Regulation of isoprene emission from poplar leaves throughout a day

ABSTRACT

Isoprene is a biogenic hydrocarbon that significantly affects tropospheric chemistry. Numerous plant species, including many trees, emit isoprene. Isoprene is synthesized by isoprene synthase (IspS), from dimethylallyl diphosphate (DMADP) made by the methylerythritol 4-phosphate (MEP) pathway. It has been demonstrated that in developing leaves, isoprene emission is regulated by transcriptional control of IspS, while in mature leaves subjected to changing growth temperature, regulation of emission is shared between IspS and DMADP supply from the MEP pathway. Isoprene emission also varies throughout a day, with circadian regulation implicated. This study investigated changes in isoprene emission capacity, and expression of IspS and the enzymes of the MEP pathway throughout several days, with Populus trichocarpa grown at different temperatures to induce different levels of isoprene emission. Isoprene emission capacity exhibited ultradian regulation, with a period of about 12 h; peak capacity was observed at 0300 and 1500 h daily. Several of the enzymes of the MEP pathway had previously been suggested to have regulatory roles in the production of other plastidic terpenoids, and transcript accumulation for these enzymes, combined with in silico promoter analyses, supported a regulatory role for deoxyxylulose 5-phosphate synthase (DXS) in particular.

INTRODUCTION

Isoprene (2-methyl 1,3-butadiene) is a gaseous biogenic hydrocarbon that a variety of plants emit into the atmosphere. Globally, the flux of isoprene to the atmosphere is estimated to be 400–600 Tg year⁻¹, making isoprene the dominant gaseous hydrocarbon produced by vegetation (Arneth et al. 2008). Isoprene emitted by plants has significant effects on atmospheric chemistry. It can react in the presence of nitrogen oxides and hydroxyl radicals to produce tropospheric ozone (Haagen-Smit 1952; Chameides et al. 1988), and because it is more reactive with hydroxyl radicals than is the greenhouse gas methane, it can increase the lifetime of methane in the atmosphere (Zimmerman, Greenberg & Westberg 1988; Poisson, Kanakidou & Crutzen 2000). Therefore, the development of mechanistic models of isoprene emission will be helpful in atmospheric quality modelling and policy making; for such models to be developed, the factors that regulate isoprene emission from plants must be understood.

Isoprene is synthesized by isoprene synthase (IspS) (Silver & Fall 1991) acting upon dimethylallyl diphosphate (DMADP) produced by the chloroplastic methylerythritol 4-phosphate (MEP) pathway (Schwender et al. 1997). Leaf isoprene emission is light dependent (Sanadze & Kalandaze 1966; Sanadze 1969; Rasmussen & Jones 1973). Emission capacity tends to increase in the morning, peak in the afternoon and decline late in the afternoon (Sharkey et al. 1999; Geron et al. 2000; Funk et al. 2003); IspS transcript levels and whole-leaf DMADP quantities show the same pattern (Mayrhofer et al. 2005). This could be explained by circadian control of isoprene emission capacity. That has indeed been shown to be the case in Elaeis guineensis, with emission rates oscillating in continuous light (CL) with a temperature-compensated period of about 24 h (Wilkinson et al. 2006). Populus × canescens cell cultures have also been shown to have circadian-regulated isoprene emission; emission rates may have oscillated with an approximately 24 h period in CL, and IspS transcript levels did so as well (Loivamäki et al. 2007).

The present study was undertaken to investigate the regulation of diurnal variations in isoprene emission in poplar leaves. Isoprene emission from intact leaves in CL, continuous dark (CD) and light/dark (LD) cycles, and the changes in transcript accumulation of the MEP pathway genes and IspS were determined, as were changes in accumulated IspS protein. The MEP pathway genes were investigated because previous work had shown that control of isoprene emission from mature leaves in some conditions is shared between IspS and DMADP supply from the MEP pathway (Wiberley et al. 2008). This study tested whether there is circadian regulation of MEP pathway gene expression in an isoprene-emitting tree species, and if so, whether IspS and MEP pathway genes are coordinately regulated. This tests the hypothesis that variations in isoprene emission throughout a day are regulated by IspS in combination with variations in DMADP supply rather than by IspS alone, as is the case in developing leaves (Wiberley et al. 2005; Sharkey, Wiberley & Donohue 2008).

