonzalez Fontes A., Morcuende R., Lauerer M., Geiger M., Glaab J., Gojon A., Schulze E.D. & Stitt M. (1997) Tobacco mutants with a decreased number of functional nia genes compensate by modifying the diurnal regulation of transcription, post-translational modification and turnover of nitrate reductase. Planta 203,304319.
  • Selle A., Willmann M., Grunze N., Kopriva S. & Nehls U. (2005) The high affinity poplar ammonium importer PttAMT1.2 and its role in ectomycorrhizal symbiosis. New Phytologist 168, 697706.
  • Singh B. (1998) Biomass production and nutrient dynamics in three clones of Populus deltoides planted on Indogangetic plains. Plant and Soil 203, 1526.
  • Singh S.K., Sharma H.C., Goswami A.M., Datta S.P. & Singh S.P. (2000) In vitro growth and leaf composition of grapevine cultivars as affected by sodium chloride. Biologia Plantarum 43,283286.
  • Sixto H., Grau J.M., Alba N. & Alia R. (2005) Response to sodium chloride in different species and clones of genus Populus L. Forestry 78, 93104.
  • Speer M., Brune A. & Kaiser W.M. (1994) Replacement of nitrate by ammonium as the nitrogen source increases the salt sensitivity of pea plants. 1. Ion concentrations in roots and leaves. Plant, Cell & Environment 17, 12151221.
  • Tully R.E., Hanson A.D. & Nelson C.E. (1979) Proline accumulation in water stressed barley leaves in relation to translocation and the nitrogen budget. Plant Physiology 63, 518523.
  • Volkov V., Wang B., Dominy P.J., Fricke W. & Amtmann A. (2004) Thellungiella halophila, a salt-tolerant relative of Arabidopsis thaliana, possesses effective mechanisms to discriminate between potassium and sodium. Plant, Cell & Environment 27, 1.
  • Yancey P.H., Clark M.E., Hand S.C., Bowlus R.D. & Somero G.N. (1982) Living with water stress: evolution of osmolyte system. Science 217, 12141222.
  • Zhu J.K. (2001) Plant salt tolerance. Trends in Plant Science 6, 6671.

Supporting Information

  1. Top of page
  2. ABSTRACT
  3. INTRODUCTION
  4. MATERIAL AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES
  9. Supporting Information

Table S1. Amino compounds in nmol N g-1 FW in different organs of poplar trees with salt stress (+NaCl) or without salt stress (-NaCl) after one (T1) and two (T2) weeks.

FilenameFormatSizeDescription
PCE1668_TableS1.xls132KSupporting info item

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.