MATERIALS AND METHODS

Plant growth conditions

Poplar trees [Populus trichocarpa (Torr. & Gray)] were grown from rooted stem cuttings (kindly provided by Christopher Dervinis, University of Florida) in 19 L pots with a vermiculite/peat moss-based growth medium (Metro-Mix 366; Sun Gro Horticulture, Bellevue, WA, USA). The trees were grown in temperature-controlled greenhouses in the Biotron at the University of Wisconsin-Madison. Fifteen were grown at 20/16 °C day/night temperature, and 16 were grown at 30/20 °C day/night temperature. The plants were watered with one-tenth-strength Hoagland's solution (Hoagland & Arnon 1938), and also fertilized with 14-14-14 N-P-K Osmocote, applied according to the manufacturer's instructions (The Scotts Company, Marysville, OH, USA).

Three sets of light and temperature treatments were tested. Firstly, trees that had grown in the 20 °C Biotron greenhouse were transferred to growth chambers for CL or CD treatments. All 15 of the trees were kept in the chamber for 3 d prior to sampling, at 20/16 °C day/night temperatures, with lights turning on at 0500 h and off at 2100 h. Sampling began at 0600 h on 16 July 2007, and samples were collected every 3 h around the clock. After 24 h, five of the plants were moved to a chamber that was kept in continuous darkness at 16 °C, and the chamber housing the remaining 10 was kept with lights continuously on and at 20 °C. The plants remained in these conditions for 3 d, through 0300 h on 20 July 2007, with samples collected every 3 h around the clock. These plants are hereinafter called the ‘20CD’ for the CD treatment, or ‘20CL’ for the CL treatment plants.

The second treatment was the same, except eight trees that had grown in the 30 °C Biotron greenhouse were transferred to a 30/20 °C growth chamber, and after 24 h, three trees were moved to a chamber that was kept constantly dark at 20 °C. Five remained in a chamber with lights on and temperature at 30 °C constantly. Samples were collected from 14 through 18 August 2007. These are the ‘30CD’ or ‘30CL’ plants, depending on light regimen.

In the third treatment, plants remained in the 20/16 °C and 30/20 °C Biotron greenhouses with sunlight giving natural LD cycles (sunrise at 0630 h and sunset at 1915 h). Samples were collected every 3 h around the clock from 10 through 13 September 2007. These are the ‘20LD’ or ‘30LD’ plants, depending on temperature regimen. At every time-point in every treatment, with the exception of CD plants at hours 69 through 90, three leaves, each from a different tree, were sampled.

Leaf sample collection

The first leaf with a blade length greater than or equal to 1 cm on each branch was designated ‘leaf 1’, and subsequent leaves were numbered by counting down the branch. Leaves from nodes 10 through 16 inclusive were sampled in this study, having previously been determined to have similar isoprene emission and IspS expression (Sharkey et al. 2008). Tissue samples were frozen in dry ice immediately after collection and stored at –80 °C until use.

Gas exchange and isoprene emission measurements

Gas exchange measurements were conducted as described by Wolfertz et al. (2003); most measurements were made at 30 °C and 1000 µmol m⁻² s⁻¹. The only measurements that were not were the last three time-points in the LD treatment; these measurements were made at 16 °C (for 20 °C-grown leaves) or 20 °C (for 30 °C-grown leaves), and 0 µmol photons m⁻² s⁻¹. This was done to ascertain whether leaves were emitting isoprene in the dark. The air exiting the leaf cuvette was analysed for isoprene content with a Fast Isoprene Sensor (Hills Scientific, Boulder, CO, USA) as described by Hanson & Sharkey (2001), or by gas chromatography as described by Wiberley et al. (2005), and leaf isoprene emission rates calculated as described by Singsaas et al. (1997).

It was known that isoprene emission and photosynthesis for dark-adapted leaves did not reach maximal values until they had been clamped at 30 °C and 1000 µmol m⁻² s⁻¹ for at least 20 min (Loreto & Sharkey 1990), so the CD leaves at hours 69 through 90, for both 20 °C and 30 °C-grown leaves, were kept in the Li-Cor cuvette (Lincoln, NE, USA) for 30 min, with photosynthesis and isoprene measurements taken every 5 min. The percentages of final emission and photosynthesis rates that were attained after 5 min in the measurement conditions (data not shown) were used to correct the emission capacities found for other dark-adapted leaves.

MEP pathway gene selection

The poplar genome underwent a duplication about 65 million years ago, from which 8000 paralogous pairs of genes survive (Tuskan et al. 2006). In searches of the poplar genome with Arabidopsis MEP pathway gene sequences and pathway-related keywords, it was found that six of this pathway's genes – DXS, deoxyxylulose 5-phosphate reductoisomerase (DXR), diphosphocytidylyl methylerythritol kinase (CMK), methylerythritol 2,4-cyclodiphosphate synthase (MCS), hydroxymethylbutenyl diphosphate synthase (HDS) and hydroxymethylbutenyl diphosphate reductase (HDR) – have two copies in the poplar genome. Poplar EST collections (at http://www.populus.db.umu.se/ and http://www.ncbi.nlm.nih.gov) totalling over 120 000 sequences were searched, and it was found that of these six genes, only DXR, MCS and HDS had both copies expressed in leaves (data not shown). Therefore, the single expressed copies of DXS, diphosphocytidylyl methylerythritol synthase (CMS), CMK, HDR, isopentenyl diphosphate isomerase (IDI) and IspS were analysed by quantitative PCR (QPCR), while both expressed copies of DXR (DXR XII and DXR XV), MCS (MCS I and MCS III) and HDS (HDS 66 and HDS IX) were analysed. In addition, one actin gene was found to be ubiquitously expressed, and this was selected as a standard, as its ortholog was previously found to be a suitable reference gene for circadian experiments in Arabidopsis (Kim et al. 2003; Lu, Gehan & Sharkey 2005).

RNA extraction and QPCR analysis

Total RNA was extracted as described by Haruta et al. (2001) and quantitated with a Beckman DU 640 spectrophotometer (Beckman Coulter, Inc., Fullerton, CA, USA). Chemicals were obtained from Sigma-Aldrich (St Louis, MO, USA) unless otherwise specified. RNA was treated with RQ1 RNase-free DNase to remove contaminating genomic DNA and then reverse transcribed with oligo(dT)15 primer and M-MLV reverse transcriptase according to the manufacturer's instructions (Promega Corp., Madison, WI, USA). A total of 3 µg of total RNA was reverse transcribed for each sample. QPCR was carried out on 2 µL of the RT product, using an Mx3000P real-time PCR system with Brilliant SYBR Green QPCR Master Mix (Stratagene, La Jolla, CA, USA), according to the manufacturer's instructions. Primer sequences are listed in Table 1. The thermal profile was: 95 °C for 10 min; 40 cycles of 95 °C for 30 s, T_anneal (see Table 1) for 1 min and 72 °C for 30 s; 95 °C for 1 min; T_anneal for 30 s and then a ramp up to 95 °C. SYBR Green fluorescence was recorded at the end of each annealing stage of the first 40 cycles and continuously during the last temperature ramp.

Table 1.  Primer sequences and T_anneals used for QPCR of methylerythritol 4-phosphate (MEP) pathway genes and actin

Gene (copy)	Tanneal (°C)	Primer	Primer sequence (5′→3′)	Amplicon length (bp)
DXS (X)	55	Fwd	TAGCTGCTGCCTCTTTAGTAGAACGC	217
		Rev	GGTCGCCACTTTAGTTTGCCATCAAG
DXR (XII)	51	Fwd	CTGGGGAGCAAGGAGTTGTA	183
		Rev	TGTGAGCAAGAGGGAGAACA
DXR (XV)	51	Fwd	AAGAGGCTCTGGCTGATGTC	141
		Rev	AGGCTTTAGGCCTGCACAAC
CMS (86)	51	Fwd	GGTGCAAACATGCCGAAGCAGTAT	200
		Rev	TCTTGTCTCTCCTTTCCTGGCAGT
CMK (I)	51	Fwd	GGCATTCCAATGGTTCTCATG	174
		Rev	AAAGGCAGGAGGTTCCAAAT
MCS (I)	51	Fwd	CAGCTGCAAGTACCACTGCT	281
		Rev	TCCTTTCCACTTGGGATCAG
MCS (III)	51	Fwd	TGGGTTTGATCTCCATAGGC	123
		Rev	TGAAGCTGCTCCTTTCCATT
HDS (66)	51	Fwd	CGATGAGCCCTGTGAAGAAT	241
		Rev	CTCCAGCATCTGTACCAGCA
HDS (IX)	51	Fwd	GGGAAGAGAGAAGCTGATGCA	150
		Rev	TCCTGGGTTGACACGAATCT
HDR (IX)	51	Fwd	TGGTGGAGGAAAAGTTGGAC	174
		Rev	CCAACTCCCCATGATTCAAC
IDI (XIX)	54	Fwd	ATGAGCTACTCCTTCAGCAACGCT	190
		Rev	TCAACTGGCACATCTTCAGC
IspS (64)	51	Fwd	ACAAATGCTGTTGAGAGATGG	198
		Rev	CCATTTTGCTTCTTGTAGGAATG
Actin (185)	54	Fwd	GGAGCTGAGAGATTCCGTTG	280
		Rev	ACCCTCCAATCCAGACACTG

Each target sequence had previously been amplified from a reverse-transcribed poplar RNA extract, and the resulting DNA was quantitated as previously described. Dilutions of these, containing known numbers of copies of the target sequences, were used to prepare standard curves that were used to determine the copy numbers of the plant samples. Plant sample reactions were spiked with 1000 copies of the target amplicon to eliminate the formation of primer dimers, and this number was subtracted from the copy numbers calculated by the software of the Mx3000P (Wiberley et al. 2005).

Protein extraction and Western blot analysis

Total protein was extracted from leaf samples, separated by sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS–PAGE), transferred to polyvinylidene difluoride (PVDF) membrane and analysed for the presence of IspS protein as described by Wiberley et al. (2008). The rabbit primary antibody was diluted 1:2500, and the donkey anti-rabbit secondary antibody was diluted 1:10 000. Blots were visualized using a Fujifilm LAS-3000 imaging system (Fujifilm Corporation, Tokyo, Japan), with 10 min exposures. Protein bands were quantitated using ImageJ (US National Institutes of Health, http://rsb.info.nih.gov/ij/).

Statistics

Data were analysed with JMP (version 5, SAS) using t-tests to determine differences, or with pair-wise t-tests using Microsoft Excel 2003.

RESULTS

Isoprene emission and photosynthesis capacities

Poplar leaves grown in both 20LD and 30LD showed daily changes in isoprene emission, with day-time emission capacity peaking at midday or in late afternoon on most days. These leaves had night-time emission capacities as high as those in the day, although isoprene was not actually being emitted unless the leaves were illuminated. Night-time emission capacities also showed peaks and troughs (Fig. 1a,d). Leaves grown in CL, in both temperatures, likewise showed two peaks in emission capacity: one near midday and one near the middle of the night (Fig. 1b,e). Those in CD were still capable of emitting isoprene after 3 d in dark, although emission capacity in that case did not follow a readily discernible pattern (Fig. 1c,f).

Figure 1. Relative isoprene emission capacities of 20 °C-grown leaves in light/dark (LD) (a) and in continuous light (CL) (b) or continuous dark (CD) (c), and of 30 °C-grown leaves in LD (d) and in CL (e) or CD (f). Dark grey background indicates that plants were in dark when emission capacity was measured, and light grey background indicates subjective night for plants in CL. Emission capacities are expressed relative to the average capacity for each treatment. All emission capacities were measured at 30 °C and 1000 µmol m⁻² s⁻¹ light, except for hours 69 through 75 in (a) and (d). These were measured at 16 °C and 0 µmol m⁻² s⁻¹ (a), and 20 °C and 0 µmol m⁻² s⁻¹ (c). Most values are the average of three leaves' data ± standard error.

Photosynthesis capacities in 20LD and 30LD leaves tended to rise during light periods to peak at midday and then fall to a daily minimum in the middle of the night (Fig. 2a,d). 20CL and 30CL leaves had fairly constant photosynthesis capacities in the light (Fig. 2b,e), and were still capable of carrying out photosynthesis after 1 or 3 d in CD, although capacities dropped with increasing time in the dark (Fig. 2c,f). All leaves that were emitting isoprene had net photosynthesis rates greater than zero.

Figure 2. Photosynthesis rates for 20 °C-grown leaves in light/dark (LD) (a) and in continuous light (CL) (b) or continuous dark (CD) (c), and for 30 °C-grown leaves in LD (d) and in CL (e) or CD (f). Meaning of shading is as described in Fig. 1 legend. All rates were measured at 30 °C and 1000 µmol m⁻² s⁻¹ light, except for hours 69 through 75 in (a) and (d), which were measured at 16 (a) or 20 °C (d), and 0 µmol m⁻² s⁻¹ light. Values are the averages of three leaves' rates ± standard error.

MEP pathway and IspS gene expression

The genes of the MEP pathway and IspS showed different patterns of mRNA accumulation over the course of a day, with or without CL. DXR XV, CMS (data not shown) and HDS IX (Fig. 3) generally had two daily peaks in mRNA accumulation, one near midday and the other near midnight. DXS (Fig. 4), HDR (data not shown) and IspS (Fig. 5) had one daily peak in mRNA accumulation, at or just before midday. In the case of DXS and possibly DXR XV, CMK, MCS I, HDS 66 and IspS, 30 °C-grown plants accumulated more mRNA than did 20 °C-grown ones. DXR XII, CMK, MCS I, MCS III, HDS 66 and IDI mRNA accumulation showed no patterns throughout the days studied.

Figure 3. Quantities of HDS IX mRNA for 20 °C-grown leaves in light/dark (LD) (a) and in continuous light (CL) (b), and for 30 °C-grown leaves in LD (c) and in CL (d), expressed relative to quantities of actin. Meaning of shading is as described in Fig. 1 legend. Values are the averages of one to three leaves' message quantities.

Figure 4. Quantities of DXS mRNA for 20 °C-grown leaves in light/dark (LD) (a) and in continuous light (CL) (b), and for 30 °C-grown leaves in LD (c) and in CL (d), expressed relative to quantities of actin. Meaning of shading is as described in Fig. 1 legend. Values are the averages of one to three leaves' message quantities.

Figure 5. Quantities of isoprene synthase (IspS) mRNA for 20 °C-grown leaves in light/dark (LD) (a) and in continuous light (CL) (b), and for 30 °C-grown leaves in LD (c) and in CL (d), expressed relative to quantities of actin. Meaning of shading is as described in Fig. 1 legend. Values are the averages of one to three leaves' message quantities.

Accumulated mRNA quantities decreased rapidly when plants were put in CD. Within less than a day and a half, mRNA quantities for almost all genes, at both temperatures, had dropped to zero. After 3 d in CD, only DXR XV, CMS and IDI had accumulated transcript in the 20 °C-grown plants, and only DXR XV, CMS and HDR had accumulated transcript in the 30 °C-grown plants; of these, only CMS had considerable accumulation at almost every time-point (Fig. 6).

Figure 6. Quantities of mRNA of methylerythritol 4-phosphate (MEP) pathway genes and isoprene synthase (IspS) in 20 (a) and 30 °C- (b) grown plants after varying times in continuous dark (CD), expressed relative to quantities of actin. Symbols: , DXS; , DXR XII; , DXR XV; , CMS; , CMK; ★, MCS I; □, MCS III; , HDS 66; , HDS IX; , HDR; , IDI; , IspS. Meaning of shading is as described in Fig. 1 legend. Nine hours in CD corresponds to hour 42. Values are the averages of one to three leaves' message quantities.

Two thousand base pairs upstream of the start codons of the MEP pathway genes (found on the Populus trichocarpa genome website, http://genome.jgi-psf.org/Poptr1_1/Poptr1_1.home.html) were analysed with PLACE (Higo et al. 1999) and PlantCARE (Lescot et al. 2002), which search DNA sequences for transcription factor binding sites. DXS, CMS, MCS, HDS and IspS promoter regions all had a ‘CAA(N)₄ATC’ motif within 300 bp of their start codons, which is associated with circadian regulation (Table 2), as did the promoters of some circadian-regulated genes in tomato (Piechulla, Merforth & Rudolph 1998). Barley light-responsive genes had a conserved ‘TATTCT’ 10 nucleotides upstream of the transcription start site, where it is important in circadian regulation (Thum et al. 2001), and this same motif was found in poplar DXS, CMS, MCS, HDS, HDR and IspS. DXS and IspS promoter regions (Table 2) were found to have a series of repeated GATA boxes with spacing and position comparable to those necessary for circadian regulation of some Arabidopsis genes (Anderson et al. 1994). The heat shock promoter element (A)₆TTTC was found immediately downstream of an activating CCAAT sequence in the upstream regions of DXS, HDR and IspS (Table 2), and fairly close to one in CMS.

Table 2.  Genetic regulation elements of the methylerythritol 4-phosphate (MEP) pathway

Gene	30/20 °C	Circadian	CAA(N)4ATC	TATTCT	GATA	HSE
For temperature response, the level of mRNA was compared for the high versus low temperature treatment. + indicates that the level was marginally higher in high temperature, ++ indicates it was substantially higher, and = indicates about the same in high temperature. C indicates an easily observed circadian rhythm with a single major peak in accumulation, while U indicates a repeating pattern but with two peaks in each 24 h period. The occurrence of circadian control elements as described in the text is indicated by an X as is the presence of a heat shock element close to the TATA box with a CCAAT box nearby upstream. mRNA levels were much lower for DXR XII, MCS I and HDS 66 than for their paralogs, and so these are not shown.
DXS	++	C	X	X	X	X
DXR XV	+	U
CMS	=	U	X	X
CMK	+	=
MCS III	=	=	X	X
HDS IX	=	U	X	X
HDR	=	C		X		X
IDI	=	=
IspS	+	C	X	X	X	X

IspS protein quantities

IspS protein accumulated to different levels in 20LD, 20CL, 30LD and 30CL plants, although these levels did not change with any discernible pattern or in any way that paralleled the observed changes in isoprene emission capacity (Fig. 7). IspS protein accumulated to significantly greater levels in 30 °C-grown plants than in 20 °C-grown ones. After 2–3 d in CD, IspS protein levels dropped, but just to one-half of those found in CL leaves (Fig. 8). Because there was no mRNA for IspS present in the CD-treated leaves, the change of protein amount depended only on the rate of protein degradation. Therefore, the half-life of IspS protein could be calculated. At 20 °C, the half-life was 5.3 d while at 30 °C it was 3.4 d.

Figure 7. Quantities of isoprene synthase (IspS) protein for 20 °C-grown leaves in light/dark (LD) (a) and in continuous light (CL) (b), and for 30 °C-grown leaves in LD (c) and in CL (d). Meaning of shading is as described in Fig. 1 legend. Values are the averages of three leaves' protein quantities ± standard error. Mean protein quantities (mg m⁻² leaf) for all time-points: 20LD = 2.19 ± 0.13; 30LD = 2.81 ± 0.13; 20CL = 2.89 ± 0.15; 30CL = 4.27 ± 0.16.

Figure 8. Isoprene synthase (IspS) protein in 20 and 30 °C continuous light (CL) (pale bars) and continuous dark (CD) (dark bars) leaves, after plants had been in CL or CD for 2–3 d. Bars show average protein quantities for hours 69 through 90 ± standard error.

DISCUSSION

Isoprene emission capacity from poplar leaves showed distinct rhythms throughout the day, and these rhythms corresponded to changes in mRNA accumulation for several of the MEP pathway genes and IspS, although not to changes in IspS protein. As was expected from previous work (Sharkey et al. 1999; Geron et al. 2000; Funk et al. 2003; Mayrhofer et al. 2005), emission capacity generally peaked at midday or early in the afternoon when plants were grown in LD conditions. The same pattern was seen in CL plants during subjective day, also in agreement with previous work (Wilkinson et al. 2006; Loivamäki et al. 2007). Unexpectedly, a peak in emission capacity was usually observed in the middle of the night for LD plants and the middle of subjective night for the CL plants. At night, the LD plants did not actually emit isoprene unless they were illuminated for measurement, but emission capacity still varied in a time-dependent fashion. The fact that these patterns were observed in CL conditions indicates that the rhythmic changes are free running, independent of changes in environmental conditions. They are also temperature compensated, having almost the same pattern in plants grown at 20 and 30 °C. The daily patterns observed in isoprene emission capacity cannot be called ‘circadian’, as they have a period of approximately 12 h rather than 24; rather, they are ‘ultradian’: distinct, reproducible changes throughout the day, even in the absence of daily light and temperature cycles, with a period of less than 24 h. The 20CL and 30CL data could be fitted with sine curves according to the equation:

• 

where for 20CL, A = 0.22, x_c = 3.9, w = 1.9 and u = 1; for 30CL, A = −0.22, x_c = 3.5, w = 2.1 and u = 1. The parameter w is the width of the sine curve; with eight sampling time-points in a day, a width of two indicates that there were two peaks and two troughs in emission capacity present per day.

Transcript accumulation for several genes in the MEP pathway showed similar patterns. DXS, HDR and IspS had daily mRNA accumulation peaks near midday. DXR XV, CMS and HDS IX generally had two daily peaks in transcript accumulation, one near midday and the other near midnight. These patterns were observed in LD as well as CL plants, and in 20 °C-grown leaves as well as 30 °C-grown ones. This is in good agreement with expression regulation predicted by an analysis of the promoters of the MEP pathway genes. All of the MEP pathway genes that were predicted to be circadian regulated by this analysis proved to be so regulated, with the exception of MCS. The observed circadian regulation of IspS transcript accumulation also agrees with the observations of Loivamäki et al. (2007). DXS and IspS appear to be the most highly regulated genes in the pathway; both had all of the control elements analysed in their promoters and exhibited the responses related to these elements, namely circadian regulation of transcript accumulation and increased transcript accumulation in higher temperature. A pair-wise t-test showed 30LD leaves to have significantly more DXS accumulation than 20LD leaves (P = 0.013); it was the only gene for which this was the case. The same test did not show significantly more IspS mRNA accumulation in 30LD leaves than in 20LD leaves. However, it may be that the IspS mRNA data were too variable both throughout the day and from day to day for an effect to be demonstrated. When peak IspS message levels (at the third time-point of each day) were averaged, it was found that 20LD levels were 17 ± 2% of 30LD levels. High variability may have masked this effect in statistical tests. The same may also have been the case for DXR XV, CMK, MCS I and HDS 66 (P = 0.1−0.14).

DXS, DXR, HDS, HDR and IspS have all been suggested to have regulatory roles in synthesis of plastidic isoprenoids, and the agreement between their transcript accumulation patterns and isoprene emission capacity suggests that one or more of them might be regulatory in isoprene emission as well. A correlation of metabolite and transcript levels does not prove that synthesis of the metabolite is under transcriptional control; regulation may be found in mRNA stability, translation or post-translational modification. However, comparison of MEP pathway mRNA accumulation patterns in isoprenoid-emitting and -non-emitting species support the idea that correlation between transcript accumulation and end-product synthesis may indicate a regulatory role for the gene in question. In Arabidopsis, which does not produce substantial quantities of plastidic isoprenoids, accumulation patterns for MEP pathway transcript accumulation are quite different from those seen in poplar. Arabidopsis DXS, CMS, HDS and HDR all show distinct daily patterns in mRNA accumulation, with a peak seen late in the dark period and early in the light period (Hsieh & Goodman 2005). Snapdragon flowers, which synthesize relatively large quantities of plastidic terpenoids, have peak DXS accumulation at 1500 and 1800 h, which is also when monoterpene emissions peak (Dudareva et al. 2005). The fact that transcript accumulation patterns for several of the pathway's genes differ in species that do not synthesize particularly large quantities of pathway end product compared to those that do, supports a key regulatory role for these genes in synthesis of the pathway end products.

Transcript for the MEP pathway genes accumulated, with or without pattern depending on the gene, in the light, but a few days in CD were sufficient, in most cases, to reduce transcript accumulation to zero. This lack of accumulation after 3 d in dark is seen in other circadian-regulated genes as well, for example, in transcript for components of the photosynthetic light-harvesting complex (Piechulla 1999). This observation also agrees with analysis of the promoters of the poplar MEP pathway genes, carried out as previously described; all of the genes' promoters had a variety of transcription factor binding sites associated with light-regulated transcription (Terzaghi & Cashmore 1995), located throughout their promoter regions.

IspS protein quantities did not change with patterns that paralleled those of emission capacity. Plants grown at 30 °C did have significantly (P = 0.05) more IspS protein than did 20 °C-grown ones, which also had more IspS transcript accumulation. Because the half-life of IspS is 3–5 d, the level of IspS will reflect the amount of mRNA that was present over as much as 1 week, and the rhythm of isoprene emission over 24 h cannot be explained by changes in mRNA level. Averaged over the 3 d of the CL experiment, there were about 12 copies of IspS per copy of actin per hour in 20 °C, and 26 copies per hour at 30 °C. If translation rate were linearly dependent on the amount of mRNA, this would support twice as much IspS protein, but the relatively faster rate of decay of the IspS amount at higher temperature can account for less than twice as much IspS in the 30CL treatment compared to the 20CL treatment.

Isoprene emission capacity exhibits distinct daily rhythms, which correspond to the transcript accumulation for some of the genes of the MEP pathway. These rhythms in emission capacity were not caused by changes in substrate availability from photosynthesis, as changes in emission were observed in CL while photosynthesis rate stayed essentially constant. However, because IspS, and likely many of the MEP pathway enzymes, turn over much more slowly than does the mRNA, the large circadian variability in mRNA amount does not directly determine the ultradian isoprene emission capacity. Because the K_m of IspS for DMADP is very high and in the range of the amount of DMADP found in chloroplasts, changes in either substrate supply or in IspS activity will change the rate of isoprene emission. Examples of both kinds of regulation are known (Brüggemann & Schnitzler 2002a; Sharkey et al. 2008). The data reported here indicate that environmental effects mediated through gene expression are likely to be found mostly at DXS and IspS with additional controls possible at CMS and HDR. Changes in metabolites may cause increased levels of IDI when isoprene emissions increase (Brüggemann & Schnitzler 2002b). Together with previous data on the regulation of isoprene emission capacity in mature leaves, this information indicates that isoprene emission capacity is regulated by an interaction of substrate supply from the MEP pathway and by IspS.

ACKNOWLEDGMENT

This research was supported by the National Science Foundation grant IOB-0640853.